ID: 963103084

View in Genome Browser
Species Human (GRCh38)
Location 3:141623874-141623896
Sequence GCCTCTCTCAGGTGACTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963103076_963103084 8 Left 963103076 3:141623843-141623865 CCCAGCCTCAGTAAGGACTTGGC No data
Right 963103084 3:141623874-141623896 GCCTCTCTCAGGTGACTCACTGG No data
963103073_963103084 12 Left 963103073 3:141623839-141623861 CCCGCCCAGCCTCAGTAAGGACT No data
Right 963103084 3:141623874-141623896 GCCTCTCTCAGGTGACTCACTGG No data
963103072_963103084 13 Left 963103072 3:141623838-141623860 CCCCGCCCAGCCTCAGTAAGGAC No data
Right 963103084 3:141623874-141623896 GCCTCTCTCAGGTGACTCACTGG No data
963103077_963103084 7 Left 963103077 3:141623844-141623866 CCAGCCTCAGTAAGGACTTGGCC No data
Right 963103084 3:141623874-141623896 GCCTCTCTCAGGTGACTCACTGG No data
963103070_963103084 16 Left 963103070 3:141623835-141623857 CCTCCCCGCCCAGCCTCAGTAAG No data
Right 963103084 3:141623874-141623896 GCCTCTCTCAGGTGACTCACTGG No data
963103074_963103084 11 Left 963103074 3:141623840-141623862 CCGCCCAGCCTCAGTAAGGACTT No data
Right 963103084 3:141623874-141623896 GCCTCTCTCAGGTGACTCACTGG No data
963103078_963103084 3 Left 963103078 3:141623848-141623870 CCTCAGTAAGGACTTGGCCCCAA No data
Right 963103084 3:141623874-141623896 GCCTCTCTCAGGTGACTCACTGG No data
963103067_963103084 29 Left 963103067 3:141623822-141623844 CCCTCCAGCAGGGCCTCCCCGCC No data
Right 963103084 3:141623874-141623896 GCCTCTCTCAGGTGACTCACTGG No data
963103069_963103084 25 Left 963103069 3:141623826-141623848 CCAGCAGGGCCTCCCCGCCCAGC No data
Right 963103084 3:141623874-141623896 GCCTCTCTCAGGTGACTCACTGG No data
963103068_963103084 28 Left 963103068 3:141623823-141623845 CCTCCAGCAGGGCCTCCCCGCCC No data
Right 963103084 3:141623874-141623896 GCCTCTCTCAGGTGACTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963103084 Original CRISPR GCCTCTCTCAGGTGACTCAC TGG Intergenic
No off target data available for this crispr