ID: 963103087

View in Genome Browser
Species Human (GRCh38)
Location 3:141623882-141623904
Sequence CAGGTGACTCACTGGGCACC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963103083_963103087 -8 Left 963103083 3:141623867-141623889 CCAAGAGGCCTCTCTCAGGTGAC No data
Right 963103087 3:141623882-141623904 CAGGTGACTCACTGGGCACCCGG No data
963103076_963103087 16 Left 963103076 3:141623843-141623865 CCCAGCCTCAGTAAGGACTTGGC No data
Right 963103087 3:141623882-141623904 CAGGTGACTCACTGGGCACCCGG No data
963103078_963103087 11 Left 963103078 3:141623848-141623870 CCTCAGTAAGGACTTGGCCCCAA No data
Right 963103087 3:141623882-141623904 CAGGTGACTCACTGGGCACCCGG No data
963103077_963103087 15 Left 963103077 3:141623844-141623866 CCAGCCTCAGTAAGGACTTGGCC No data
Right 963103087 3:141623882-141623904 CAGGTGACTCACTGGGCACCCGG No data
963103082_963103087 -7 Left 963103082 3:141623866-141623888 CCCAAGAGGCCTCTCTCAGGTGA No data
Right 963103087 3:141623882-141623904 CAGGTGACTCACTGGGCACCCGG No data
963103072_963103087 21 Left 963103072 3:141623838-141623860 CCCCGCCCAGCCTCAGTAAGGAC No data
Right 963103087 3:141623882-141623904 CAGGTGACTCACTGGGCACCCGG No data
963103074_963103087 19 Left 963103074 3:141623840-141623862 CCGCCCAGCCTCAGTAAGGACTT No data
Right 963103087 3:141623882-141623904 CAGGTGACTCACTGGGCACCCGG No data
963103070_963103087 24 Left 963103070 3:141623835-141623857 CCTCCCCGCCCAGCCTCAGTAAG No data
Right 963103087 3:141623882-141623904 CAGGTGACTCACTGGGCACCCGG No data
963103081_963103087 -6 Left 963103081 3:141623865-141623887 CCCCAAGAGGCCTCTCTCAGGTG No data
Right 963103087 3:141623882-141623904 CAGGTGACTCACTGGGCACCCGG No data
963103073_963103087 20 Left 963103073 3:141623839-141623861 CCCGCCCAGCCTCAGTAAGGACT No data
Right 963103087 3:141623882-141623904 CAGGTGACTCACTGGGCACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963103087 Original CRISPR CAGGTGACTCACTGGGCACC CGG Intergenic
No off target data available for this crispr