ID: 963107385

View in Genome Browser
Species Human (GRCh38)
Location 3:141658932-141658954
Sequence GTTTCCTTACGGAGGCTTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963107376_963107385 23 Left 963107376 3:141658886-141658908 CCACACAACTTTCACTGGACTGA No data
Right 963107385 3:141658932-141658954 GTTTCCTTACGGAGGCTTTGGGG No data
963107375_963107385 24 Left 963107375 3:141658885-141658907 CCCACACAACTTTCACTGGACTG No data
Right 963107385 3:141658932-141658954 GTTTCCTTACGGAGGCTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963107385 Original CRISPR GTTTCCTTACGGAGGCTTTG GGG Intergenic
No off target data available for this crispr