ID: 963107385 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:141658932-141658954 |
Sequence | GTTTCCTTACGGAGGCTTTG GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
963107376_963107385 | 23 | Left | 963107376 | 3:141658886-141658908 | CCACACAACTTTCACTGGACTGA | No data | ||
Right | 963107385 | 3:141658932-141658954 | GTTTCCTTACGGAGGCTTTGGGG | No data | ||||
963107375_963107385 | 24 | Left | 963107375 | 3:141658885-141658907 | CCCACACAACTTTCACTGGACTG | No data | ||
Right | 963107385 | 3:141658932-141658954 | GTTTCCTTACGGAGGCTTTGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
963107385 | Original CRISPR | GTTTCCTTACGGAGGCTTTG GGG | Intergenic | ||
No off target data available for this crispr |