ID: 963111371

View in Genome Browser
Species Human (GRCh38)
Location 3:141691172-141691194
Sequence AATTTAGATTAGCCTCCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963111371_963111374 29 Left 963111371 3:141691172-141691194 CCTTGTGGAGGCTAATCTAAATT No data
Right 963111374 3:141691224-141691246 TTTTTCTCTACCATGAGTCTGGG No data
963111371_963111375 30 Left 963111371 3:141691172-141691194 CCTTGTGGAGGCTAATCTAAATT No data
Right 963111375 3:141691225-141691247 TTTTCTCTACCATGAGTCTGGGG No data
963111371_963111373 28 Left 963111371 3:141691172-141691194 CCTTGTGGAGGCTAATCTAAATT No data
Right 963111373 3:141691223-141691245 GTTTTTCTCTACCATGAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963111371 Original CRISPR AATTTAGATTAGCCTCCACA AGG (reversed) Intergenic
No off target data available for this crispr