ID: 963111373

View in Genome Browser
Species Human (GRCh38)
Location 3:141691223-141691245
Sequence GTTTTTCTCTACCATGAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963111371_963111373 28 Left 963111371 3:141691172-141691194 CCTTGTGGAGGCTAATCTAAATT No data
Right 963111373 3:141691223-141691245 GTTTTTCTCTACCATGAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963111373 Original CRISPR GTTTTTCTCTACCATGAGTC TGG Intergenic
No off target data available for this crispr