ID: 963114383

View in Genome Browser
Species Human (GRCh38)
Location 3:141713926-141713948
Sequence TACTTGGCCCACTGGGGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 113}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963114383_963114390 11 Left 963114383 3:141713926-141713948 CCACATCCCCAGTGGGCCAAGTA 0: 1
1: 0
2: 1
3: 10
4: 113
Right 963114390 3:141713960-141713982 TACTGTAGAAAAAGCTTGCTGGG 0: 1
1: 0
2: 1
3: 61
4: 178
963114383_963114391 14 Left 963114383 3:141713926-141713948 CCACATCCCCAGTGGGCCAAGTA 0: 1
1: 0
2: 1
3: 10
4: 113
Right 963114391 3:141713963-141713985 TGTAGAAAAAGCTTGCTGGGTGG 0: 1
1: 0
2: 2
3: 30
4: 215
963114383_963114389 10 Left 963114383 3:141713926-141713948 CCACATCCCCAGTGGGCCAAGTA 0: 1
1: 0
2: 1
3: 10
4: 113
Right 963114389 3:141713959-141713981 CTACTGTAGAAAAAGCTTGCTGG 0: 1
1: 0
2: 0
3: 10
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963114383 Original CRISPR TACTTGGCCCACTGGGGATG TGG (reversed) Intergenic
902970593 1:20045302-20045324 TACTTGCCCCCCTGGGGAGGTGG + Intronic
903366441 1:22808206-22808228 CACTGGGCCCATTGTGGATGAGG + Intronic
906704349 1:47883983-47884005 TGCTTGACCCCCAGGGGATGTGG + Intronic
907405185 1:54249583-54249605 TACTTGGGAGACTGAGGATGTGG + Intronic
921139665 1:212295229-212295251 TGCTTGTCCAAGTGGGGATGGGG + Intronic
921277930 1:213537688-213537710 TTCTAGGCCCACAGGGAATGTGG + Intergenic
1067116253 10:43437330-43437352 GACTGGGCCCGCTGGGGGTGGGG + Intronic
1073394409 10:103206344-103206366 TACTTGCCCCCCAGGGGAGGTGG - Intergenic
1073683363 10:105728488-105728510 TACTTGCCCCCCAGGGGAGGTGG - Intergenic
1077077334 11:707574-707596 TCTTTGGCCCACTGGTGGTGGGG - Intronic
1078098963 11:8318373-8318395 TGCTTGACCCTCTGGGAATGAGG - Intergenic
1078355240 11:10627874-10627896 TTCGTGACCCACTGGAGATGAGG - Intronic
1078355554 11:10629327-10629349 TCCTAGGCCCTCTGGGGAAGAGG - Intronic
1079173224 11:18115896-18115918 ACCTTTGCCCAGTGGGGATGTGG + Intronic
1081539253 11:44018133-44018155 TCCTTCCCCCACTGGGGCTGGGG - Intergenic
1087681550 11:101224236-101224258 TATCTGGCTCACTGGGGTTGGGG + Intergenic
1092735381 12:11577690-11577712 TACTTGGCCCTCTGGGGGACTGG - Intergenic
1093022135 12:14213687-14213709 TACTTGGCCCAATGTGTATCAGG + Intergenic
1097263536 12:57733069-57733091 GGCTGGGTCCACTGGGGATGGGG + Intronic
1102448089 12:113018999-113019021 TACCTGGAGCTCTGGGGATGTGG + Intergenic
1103189820 12:118991733-118991755 TGTTTGAACCACTGGGGATGGGG + Intronic
1109361259 13:61298327-61298349 AACTTGGCCCACAAGGAATGAGG + Intergenic
1110094868 13:71505190-71505212 TACTTGGGACACTGAGGCTGAGG - Intronic
1112230501 13:97584813-97584835 TACTTGCCCCACTAGTTATGGGG + Intergenic
1121535121 14:94685863-94685885 GCCTGGGCCCACTGGGAATGTGG - Intergenic
1122170801 14:99873092-99873114 TACCTTGCTCAGTGGGGATGCGG + Intronic
1122486485 14:102085679-102085701 CCCTTGGACCCCTGGGGATGCGG - Intronic
1125828094 15:42692759-42692781 TACTCAGACCACTGTGGATGAGG + Exonic
1125896928 15:43310354-43310376 AACCTGGCCCCCTGGAGATGTGG - Intergenic
1128344915 15:66847692-66847714 TCCTGGGGGCACTGGGGATGTGG - Intergenic
1130765805 15:86869786-86869808 GACTTGGGCCACTTGGGATAAGG - Intronic
1130796791 15:87218182-87218204 CACTTGGTCCAATGGGGAAGTGG - Intergenic
1132243652 15:100278760-100278782 TCCTGGGCCCACTGGGTGTGGGG - Intronic
1133196879 16:4177326-4177348 TGCTTTCACCACTGGGGATGAGG - Intergenic
1136085694 16:27883296-27883318 TCCTTGGACAGCTGGGGATGGGG + Intronic
1138111753 16:54329737-54329759 TGCATGGCCCACTGGGGCTTGGG + Intergenic
1138427453 16:56945558-56945580 TGCTTGCCCCAGTGGGGATGGGG - Intergenic
1141453638 16:84122677-84122699 TGATTGGACCACTGTGGATGGGG - Exonic
1142671383 17:1488868-1488890 TACTGGAACCACAGGGGATGGGG + Intronic
1146929211 17:36765919-36765941 GGCTTGGCTCCCTGGGGATGGGG + Intergenic
1150652205 17:67017476-67017498 GAATTTGCCCACTGGGAATGGGG - Intronic
1152227119 17:79097630-79097652 TACTTGGCCCCGTGGGGCTCCGG - Intronic
1152612324 17:81321980-81322002 TACTTGTCCCACCGGGGCTCAGG + Intronic
1153299168 18:3577668-3577690 TTCTAGGACCAGTGGGGATGAGG - Intronic
1156386143 18:36606919-36606941 TCCTGGGCACACTGGGGTTGGGG + Intronic
1158721960 18:59933020-59933042 GGCTGGCCCCACTGGGGATGGGG - Intergenic
1162496861 19:11028183-11028205 TGCTGGGCGCACTGGGGAAGGGG + Intronic
1162660161 19:12162799-12162821 TACTTGGTCTGCGGGGGATGGGG - Intergenic
1162827789 19:13264291-13264313 AAGGTGACCCACTGGGGATGGGG - Intronic
1165435583 19:35793027-35793049 AACTTGGGCCCCTGGGGATGGGG + Intergenic
1165871197 19:38974796-38974818 TATTTGGCCGACAGGGGTTGGGG + Intronic
1167367397 19:49061931-49061953 CAATTGGCACACTGGGGAGGAGG + Exonic
1168612621 19:57813539-57813561 AACTAGGCCCACTGGTCATGGGG + Intronic
1168616182 19:57838882-57838904 AACTAGGCCCACTGGTCATGGGG - Intronic
1168620689 19:57877161-57877183 AACTAGGCCCACTGGTCATGGGG + Intronic
935317319 2:101848594-101848616 AACCAGGCCCACTGGGGTTGGGG + Intronic
936071709 2:109375620-109375642 GCCCTGGCCCACTGGGGAGGAGG - Intronic
936073199 2:109384791-109384813 GTCTTGGGCCCCTGGGGATGTGG + Intronic
936960588 2:118069789-118069811 TGCTTGGCACATTGGGGATGAGG - Intergenic
940373316 2:152925593-152925615 CCCTTGGCCCTCTGGGCATGTGG + Intergenic
942217961 2:173740875-173740897 TACTTTGCCAAATGGGTATGAGG - Intergenic
944260270 2:197668706-197668728 TACTTGGTCTATTAGGGATGGGG + Intronic
947808958 2:232987921-232987943 TGCTTGGCCCAGTGGCCATGTGG - Intronic
1169336882 20:4763960-4763982 AACTTGTCCCACTGTGGATGAGG - Intergenic
1170196993 20:13699473-13699495 TCCTTAGCCCACTGGGCAAGTGG - Intergenic
1170210065 20:13839208-13839230 TGCATTTCCCACTGGGGATGGGG + Intergenic
1172992426 20:39046482-39046504 TTCTTGACCCAGTGGTGATGGGG + Intergenic
1174266437 20:49335578-49335600 TACCTTGTCCACTGGGCATGGGG - Intergenic
1178162765 21:29938906-29938928 TACAGGGACCACTAGGGATGTGG - Intronic
1180997729 22:19973783-19973805 TACGTGGCCCACTGCGGAGGCGG + Exonic
1182701607 22:32244344-32244366 TACTCGCCCCTCTGTGGATGAGG - Intronic
1182782400 22:32878551-32878573 TGCTTGGCCCCCTGGGGTAGTGG - Intronic
1182879160 22:33718572-33718594 AACTTAGCCCACTGGCCATGTGG - Intronic
1184152281 22:42646119-42646141 TACTTGGCCCACTGCTGGTGAGG - Intronic
1185348263 22:50320026-50320048 TGCAGGGCCCACTGGGAATGGGG - Intronic
950904826 3:16528651-16528673 TAAGTGGCCCACTGGGGACTGGG - Intergenic
953270470 3:41437957-41437979 GACTTGGTGCTCTGGGGATGGGG + Intronic
959728245 3:109570112-109570134 TATTTAGCCCACTGGGGAGTTGG + Intergenic
961878467 3:130042646-130042668 GACTTGGCGCCCTGGGGATGGGG + Intergenic
963001838 3:140688553-140688575 TTCTGGGCCCAGTGGGGAAGTGG + Intronic
963114383 3:141713926-141713948 TACTTGGCCCACTGGGGATGTGG - Intergenic
963155986 3:142097899-142097921 TACTTGGGCCAGAGGGGCTGAGG - Intronic
963358458 3:144239781-144239803 TTCTTGGCCTTCTGGGAATGGGG - Intergenic
965668976 3:171126836-171126858 AACTAGGCCAACTGGGCATGTGG + Intronic
968886467 4:3336615-3336637 TCCTTGCCCCACTGGGGCTTAGG + Intronic
973190105 4:47376806-47376828 TACATGACTCACTGGGGTTGAGG - Intronic
976244889 4:82996915-82996937 TACCTGGGCCAGTGGAGATGAGG - Intronic
980680421 4:136152667-136152689 TACTCAGCCCAGTGGGGCTGTGG - Intergenic
985791935 5:1933525-1933547 AAATTGTCCCACAGGGGATGAGG - Intergenic
986399045 5:7361578-7361600 TGCTTGTGCCACTGGGGAAGAGG + Intergenic
989963882 5:50446653-50446675 TACTTGGCCTTTTGGGGGTGGGG - Intergenic
990338987 5:54803739-54803761 TACTTGGCTCAGTGAGTATGTGG - Intergenic
990593315 5:57287767-57287789 TACTTGACCCACTGGTCATTAGG - Intergenic
997666290 5:135632025-135632047 TTCTTGGCCTCCTGAGGATGAGG + Intergenic
1002335045 5:178471730-178471752 TACCTGGCCCATGGGTGATGAGG - Intronic
1004133227 6:12941324-12941346 TGCTTGGCCCACTGCAGTTGTGG + Intronic
1005883092 6:30075000-30075022 CACTTGGTCCACAGGGGAGGAGG - Intronic
1006209089 6:32377341-32377363 TATTTTCCCCACTGGGGATAAGG + Intergenic
1006368140 6:33628054-33628076 AGCTTGGCCCACTGGGGCGGTGG + Intronic
1007601973 6:43087860-43087882 GACTTGACCAACTGGTGATGTGG + Intronic
1010261652 6:73824110-73824132 TACTGAGACCACTGGGCATGGGG - Exonic
1013652210 6:112207018-112207040 TACTTGGCCAAGTGGGGCAGGGG + Exonic
1015666324 6:135633832-135633854 TGTTGGTCCCACTGGGGATGGGG + Intergenic
1017082744 6:150684600-150684622 TGATTGGCCCATGGGGGATGAGG + Intronic
1022955740 7:35378398-35378420 TCCTTGGCCCACTGTGGGGGTGG + Intergenic
1023653010 7:42390399-42390421 TACTTGGCACACTGAGCATCTGG + Intergenic
1024361522 7:48473698-48473720 TGCTTAGCCCAAGGGGGATGGGG + Intronic
1024524978 7:50340328-50340350 TACTTCCCCCACAGGGGATGTGG + Intronic
1028160690 7:87481403-87481425 TACTGAGCCCACTGGTGCTGTGG - Intergenic
1029424014 7:100485595-100485617 GACTCGGGCCTCTGGGGATGGGG - Intronic
1033265870 7:139886546-139886568 TACTTGGCCTACTGGAGATGTGG + Intronic
1035306953 7:157939536-157939558 TGATGGCCCCACTGGGGATGTGG - Intronic
1037709059 8:21341263-21341285 TACATGGCACAGAGGGGATGAGG + Intergenic
1038008366 8:23453633-23453655 TACTTGGCTAACAGGGGAAGGGG + Intronic
1039873261 8:41565251-41565273 TTCTTGGGTCACTGGGGATCAGG - Intergenic
1043403155 8:79903442-79903464 TGTTTGGCAAACTGGGGATGGGG - Intergenic
1049238187 8:141523168-141523190 TTCTGGGGCCGCTGGGGATGGGG + Intergenic
1059334017 9:113557392-113557414 TACTTGGGCCAATGAGGATCAGG - Intronic
1059734550 9:117088282-117088304 TACGTGGTACACTGGGGAAGGGG - Intronic
1061059698 9:128244382-128244404 CACTAGGACCACTGGGGATGTGG + Intronic
1062129765 9:134885986-134886008 CTCTTGGCCCACAGGGGATTGGG + Intronic
1062133386 9:134912379-134912401 CTCTTGGCCCACAGGGGATTGGG - Intronic
1062438270 9:136556739-136556761 TCCTGGGCCCACTGCAGATGGGG - Intergenic
1188384763 X:29542468-29542490 TACTTGGACCAATGGGCTTGTGG + Intronic
1198092219 X:133342657-133342679 TTCTTGGGCTACTGGGGATTCGG + Intronic