ID: 963126886

View in Genome Browser
Species Human (GRCh38)
Location 3:141824636-141824658
Sequence TTTTTCCCTTTTAAGATTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963126886_963126887 -3 Left 963126886 3:141824636-141824658 CCATAAATCTTAAAAGGGAAAAA No data
Right 963126887 3:141824656-141824678 AAAATGATACAAAGTACATAAGG No data
963126886_963126888 30 Left 963126886 3:141824636-141824658 CCATAAATCTTAAAAGGGAAAAA No data
Right 963126888 3:141824689-141824711 AGCACAAGTATTTTTTTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963126886 Original CRISPR TTTTTCCCTTTTAAGATTTA TGG (reversed) Intergenic
No off target data available for this crispr