ID: 963127293

View in Genome Browser
Species Human (GRCh38)
Location 3:141827572-141827594
Sequence TCTGCAGTTTTGAGGGGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963127293_963127305 23 Left 963127293 3:141827572-141827594 CCCTCACCCCTCAAAACTGCAGA No data
Right 963127305 3:141827618-141827640 CTGCCGCCCGCACATTCAGCTGG No data
963127293_963127300 -7 Left 963127293 3:141827572-141827594 CCCTCACCCCTCAAAACTGCAGA No data
Right 963127300 3:141827588-141827610 CTGCAGATGGACCAGGCCTCCGG No data
963127293_963127301 -2 Left 963127293 3:141827572-141827594 CCCTCACCCCTCAAAACTGCAGA No data
Right 963127301 3:141827593-141827615 GATGGACCAGGCCTCCGGAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963127293 Original CRISPR TCTGCAGTTTTGAGGGGTGA GGG (reversed) Intergenic
No off target data available for this crispr