ID: 963127297

View in Genome Browser
Species Human (GRCh38)
Location 3:141827579-141827601
Sequence TGGTCCATCTGCAGTTTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963127297_963127309 24 Left 963127297 3:141827579-141827601 CCCTCAAAACTGCAGATGGACCA No data
Right 963127309 3:141827626-141827648 CGCACATTCAGCTGGCACTCAGG No data
963127297_963127310 25 Left 963127297 3:141827579-141827601 CCCTCAAAACTGCAGATGGACCA No data
Right 963127310 3:141827627-141827649 GCACATTCAGCTGGCACTCAGGG No data
963127297_963127305 16 Left 963127297 3:141827579-141827601 CCCTCAAAACTGCAGATGGACCA No data
Right 963127305 3:141827618-141827640 CTGCCGCCCGCACATTCAGCTGG No data
963127297_963127301 -9 Left 963127297 3:141827579-141827601 CCCTCAAAACTGCAGATGGACCA No data
Right 963127301 3:141827593-141827615 GATGGACCAGGCCTCCGGAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963127297 Original CRISPR TGGTCCATCTGCAGTTTTGA GGG (reversed) Intergenic
No off target data available for this crispr