ID: 963127301

View in Genome Browser
Species Human (GRCh38)
Location 3:141827593-141827615
Sequence GATGGACCAGGCCTCCGGAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963127297_963127301 -9 Left 963127297 3:141827579-141827601 CCCTCAAAACTGCAGATGGACCA No data
Right 963127301 3:141827593-141827615 GATGGACCAGGCCTCCGGAACGG No data
963127298_963127301 -10 Left 963127298 3:141827580-141827602 CCTCAAAACTGCAGATGGACCAG No data
Right 963127301 3:141827593-141827615 GATGGACCAGGCCTCCGGAACGG No data
963127288_963127301 12 Left 963127288 3:141827558-141827580 CCCCCACGCTGGTCCCCTCACCC No data
Right 963127301 3:141827593-141827615 GATGGACCAGGCCTCCGGAACGG No data
963127291_963127301 9 Left 963127291 3:141827561-141827583 CCACGCTGGTCCCCTCACCCCTC No data
Right 963127301 3:141827593-141827615 GATGGACCAGGCCTCCGGAACGG No data
963127296_963127301 -8 Left 963127296 3:141827578-141827600 CCCCTCAAAACTGCAGATGGACC No data
Right 963127301 3:141827593-141827615 GATGGACCAGGCCTCCGGAACGG No data
963127290_963127301 10 Left 963127290 3:141827560-141827582 CCCACGCTGGTCCCCTCACCCCT No data
Right 963127301 3:141827593-141827615 GATGGACCAGGCCTCCGGAACGG No data
963127289_963127301 11 Left 963127289 3:141827559-141827581 CCCCACGCTGGTCCCCTCACCCC No data
Right 963127301 3:141827593-141827615 GATGGACCAGGCCTCCGGAACGG No data
963127293_963127301 -2 Left 963127293 3:141827572-141827594 CCCTCACCCCTCAAAACTGCAGA No data
Right 963127301 3:141827593-141827615 GATGGACCAGGCCTCCGGAACGG No data
963127292_963127301 -1 Left 963127292 3:141827571-141827593 CCCCTCACCCCTCAAAACTGCAG No data
Right 963127301 3:141827593-141827615 GATGGACCAGGCCTCCGGAACGG No data
963127294_963127301 -3 Left 963127294 3:141827573-141827595 CCTCACCCCTCAAAACTGCAGAT No data
Right 963127301 3:141827593-141827615 GATGGACCAGGCCTCCGGAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963127301 Original CRISPR GATGGACCAGGCCTCCGGAA CGG Intergenic
No off target data available for this crispr