ID: 963127302

View in Genome Browser
Species Human (GRCh38)
Location 3:141827599-141827621
Sequence GCAGTGCCGTTCCGGAGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963127302_963127310 5 Left 963127302 3:141827599-141827621 CCAGGCCTCCGGAACGGCACTGC No data
Right 963127310 3:141827627-141827649 GCACATTCAGCTGGCACTCAGGG No data
963127302_963127309 4 Left 963127302 3:141827599-141827621 CCAGGCCTCCGGAACGGCACTGC No data
Right 963127309 3:141827626-141827648 CGCACATTCAGCTGGCACTCAGG No data
963127302_963127305 -4 Left 963127302 3:141827599-141827621 CCAGGCCTCCGGAACGGCACTGC No data
Right 963127305 3:141827618-141827640 CTGCCGCCCGCACATTCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963127302 Original CRISPR GCAGTGCCGTTCCGGAGGCC TGG (reversed) Intergenic
No off target data available for this crispr