ID: 963127303

View in Genome Browser
Species Human (GRCh38)
Location 3:141827604-141827626
Sequence GGGCGGCAGTGCCGTTCCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963127303_963127309 -1 Left 963127303 3:141827604-141827626 CCTCCGGAACGGCACTGCCGCCC No data
Right 963127309 3:141827626-141827648 CGCACATTCAGCTGGCACTCAGG No data
963127303_963127310 0 Left 963127303 3:141827604-141827626 CCTCCGGAACGGCACTGCCGCCC No data
Right 963127310 3:141827627-141827649 GCACATTCAGCTGGCACTCAGGG No data
963127303_963127305 -9 Left 963127303 3:141827604-141827626 CCTCCGGAACGGCACTGCCGCCC No data
Right 963127305 3:141827618-141827640 CTGCCGCCCGCACATTCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963127303 Original CRISPR GGGCGGCAGTGCCGTTCCGG AGG (reversed) Intergenic
No off target data available for this crispr