ID: 963127305

View in Genome Browser
Species Human (GRCh38)
Location 3:141827618-141827640
Sequence CTGCCGCCCGCACATTCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963127302_963127305 -4 Left 963127302 3:141827599-141827621 CCAGGCCTCCGGAACGGCACTGC No data
Right 963127305 3:141827618-141827640 CTGCCGCCCGCACATTCAGCTGG No data
963127292_963127305 24 Left 963127292 3:141827571-141827593 CCCCTCACCCCTCAAAACTGCAG No data
Right 963127305 3:141827618-141827640 CTGCCGCCCGCACATTCAGCTGG No data
963127294_963127305 22 Left 963127294 3:141827573-141827595 CCTCACCCCTCAAAACTGCAGAT No data
Right 963127305 3:141827618-141827640 CTGCCGCCCGCACATTCAGCTGG No data
963127293_963127305 23 Left 963127293 3:141827572-141827594 CCCTCACCCCTCAAAACTGCAGA No data
Right 963127305 3:141827618-141827640 CTGCCGCCCGCACATTCAGCTGG No data
963127303_963127305 -9 Left 963127303 3:141827604-141827626 CCTCCGGAACGGCACTGCCGCCC No data
Right 963127305 3:141827618-141827640 CTGCCGCCCGCACATTCAGCTGG No data
963127296_963127305 17 Left 963127296 3:141827578-141827600 CCCCTCAAAACTGCAGATGGACC No data
Right 963127305 3:141827618-141827640 CTGCCGCCCGCACATTCAGCTGG No data
963127297_963127305 16 Left 963127297 3:141827579-141827601 CCCTCAAAACTGCAGATGGACCA No data
Right 963127305 3:141827618-141827640 CTGCCGCCCGCACATTCAGCTGG No data
963127298_963127305 15 Left 963127298 3:141827580-141827602 CCTCAAAACTGCAGATGGACCAG No data
Right 963127305 3:141827618-141827640 CTGCCGCCCGCACATTCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963127305 Original CRISPR CTGCCGCCCGCACATTCAGC TGG Intergenic
No off target data available for this crispr