ID: 963127310

View in Genome Browser
Species Human (GRCh38)
Location 3:141827627-141827649
Sequence GCACATTCAGCTGGCACTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963127302_963127310 5 Left 963127302 3:141827599-141827621 CCAGGCCTCCGGAACGGCACTGC No data
Right 963127310 3:141827627-141827649 GCACATTCAGCTGGCACTCAGGG No data
963127297_963127310 25 Left 963127297 3:141827579-141827601 CCCTCAAAACTGCAGATGGACCA No data
Right 963127310 3:141827627-141827649 GCACATTCAGCTGGCACTCAGGG No data
963127296_963127310 26 Left 963127296 3:141827578-141827600 CCCCTCAAAACTGCAGATGGACC No data
Right 963127310 3:141827627-141827649 GCACATTCAGCTGGCACTCAGGG No data
963127303_963127310 0 Left 963127303 3:141827604-141827626 CCTCCGGAACGGCACTGCCGCCC No data
Right 963127310 3:141827627-141827649 GCACATTCAGCTGGCACTCAGGG No data
963127298_963127310 24 Left 963127298 3:141827580-141827602 CCTCAAAACTGCAGATGGACCAG No data
Right 963127310 3:141827627-141827649 GCACATTCAGCTGGCACTCAGGG No data
963127304_963127310 -3 Left 963127304 3:141827607-141827629 CCGGAACGGCACTGCCGCCCGCA No data
Right 963127310 3:141827627-141827649 GCACATTCAGCTGGCACTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963127310 Original CRISPR GCACATTCAGCTGGCACTCA GGG Intergenic
No off target data available for this crispr