ID: 963133066 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:141876353-141876375 |
| Sequence | GGCGGGCGTCCCCGCGCCGC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 197 | |||
| Summary | {0: 1, 1: 1, 2: 1, 3: 12, 4: 182} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 963133066_963133070 | 18 | Left | 963133066 | 3:141876353-141876375 | CCTGCGGCGCGGGGACGCCCGCC | 0: 1 1: 1 2: 1 3: 12 4: 182 |
||
| Right | 963133070 | 3:141876394-141876416 | CGTGCGTGCGACTAAACCTTCGG | 0: 1 1: 0 2: 0 3: 0 4: 7 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 963133066 | Original CRISPR | GGCGGGCGTCCCCGCGCCGC AGG (reversed) | Intronic | ||