ID: 963133066

View in Genome Browser
Species Human (GRCh38)
Location 3:141876353-141876375
Sequence GGCGGGCGTCCCCGCGCCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 1, 2: 1, 3: 12, 4: 182}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963133066_963133070 18 Left 963133066 3:141876353-141876375 CCTGCGGCGCGGGGACGCCCGCC 0: 1
1: 1
2: 1
3: 12
4: 182
Right 963133070 3:141876394-141876416 CGTGCGTGCGACTAAACCTTCGG 0: 1
1: 0
2: 0
3: 0
4: 7

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963133066 Original CRISPR GGCGGGCGTCCCCGCGCCGC AGG (reversed) Intronic