ID: 963133316

View in Genome Browser
Species Human (GRCh38)
Location 3:141877238-141877260
Sequence AAGCCGGGCCCCGAGAGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 124}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963133297_963133316 25 Left 963133297 3:141877190-141877212 CCGGGCCTCCCGCCCGGCGCGGC 0: 1
1: 0
2: 2
3: 65
4: 511
Right 963133316 3:141877238-141877260 AAGCCGGGCCCCGAGAGTGCAGG 0: 1
1: 0
2: 0
3: 6
4: 124
963133302_963133316 13 Left 963133302 3:141877202-141877224 CCCGGCGCGGCGCCGGAAGCCGG 0: 1
1: 0
2: 0
3: 23
4: 329
Right 963133316 3:141877238-141877260 AAGCCGGGCCCCGAGAGTGCAGG 0: 1
1: 0
2: 0
3: 6
4: 124
963133308_963133316 -6 Left 963133308 3:141877221-141877243 CCGGGGACCCCTGCCCGAAGCCG 0: 1
1: 0
2: 2
3: 23
4: 192
Right 963133316 3:141877238-141877260 AAGCCGGGCCCCGAGAGTGCAGG 0: 1
1: 0
2: 0
3: 6
4: 124
963133301_963133316 16 Left 963133301 3:141877199-141877221 CCGCCCGGCGCGGCGCCGGAAGC 0: 1
1: 0
2: 3
3: 14
4: 128
Right 963133316 3:141877238-141877260 AAGCCGGGCCCCGAGAGTGCAGG 0: 1
1: 0
2: 0
3: 6
4: 124
963133298_963133316 20 Left 963133298 3:141877195-141877217 CCTCCCGCCCGGCGCGGCGCCGG 0: 1
1: 0
2: 8
3: 58
4: 611
Right 963133316 3:141877238-141877260 AAGCCGGGCCCCGAGAGTGCAGG 0: 1
1: 0
2: 0
3: 6
4: 124
963133300_963133316 17 Left 963133300 3:141877198-141877220 CCCGCCCGGCGCGGCGCCGGAAG 0: 1
1: 0
2: 0
3: 20
4: 148
Right 963133316 3:141877238-141877260 AAGCCGGGCCCCGAGAGTGCAGG 0: 1
1: 0
2: 0
3: 6
4: 124
963133295_963133316 26 Left 963133295 3:141877189-141877211 CCCGGGCCTCCCGCCCGGCGCGG 0: 1
1: 0
2: 4
3: 38
4: 392
Right 963133316 3:141877238-141877260 AAGCCGGGCCCCGAGAGTGCAGG 0: 1
1: 0
2: 0
3: 6
4: 124
963133307_963133316 1 Left 963133307 3:141877214-141877236 CCGGAAGCCGGGGACCCCTGCCC 0: 1
1: 0
2: 2
3: 36
4: 313
Right 963133316 3:141877238-141877260 AAGCCGGGCCCCGAGAGTGCAGG 0: 1
1: 0
2: 0
3: 6
4: 124
963133304_963133316 12 Left 963133304 3:141877203-141877225 CCGGCGCGGCGCCGGAAGCCGGG 0: 1
1: 0
2: 0
3: 19
4: 173
Right 963133316 3:141877238-141877260 AAGCCGGGCCCCGAGAGTGCAGG 0: 1
1: 0
2: 0
3: 6
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963133316 Original CRISPR AAGCCGGGCCCCGAGAGTGC AGG Intronic