ID: 963138371

View in Genome Browser
Species Human (GRCh38)
Location 3:141928457-141928479
Sequence AGGGCTATGCCATTGGCCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 166}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963138359_963138371 25 Left 963138359 3:141928409-141928431 CCTGCTAGCTGGCCACCTGTCTG 0: 1
1: 0
2: 1
3: 18
4: 167
Right 963138371 3:141928457-141928479 AGGGCTATGCCATTGGCCCTTGG 0: 1
1: 0
2: 0
3: 14
4: 166
963138367_963138371 -9 Left 963138367 3:141928443-141928465 CCTGAGAATACCCAAGGGCTATG 0: 1
1: 0
2: 0
3: 6
4: 93
Right 963138371 3:141928457-141928479 AGGGCTATGCCATTGGCCCTTGG 0: 1
1: 0
2: 0
3: 14
4: 166
963138366_963138371 -8 Left 963138366 3:141928442-141928464 CCCTGAGAATACCCAAGGGCTAT 0: 1
1: 0
2: 2
3: 6
4: 117
Right 963138371 3:141928457-141928479 AGGGCTATGCCATTGGCCCTTGG 0: 1
1: 0
2: 0
3: 14
4: 166
963138362_963138371 13 Left 963138362 3:141928421-141928443 CCACCTGTCTGGGTAAGAGAACC 0: 1
1: 0
2: 0
3: 11
4: 166
Right 963138371 3:141928457-141928479 AGGGCTATGCCATTGGCCCTTGG 0: 1
1: 0
2: 0
3: 14
4: 166
963138363_963138371 10 Left 963138363 3:141928424-141928446 CCTGTCTGGGTAAGAGAACCCTG 0: 1
1: 0
2: 0
3: 18
4: 151
Right 963138371 3:141928457-141928479 AGGGCTATGCCATTGGCCCTTGG 0: 1
1: 0
2: 0
3: 14
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963138371 Original CRISPR AGGGCTATGCCATTGGCCCT TGG Intergenic
900108988 1:997820-997842 AGGGCCAGGCCAGTGACCCTGGG - Intergenic
901019358 1:6248168-6248190 TGGGCATTGCCATGGGCCCTGGG - Exonic
901620159 1:10578367-10578389 AGGGCTATGGCATTTTCCCTAGG + Intronic
901954527 1:12774785-12774807 AGAGCAATGACATTGGCACTAGG + Intergenic
902030123 1:13416247-13416269 AGAGCAATGACTTTGGCCCTGGG + Intronic
902132932 1:14279581-14279603 AGGGCTATGGCTTTGGACCAAGG - Intergenic
904042106 1:27591061-27591083 AGGGCTTTGACATTGGCCTGGGG - Intronic
904982721 1:34520442-34520464 AGTGCTATGACACTGGACCTTGG - Intergenic
907376543 1:54048043-54048065 AGAAGTATGCCATTGGTCCTAGG - Intronic
910442116 1:87263591-87263613 GGGGCTATGCCATTGTCCCAGGG + Intergenic
911518166 1:98894677-98894699 AGGCCTAGGCCAGTGGCCTTTGG - Intronic
915471841 1:156130349-156130371 AGAGCTCTGCCCTTGGCCCCAGG + Intronic
916071556 1:161173203-161173225 AGGCCTGTGCCATTGGCACAGGG - Intronic
916745688 1:167683309-167683331 AAGGCTAAGCCATTTGCCCCAGG + Intronic
917411845 1:174767204-174767226 AGGGCTGTGTCATGGGCCATTGG + Intronic
918048533 1:180955392-180955414 AGGGCTATGGCCTGGCCCCTGGG + Intergenic
923513927 1:234677763-234677785 AGGTGTATGACATTGGGCCTTGG - Intergenic
1067855643 10:49790624-49790646 AGGGCTGTGTCATGGGCCATTGG - Intergenic
1069896350 10:71682580-71682602 AGGGCAAGGCCAGTGGCCCTGGG - Intronic
1070723944 10:78775280-78775302 AGGGCTCTGACCTTGGACCTTGG - Intergenic
1071546586 10:86534595-86534617 TGGGCTCTGCAACTGGCCCTTGG + Intergenic
1071568266 10:86682600-86682622 AGGGCTATGCCAATTGCACAGGG - Intronic
1071829117 10:89354395-89354417 AGGGCAATGTCATGGGCCATTGG + Intronic
1073543059 10:104327995-104328017 AGGTCTATGCCAGTTGCTCTGGG - Intronic
1075532621 10:123242816-123242838 AGGACTATGCCCTTGGTCCTAGG - Intergenic
1077011336 11:380608-380630 AGGGCCATGCCAGGGGCCCCAGG + Intronic
1077285171 11:1762372-1762394 AGGGGAAGGCCAGTGGCCCTGGG - Intronic
1077939145 11:6821394-6821416 AGGGCTATGGTATTGCTCCTAGG - Intergenic
1080045235 11:27801052-27801074 AGGGCTATGTCTTGGGCCATTGG - Intergenic
1080731549 11:34960479-34960501 AGGGCACAGCCACTGGCCCTCGG + Exonic
1081329941 11:41790410-41790432 AGGGTTATGCCCATGGGCCTAGG + Intergenic
1083274718 11:61590286-61590308 AGAGCAATGACCTTGGCCCTGGG + Intergenic
1083674116 11:64316080-64316102 AGGGCAATGCCATCAGCCCCTGG + Exonic
1084044571 11:66561321-66561343 AGGCCAATGCCATTGGACCCTGG + Exonic
1084678660 11:70652055-70652077 AGGGCTCTGGCCTTGGCCCTGGG + Intronic
1089924089 11:122239241-122239263 ATAGCTATCCCATTGTCCCTGGG + Intergenic
1092305462 12:7296078-7296100 AGGGCTGTGTCATGGGCCATTGG + Intergenic
1095896416 12:47284370-47284392 AGGGCTGTGTCATGGGCCATTGG + Intergenic
1096779071 12:53981912-53981934 GGGGCCAGGGCATTGGCCCTGGG + Intergenic
1097492023 12:60282621-60282643 AGGCCTGTGCCAGTTGCCCTCGG + Intergenic
1101679130 12:106947724-106947746 AGGGCTGTGTCATGGGCCATTGG - Intergenic
1105344310 13:19559877-19559899 AGGGCAATGCCATCAGCCCCTGG - Intergenic
1105535724 13:21261697-21261719 AGGGCAATGCCATCAGCCCCTGG + Intergenic
1112868773 13:103942345-103942367 AGGGCTATGTCACAGGCCATGGG + Intergenic
1114237767 14:20837133-20837155 AGGGCTGTGTCATGGGCCATTGG - Intergenic
1114969319 14:28005749-28005771 AGGGCTATGGCAGTGGCCATTGG + Intergenic
1116141104 14:40995275-40995297 AGGCCTATGCCATACTCCCTGGG + Intergenic
1116243557 14:42379123-42379145 GGGGCTTTGCCATGGGCCCAGGG - Intergenic
1116309959 14:43312188-43312210 ATGGCTATGTCATGGGCCATGGG + Intergenic
1118395043 14:65329058-65329080 AGGGCTGTGTCATGGGCCATTGG - Intergenic
1122860734 14:104581305-104581327 AGGCCTAACCCAATGGCCCTGGG - Intronic
1123109827 14:105861033-105861055 AGGGCGATGCCAGTGGGGCTTGG + Intergenic
1124664063 15:31576646-31576668 AGGGCTATGTCATGGACCATTGG + Intronic
1125775926 15:42213558-42213580 TGGGCTATGCCACTGGCTCCAGG + Intronic
1126946083 15:53821992-53822014 AGGGCTGTGTCATGGGCCATTGG + Intergenic
1127818026 15:62629612-62629634 AAGGCTAAGCCATGAGCCCTTGG + Intronic
1127911507 15:63419889-63419911 AGTGCTATGCCATGGGCCACGGG + Intergenic
1130143522 15:81253785-81253807 TGAGCTATGCCATTGGCAGTGGG + Intronic
1130750940 15:86712673-86712695 AGGGCTATTCTATTAGTCCTGGG + Intronic
1132270261 15:100517933-100517955 AGCCCAATGCCATTGGCCCTTGG - Intronic
1133051629 16:3120352-3120374 GGGGCTGTTCCAGTGGCCCTGGG - Exonic
1135279952 16:21145783-21145805 AGAGCTATGCCATTGTCCAAAGG - Intronic
1135869812 16:26138862-26138884 AGGGCTAAGCCTTGGGACCTAGG + Intergenic
1135951160 16:26915750-26915772 AGGGCTATGCCCTTGGCTGCAGG - Intergenic
1138226088 16:55296377-55296399 AGGGCTACCCCATTGGGCCATGG + Intergenic
1138839645 16:60484402-60484424 TGGGCTAAGCCAGTGGCCCCAGG - Intergenic
1139122967 16:64042897-64042919 AGGCCTATGCCATCCTCCCTGGG - Intergenic
1140047823 16:71454192-71454214 TGAGCTATGGAATTGGCCCTAGG - Exonic
1143386015 17:6530956-6530978 AGAGCTGTGCCACTGGCCCACGG + Intronic
1145851754 17:28105873-28105895 AGGGCTATGGCTTTGGCTTTGGG - Intronic
1148100586 17:45088188-45088210 AGGGCTTAGCCAGTGGGCCTGGG - Intronic
1151087372 17:71396082-71396104 AGGGCTAGACCATGGGCACTTGG + Intergenic
1151183776 17:72349068-72349090 AGGGCTATGGCACGGGCTCTGGG - Intergenic
1152824022 17:82452638-82452660 AGGGCTGTGTCGCTGGCCCTTGG + Intergenic
1153832965 18:8939383-8939405 AGGGCTGTGTCATGGGCCATTGG - Intergenic
1153847297 18:9061583-9061605 AGGGCTGGGCCCTTAGCCCTGGG - Intergenic
1156541335 18:37913848-37913870 TGGTCTAAGCCATTGCCCCTGGG - Intergenic
1160017819 18:75157835-75157857 AGGGCTGTGCCACTTTCCCTGGG + Intergenic
1160339029 18:78070579-78070601 AAGCCTCAGCCATTGGCCCTTGG - Intergenic
1166548402 19:43648676-43648698 AGAGCTCTCCCATTGGCCCACGG + Exonic
1166909126 19:46138679-46138701 AGGGCTAAGGCAGTGGCCCCTGG + Intergenic
1167232755 19:48295835-48295857 ATGGCTGTGCCATGGGCCCGGGG + Intergenic
925325106 2:3012643-3012665 AGTGCTATGGCTTTGGTCCTGGG - Intergenic
926919683 2:17928018-17928040 AGGGCTATGTCACAGGCCATTGG + Intronic
927524044 2:23721210-23721232 AGGGCTATTATGTTGGCCCTGGG - Intergenic
928496839 2:31841534-31841556 ATGGCTATGGTATTGGGCCTAGG + Intergenic
928931531 2:36629857-36629879 AGGGCTATGTCACAGGCCATTGG + Intronic
931264715 2:60650435-60650457 AGGGCTATCTCTGTGGCCCTGGG - Intergenic
931446330 2:62330339-62330361 AGGGCTGTGTCATGGGCCATGGG - Intergenic
932217196 2:69974698-69974720 AGGGCTTCGCCATTCACCCTGGG + Intergenic
935515224 2:104028102-104028124 AGAGCTTTCCCATTGGCCGTTGG + Intergenic
936797396 2:116224039-116224061 AGGTCAATCCCAGTGGCCCTAGG + Intergenic
938941337 2:136172147-136172169 AGGGCTGTGCCATTGAAGCTGGG + Intergenic
939671715 2:145020654-145020676 AGTACTATGCCATTGGCTCTAGG - Intergenic
942543804 2:177041760-177041782 AGGGCTGTGTCATGGGCCATTGG + Intergenic
944720474 2:202418471-202418493 AGGGCTGTGTCATGGGCCCTTGG - Intronic
946382783 2:219360028-219360050 AGGGCAATGGCATTGGGTCTGGG - Intergenic
947949768 2:234136986-234137008 AGGGCTGTGTCATGGGCCATTGG + Intergenic
1171405942 20:24912611-24912633 GGGGCTGTGTCATGGGCCCTTGG + Intergenic
1177399926 21:20589870-20589892 AGGCCTATGCTATTGCTCCTAGG - Intergenic
1178290774 21:31366172-31366194 AATACTATGCCCTTGGCCCTTGG + Intronic
1178323399 21:31623439-31623461 TGGGCTTTGCCCTTGGCTCTTGG - Intergenic
1178401111 21:32285365-32285387 AGGGCTATGCTATAGCCCTTAGG + Intergenic
1179971284 21:44837706-44837728 AGGGCCATGCCTTTGCCCGTTGG + Intergenic
1180948759 22:19710985-19711007 AGGCACCTGCCATTGGCCCTTGG - Intergenic
1182978594 22:34646786-34646808 AGGGCTCTGCCAATTGCACTTGG + Intergenic
950114069 3:10439071-10439093 AGGGCAGTGCCCTTGGCCCTTGG - Intronic
951259744 3:20494073-20494095 GGGAGTATGCCATTGGCCTTGGG - Intergenic
951808623 3:26675330-26675352 AGGCCTATGCCATGAGCTCTAGG + Intronic
951808868 3:26677586-26677608 AGGTCTATGCCATTAGCACAGGG - Intronic
954925645 3:54231916-54231938 AAGGCTATTGCACTGGCCCTTGG + Intronic
955937277 3:64113547-64113569 AGGGCATTGCCATGGGCCCCGGG - Intronic
956701292 3:71961355-71961377 AAGCCCATGCCCTTGGCCCTGGG + Intergenic
956986417 3:74706626-74706648 AGGGCTATGTCATGGGCCATTGG - Intergenic
958546415 3:95557995-95558017 TGGGCTATACCATTTACCCTGGG - Intergenic
963138371 3:141928457-141928479 AGGGCTATGCCATTGGCCCTTGG + Intergenic
964458704 3:156897373-156897395 AGGGCTGTGTCATGGGCCATGGG - Intronic
965742394 3:171889847-171889869 GGGACTATGCCATGGGCCTTGGG - Intronic
967886625 3:194337818-194337840 GGGGCTATGCCAGTGGCACCTGG - Intergenic
968870719 4:3240758-3240780 AGGGCTATGCCAGTGGCTACAGG - Exonic
969170826 4:5361613-5361635 TGGCCTATGCCATTGATCCTTGG - Intronic
969312194 4:6360191-6360213 AGGGCTCTGCATGTGGCCCTGGG - Intronic
969558899 4:7933205-7933227 AGGGCTTTGCCACAGGCCTTAGG + Intronic
969757786 4:9161369-9161391 AGAGCTCTGCCTGTGGCCCTGGG + Intergenic
971953335 4:33382938-33382960 AGGCCTCAGCCATTGGCCCCAGG + Intergenic
974328138 4:60443278-60443300 AGGTCTATCCCATTGGCTCCAGG - Intergenic
976112033 4:81685880-81685902 AGGGCTGTGTCATAGGCCATTGG - Intronic
976738512 4:88334632-88334654 AGGGCTAGAGAATTGGCCCTGGG - Intergenic
977054614 4:92175599-92175621 AGGGTTTTGCCATGGACCCTTGG + Intergenic
978532129 4:109726124-109726146 AGGGCTATGCTATATGCTCTTGG + Intronic
981105194 4:140873253-140873275 AGAGCTGTGCCATTAGCCCAAGG + Intronic
981748585 4:148073050-148073072 AGGGCTGGGGCTTTGGCCCTGGG + Intergenic
982662635 4:158225224-158225246 AGAGATAGGCCACTGGCCCTTGG + Intronic
985285120 4:188329449-188329471 AGGGCTGTGTCATGGGCCATGGG - Intergenic
998385576 5:141755335-141755357 AGGGCTCTGACTTTGGCCCAGGG + Intergenic
1000386442 5:160678859-160678881 AGGGCTTTGACATGGGACCTGGG - Intronic
1000920096 5:167128071-167128093 AAGGCTATGCAATTTGCCCCAGG - Intergenic
1005357692 6:25000069-25000091 GGGGATATGCAAATGGCCCTGGG - Intronic
1010343203 6:74781439-74781461 AATACTATGCCATTGGCCTTGGG + Intergenic
1011861504 6:91763202-91763224 AGGGATATGCCACTGCCCATTGG + Intergenic
1014247318 6:119082092-119082114 AGGCCTATGCCCATGGACCTAGG - Intronic
1014572276 6:123024500-123024522 AGGGTCATGCCATTGGCTCTGGG + Intronic
1016548066 6:145246428-145246450 AGGGCTACGCCATAGGCCTTGGG - Intergenic
1017698294 6:157041414-157041436 AGGGGTATGTAATTAGCCCTGGG + Intronic
1017928185 6:158928648-158928670 AGGGCTCTACCATAGACCCTTGG + Intergenic
1021452219 7:20793653-20793675 AGGGCTTTTGCATTGCCCCTCGG - Intergenic
1021704167 7:23350668-23350690 AGGGCCCTGGCCTTGGCCCTGGG + Intronic
1021738690 7:23663800-23663822 AGGGCTGTGCCTTGGGCCATTGG + Intergenic
1022840296 7:34157794-34157816 AGGGCCATACCACTGGCCGTGGG + Intergenic
1023832594 7:44048580-44048602 AGGGCTTTGCCAGTGCCACTGGG - Intronic
1026606491 7:71820423-71820445 AGGGCTGTGTCATAGGCCATTGG + Intronic
1028446863 7:90934264-90934286 AGGGCTCTGCCATAGTCCCAGGG - Intronic
1028456523 7:91044084-91044106 AGGGCTGTGTCATGGGCCATTGG - Intronic
1033128687 7:138726754-138726776 AGGCCTGTTCCCTTGGCCCTTGG - Intronic
1034151976 7:148924203-148924225 AGGGCTCTGCCACTGGCTCTGGG - Intergenic
1036390818 8:8322950-8322972 AGGGCTGTGTCATGGGCCATAGG + Intronic
1036485154 8:9172774-9172796 ATGGGTATGCCCTTGGCTCTTGG + Intergenic
1036494807 8:9260602-9260624 TGGGATATGCCAGTGTCCCTGGG + Intergenic
1037540246 8:19864069-19864091 TGGTCTATGCCATTCCCCCTAGG + Intergenic
1037560206 8:20066644-20066666 AAGGCTATGCCATGCACCCTAGG - Intergenic
1042199843 8:66270731-66270753 AGGGTTATGTCATGGGCCATTGG - Intergenic
1043947865 8:86274791-86274813 TGGGCTGTGCCACTGGCCATTGG - Intronic
1045660632 8:104433980-104434002 AGGGCTGTGTCATAGGCCATTGG - Intronic
1045865957 8:106865859-106865881 AGGACTATGAACTTGGCCCTGGG + Intergenic
1049345913 8:142138550-142138572 AGGGCTACCACATAGGCCCTGGG - Intergenic
1049377974 8:142298084-142298106 TGGGCTCTGCCTGTGGCCCTCGG - Intronic
1049700249 8:144007813-144007835 TGGGCTCTCCCATGGGCCCTGGG - Intronic
1050965391 9:11795319-11795341 AGAGCTATGGCATTGGCCACTGG + Intergenic
1056170488 9:83980299-83980321 AGGGCGAAGCGATTGGCCCGAGG + Intronic
1056280857 9:85040137-85040159 AGTGATATGTCATTGTCCCTTGG + Intergenic
1056808399 9:89745821-89745843 AGAGCTATGTCCTTGGCCCAGGG - Intergenic
1059546676 9:115183005-115183027 AGGGCTATATCACTGGCCATTGG - Intronic
1060969640 9:127730807-127730829 AAGGCTCTGCCTCTGGCCCTGGG - Exonic
1062396144 9:136353642-136353664 GGGGCTCTGCCATGGGGCCTGGG + Intronic
1187739516 X:22340534-22340556 AAGGCTATGGCATTGCTCCTGGG - Intergenic
1193531745 X:82663072-82663094 AGGGCTGTGTCATGGGCCATTGG - Intergenic
1195115065 X:101688981-101689003 AGGTGTAGGTCATTGGCCCTTGG - Intergenic
1195135936 X:101907111-101907133 AGGCCCATGCCAGTGGACCTAGG + Intronic
1197351248 X:125386311-125386333 AGGGCTGTGTCATGGGCCATTGG - Intergenic
1198118467 X:133567495-133567517 AGGGCTCTGCCACAGGCCATTGG - Intronic
1198123686 X:133621003-133621025 AGGGCTGTGTCATGGGCCATTGG + Intronic