ID: 963138543

View in Genome Browser
Species Human (GRCh38)
Location 3:141929475-141929497
Sequence CTGTTAGGAAGCAGAATCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963138543_963138550 24 Left 963138543 3:141929475-141929497 CCCAAGATTCTGCTTCCTAACAG No data
Right 963138550 3:141929522-141929544 AAGGGCTACATCAGAGCACGAGG No data
963138543_963138549 6 Left 963138543 3:141929475-141929497 CCCAAGATTCTGCTTCCTAACAG No data
Right 963138549 3:141929504-141929526 AGGTGCTGCTGTTGCTTCAAGGG No data
963138543_963138548 5 Left 963138543 3:141929475-141929497 CCCAAGATTCTGCTTCCTAACAG No data
Right 963138548 3:141929503-141929525 CAGGTGCTGCTGTTGCTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963138543 Original CRISPR CTGTTAGGAAGCAGAATCTT GGG (reversed) Intergenic
No off target data available for this crispr