ID: 963140125

View in Genome Browser
Species Human (GRCh38)
Location 3:141940085-141940107
Sequence GAACCAGAAAGTCCTTCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963140124_963140125 19 Left 963140124 3:141940043-141940065 CCTTTGCTGGAGGTTTGAAAGCA No data
Right 963140125 3:141940085-141940107 GAACCAGAAAGTCCTTCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963140125 Original CRISPR GAACCAGAAAGTCCTTCCTG TGG Intergenic
No off target data available for this crispr