ID: 963141353

View in Genome Browser
Species Human (GRCh38)
Location 3:141948580-141948602
Sequence CCATAACCACACTGAGAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 160}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963141353_963141358 -8 Left 963141353 3:141948580-141948602 CCCCTCTCTCAGTGTGGTTATGG 0: 1
1: 0
2: 2
3: 14
4: 160
Right 963141358 3:141948595-141948617 GGTTATGGCAGGAATAGCTGAGG 0: 1
1: 1
2: 1
3: 19
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963141353 Original CRISPR CCATAACCACACTGAGAGAG GGG (reversed) Intergenic
900965982 1:5959015-5959037 CCAAAACAACTCTGAGAGTGGGG + Intronic
904344669 1:29859969-29859991 CCATAACCACCCTGAGAGGGAGG - Intergenic
908342753 1:63198850-63198872 ACAAAACCAAACTGATAGAGAGG + Intergenic
913246779 1:116876985-116877007 TTATAACCACACTCAGAGATAGG - Intergenic
915512303 1:156392900-156392922 CGATAATCACCCTGAGAGGGCGG + Intergenic
915653024 1:157333373-157333395 TCATAAACACTCTGAGAGATAGG + Intergenic
917736183 1:177922504-177922526 CCAGAACCACACATAGAAAGTGG - Intergenic
922702425 1:227769687-227769709 CCACAACCACAGTGACACAGTGG - Intronic
922988409 1:229884765-229884787 CCATAACCACTCTCATCGAGAGG + Intergenic
1065207292 10:23369456-23369478 CCAAACCCAGCCTGAGAGAGAGG - Intergenic
1065306004 10:24369465-24369487 CCATACCCTCACTGAGGGTGAGG + Intronic
1066181972 10:32971385-32971407 CCATAAGAACCCTGAGAAAGAGG - Intronic
1070354344 10:75625271-75625293 TCATAACAACCCTGTGAGAGAGG + Intronic
1072006193 10:91250538-91250560 CCCTGACCACTGTGAGAGAGAGG + Intronic
1072314283 10:94187004-94187026 AAATAACAAAACTGAGAGAGAGG + Intronic
1072743833 10:97926363-97926385 CCACAACGACGCTGAGAGGGAGG - Intronic
1075310303 10:121408089-121408111 CCACAACCACCCTGAGAGGTAGG + Intergenic
1075601579 10:123773127-123773149 TGATAACCACAATGAGGGAGGGG - Intronic
1075687300 10:124373237-124373259 CCATCAGCAAAGTGAGAGAGTGG + Intergenic
1077253342 11:1570368-1570390 GCAGACCCACAGTGAGAGAGAGG - Intronic
1079312502 11:19378977-19378999 CCAAAACCACACAGGGAGTGAGG - Intronic
1080761370 11:35252632-35252654 CCCAAGCCACACTGAGAAAGAGG + Exonic
1083295020 11:61710546-61710568 CCACAACCACCCAGGGAGAGGGG - Intronic
1086072570 11:82815218-82815240 CCACAAACACCCTGAGTGAGAGG - Intergenic
1086785474 11:90964913-90964935 CAATAACCAAAATAAGAGAGTGG + Intergenic
1086790212 11:91027919-91027941 CCAGAACCTCACTCAGAGAGAGG - Intergenic
1087211887 11:95453359-95453381 TCATAAGCACTCTGAGAGTGGGG + Intergenic
1089260515 11:117220911-117220933 TCAGAACCACACAGAGAGAAGGG - Intronic
1089368792 11:117938746-117938768 CCATAAAAGCACTGAGTGAGGGG + Intergenic
1089922767 11:122226530-122226552 CCATCACACCACTGAAAGAGAGG - Intergenic
1092232340 12:6783137-6783159 CCAGAACCACCCTCTGAGAGTGG + Intergenic
1094711714 12:32970612-32970634 TCATAAACACACTGGGACAGGGG + Intergenic
1098967793 12:76811159-76811181 CCATAACCACCCGGAGGGAAGGG + Intronic
1101776291 12:107797274-107797296 CCACAAAAACAATGAGAGAGAGG + Intergenic
1102675711 12:114657158-114657180 CAAAAACCACAGGGAGAGAGAGG - Intergenic
1105683095 13:22749982-22750004 TCTTTACCACACTGAGAAAGTGG - Intergenic
1106120965 13:26859894-26859916 CCATGACCACACACAGAGGGTGG - Intergenic
1106217715 13:27718121-27718143 TCATGACCACACTCAGAGACAGG + Intergenic
1107349772 13:39501734-39501756 CCATGACCACACTAAGAGCAGGG - Intronic
1113939371 13:114010551-114010573 TCATATCCACAGGGAGAGAGGGG + Intronic
1116106932 14:40520655-40520677 CCATTACCACAGTGAGAGAGGGG - Intergenic
1119636002 14:76273938-76273960 CCAGTACCACAAAGAGAGAGGGG - Intergenic
1124960526 15:34389964-34389986 CCCCACCCACTCTGAGAGAGGGG + Intronic
1124977155 15:34536185-34536207 CCCCACCCACTCTGAGAGAGGGG + Intronic
1126868094 15:52957958-52957980 CCCTACACACACAGAGAGAGAGG - Intergenic
1128619406 15:69136207-69136229 TCACAACAACACTGAGAAAGAGG - Intergenic
1128792189 15:70441599-70441621 CCAGCACCTCACCGAGAGAGTGG - Intergenic
1130544766 15:84847168-84847190 CCATACACGCACAGAGAGAGAGG + Intronic
1132069255 15:98761350-98761372 GCCTAGCCACACTGAGAAAGGGG + Intronic
1133381812 16:5337174-5337196 CCAAAACCACAGTGAGGGGGAGG - Intergenic
1138252981 16:55519747-55519769 ACATAACAATACTGAAAGAGTGG + Intronic
1138366085 16:56478732-56478754 TCATAAACACACTGAGATAAAGG - Exonic
1139341592 16:66271135-66271157 CCAAAACCACACAGGTAGAGGGG + Intergenic
1141648785 16:85381560-85381582 TCATAACCTCACTAAGAGGGAGG + Intergenic
1149172125 17:53823747-53823769 CCATAACCACATTGTCCGAGGGG - Exonic
1151000956 17:70375641-70375663 CCAAAACCACAGGGAGAGAGGGG + Intergenic
1151006538 17:70443868-70443890 CCATAACTGCTCTGTGAGAGAGG + Intergenic
1152309937 17:79543932-79543954 CCACAAGCAGCCTGAGAGAGGGG + Intergenic
1153934333 18:9907443-9907465 ACATAACCACACTGAAGGGGCGG + Intergenic
1155275616 18:24184720-24184742 CCATCACCTCACAGAGAGAGGGG + Intronic
1157314030 18:46573540-46573562 CCATTACCCTACTGAGAGGGAGG + Intronic
1157571473 18:48715116-48715138 CCCTACCCACACTGTCAGAGGGG + Intronic
1157689608 18:49670338-49670360 CCATGACAACACTGTGAGGGAGG - Intergenic
1158549913 18:58426958-58426980 GCAGAACCAGACAGAGAGAGTGG - Intergenic
1159344563 18:67183536-67183558 TCATAATCACACTGTAAGAGAGG + Intergenic
1161577430 19:5062177-5062199 CCATATCCTGGCTGAGAGAGAGG - Intronic
1163507601 19:17717541-17717563 CCAGAACCAAAAAGAGAGAGAGG + Intergenic
1164521614 19:28984059-28984081 CCATGCCCACACTGAGGCAGGGG + Intergenic
1168115033 19:54217620-54217642 CCAGAACCACAGGGAGGGAGCGG - Intronic
1168120725 19:54251312-54251334 CCAGAACCACAGGGAGGGAGCGG - Intronic
1168177682 19:54636329-54636351 CCAGAACCACAGCGAGGGAGCGG + Intronic
1168181956 19:54667470-54667492 CCAGAACCACAGGGAGGGAGCGG + Intronic
1168185716 19:54698213-54698235 CCACAACTGCACTGAGAGGGAGG - Intronic
927492585 2:23530355-23530377 CCATCACCACTTTTAGAGAGGGG - Intronic
928136112 2:28688681-28688703 CCACAACCACACTCAGAGGTAGG - Intergenic
930217743 2:48714299-48714321 ACATAACCACACTGAGGGTTAGG - Intronic
930677208 2:54215931-54215953 CCATAACAAGACTGACAGATTGG - Intronic
933195270 2:79382383-79382405 ACATACCCAGACAGAGAGAGAGG - Intronic
934756200 2:96826634-96826656 CCCCAACCACACAGAGAGAGGGG - Intronic
935677728 2:105610011-105610033 CCATAAACAAAATGAAAGAGAGG - Intergenic
937471065 2:122174344-122174366 CCATAACCTCACAGAGAAAAGGG - Intergenic
938116106 2:128603843-128603865 TCTGAACCACCCTGAGAGAGGGG - Intergenic
938622281 2:133068510-133068532 CCAAAACTACACTGAGCAAGGGG + Intronic
938841357 2:135167794-135167816 CCAAATCCAGACTGTGAGAGAGG - Intronic
939834897 2:147118003-147118025 CCATATCCACACTGAAAGAAGGG - Intergenic
939848706 2:147278694-147278716 CCAGAACCACACTGAAAAACTGG - Intergenic
942253501 2:174067835-174067857 CCTGAAGCACAATGAGAGAGGGG - Intergenic
948621894 2:239240675-239240697 CCAGATGCACACTGAGAGGGAGG + Intronic
1169395199 20:5222942-5222964 CCATAACCACAATGAGCAAGTGG - Intergenic
1172098110 20:32470457-32470479 CCATAAGCACCCTGAGAGCCAGG - Intronic
1173983859 20:47245872-47245894 CCTCTAACACACTGAGAGAGAGG - Intronic
1176982178 21:15395941-15395963 CCAAAGCCTCACTGACAGAGTGG - Intergenic
1180753625 22:18144396-18144418 CCAAAACAATACTGAGAGGGAGG + Intronic
1180794148 22:18593815-18593837 CCATAGCCGCAGTGAGCGAGAGG + Intergenic
1181227590 22:21401505-21401527 CCATAGCCGCAGTGAGCGAGAGG - Intergenic
1181251060 22:21533334-21533356 CCATAGCCGCAGTGAGCGAGAGG + Intergenic
1181778377 22:25176066-25176088 ACAGAATCACACTGACAGAGGGG - Intronic
1181885827 22:26021794-26021816 TCATAGCCACCCTGAGAGATAGG - Intronic
1182109030 22:27709938-27709960 CCACAACCACAAGAAGAGAGAGG + Intergenic
1182542056 22:31048926-31048948 CCATAACCCCACCCAGGGAGGGG + Intergenic
1183484919 22:38083601-38083623 CCTTAGCAGCACTGAGAGAGTGG + Intronic
949807055 3:7966867-7966889 CCTTAACCTCACAGAGAGTGAGG - Intergenic
951687980 3:25365735-25365757 CCAAAACCACATTGAGAGTAAGG - Intronic
952387254 3:32851074-32851096 CCATAGTCACAGTGAGAAAGCGG - Intronic
953906445 3:46870664-46870686 ACATAGCCACACTGGGAGGGTGG - Intronic
956390236 3:68764229-68764251 CCATACCCCCACAGAGAAAGAGG + Intronic
960929789 3:122835229-122835251 CCAAAACCAGATTGAGAAAGAGG + Intronic
960968544 3:123122799-123122821 ACATAAGGACACAGAGAGAGAGG - Intronic
962842983 3:139252249-139252271 ACATAACCATCCTGAGAGGGGGG + Intronic
963141353 3:141948580-141948602 CCATAACCACACTGAGAGAGGGG - Intergenic
966050293 3:175608533-175608555 CGAAAAACACACTGGGAGAGAGG - Intronic
966571181 3:181445243-181445265 ACATAACCATCCTGAGACAGTGG + Intergenic
968517015 4:1019646-1019668 ACAGAACCACACTGAGGGGGTGG + Intronic
969394473 4:6911132-6911154 CCATACCCAAACTGAGATATGGG - Intronic
970350280 4:15195311-15195333 CCAAAAGCACAGTGAGGGAGTGG + Intergenic
970574422 4:17413546-17413568 CCATGAACCCACTGGGAGAGAGG - Intergenic
971365011 4:25970588-25970610 CAAAAACCAGGCTGAGAGAGGGG + Intergenic
975396666 4:73882748-73882770 TCAGAACCACACTGAAAGATGGG + Intergenic
979682248 4:123474322-123474344 CTATAAGTACACTGAGAGAGGGG + Intergenic
980210558 4:129781966-129781988 CCACAACCCCATTGGGAGAGGGG - Intergenic
982065119 4:151647933-151647955 GAATAAACAAACTGAGAGAGAGG + Intronic
987552601 5:19403337-19403359 CCATAACCACACTGTGCATGTGG - Intergenic
988685203 5:33519006-33519028 CCAAGACCAGACTGAAAGAGTGG + Intergenic
991023073 5:62001022-62001044 CCATAAACTGACTGATAGAGGGG - Intergenic
992447161 5:76844453-76844475 CCATCACATCACTGAGAGGGTGG - Intergenic
992887867 5:81176864-81176886 CCACAACCCCACTGAGGCAGAGG + Intronic
994642522 5:102427819-102427841 ACATACACACACAGAGAGAGGGG - Intronic
996892833 5:128442771-128442793 ACATACACACACAGAGAGAGAGG + Intronic
997054192 5:130421032-130421054 CCAAAACCACAATGAGATACTGG + Intergenic
997645380 5:135478095-135478117 CCACAACCAGACTCAGAGTGTGG - Intergenic
999491387 5:152054949-152054971 CCATAACTATAACGAGAGAGTGG + Intergenic
999982258 5:156968880-156968902 TCAAACCCACACTGAAAGAGTGG - Intergenic
1000608763 5:163352850-163352872 TCATAACCACACTGAATGATTGG + Intergenic
1000889413 5:166785257-166785279 TCATAACCACCCTGTGAGAAAGG - Intergenic
1004732137 6:18368248-18368270 ACATAACCACAGTGTGCGAGGGG + Intergenic
1005090763 6:22054465-22054487 CTTTAACCATACTGAGAGAGTGG + Intergenic
1006441934 6:34058513-34058535 CCAGAACCTCACAGAGAGTGAGG - Intronic
1010633123 6:78223655-78223677 CCATGACATCACTGAGAAAGTGG + Intergenic
1011190380 6:84721140-84721162 CCAAGATCACACTGAGAGACAGG - Intronic
1012521246 6:100123977-100123999 CCATAGCCTCAATGAGAAAGTGG - Intergenic
1015191000 6:130472251-130472273 CCATACACACACAGGGAGAGAGG + Intergenic
1016783008 6:147980646-147980668 TCATAACCACACCATGAGAGAGG + Intergenic
1017791367 6:157802431-157802453 CCATAACAACCCTCAGAGAAGGG - Intronic
1018712760 6:166508475-166508497 CCCTAACGACAGTGAGAGAGGGG - Intronic
1021411724 7:20336473-20336495 TCATAATCACACTGTGAGAGAGG + Intronic
1023805593 7:43870568-43870590 CCATGACCACACTGAGAAGAGGG + Intronic
1024750534 7:52459963-52459985 ATATAGCCACACTGAGAGTGAGG + Intergenic
1026099002 7:67369223-67369245 CCACACTCCCACTGAGAGAGGGG + Intergenic
1027711640 7:81611076-81611098 CCATCACCACACCGACAAAGTGG + Intergenic
1028383223 7:90222615-90222637 CCACAACCACCCTAAGAGACAGG - Intronic
1029165260 7:98584739-98584761 GCATAACCACACTGAAATAGGGG - Intergenic
1031355625 7:120783292-120783314 CAATAACCACACAGAAAGAATGG - Intergenic
1032514400 7:132496013-132496035 CCATCCCCACACTGGGAAAGAGG - Intronic
1033680932 7:143595926-143595948 CCATCAACAAACTGAGATAGTGG - Intergenic
1033703960 7:143865887-143865909 CCATCAACAAACTGAGATAGTGG + Intronic
1035945011 8:3953457-3953479 CCATAAACACACACAGAGAGAGG + Intronic
1040689578 8:49919295-49919317 ACAAAACCACACTGATTGAGGGG + Intronic
1044307098 8:90650391-90650413 CCATAGCCACACAGAGAAAGTGG + Intronic
1048123009 8:131602671-131602693 CCATATCCACACTGGGGCAGGGG + Intergenic
1048123081 8:131603628-131603650 CCATATCCACACTGGGGCAGGGG - Intergenic
1048176670 8:132158732-132158754 TCATAACCACCCTAAGAGATAGG - Intronic
1048281597 8:133109660-133109682 CCATAACCATCCTGAGGGGGTGG - Intronic
1049416847 8:142499239-142499261 CCATAACCACCCTGCCAGTGAGG - Intronic
1049510287 8:143023899-143023921 TCACAACCACACTGAGACGGGGG + Intergenic
1053353483 9:37428506-37428528 CCATAGCCACACAGCCAGAGGGG - Exonic
1055857570 9:80708930-80708952 CCACAACAACACTGAGACATAGG - Intergenic
1057768344 9:97943430-97943452 GCATCAACAGACTGAGAGAGAGG - Intronic
1059299715 9:113302611-113302633 CTAAAACCACCCTGTGAGAGAGG + Intronic
1060746679 9:126139503-126139525 TCATACACACACAGAGAGAGGGG - Intergenic
1061035948 9:128114408-128114430 CCATAAACAGACTGGGACAGTGG + Intergenic
1188820162 X:34765380-34765402 ACATAACCACACTGAGAGGATGG - Intergenic
1191745738 X:64484510-64484532 CAATAATCACATTGAGAGGGTGG - Intergenic
1192321558 X:70094344-70094366 CCAAAACAACCCTGTGAGAGAGG - Intergenic
1193734454 X:85140351-85140373 CCATAACAACCCTAAGAGGGTGG + Intergenic
1195956702 X:110338862-110338884 CCATAGCCTTCCTGAGAGAGAGG + Intronic
1199692828 X:150321625-150321647 CCATAACAACCCTGTGAGACAGG - Intergenic
1200093182 X:153645153-153645175 CCAGGAACACACTGAGAAAGGGG + Intronic