ID: 963143185

View in Genome Browser
Species Human (GRCh38)
Location 3:141964842-141964864
Sequence TTACCTCATCTGGAAATGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 258}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963143185_963143189 30 Left 963143185 3:141964842-141964864 CCAGACATTTCCAGATGAGGTAA 0: 1
1: 0
2: 0
3: 13
4: 258
Right 963143189 3:141964895-141964917 CAAGGCCTAAATTTTTTTACTGG 0: 1
1: 0
2: 1
3: 15
4: 173
963143185_963143188 12 Left 963143185 3:141964842-141964864 CCAGACATTTCCAGATGAGGTAA 0: 1
1: 0
2: 0
3: 13
4: 258
Right 963143188 3:141964877-141964899 ACTAATTATAAGATACATCAAGG 0: 1
1: 0
2: 0
3: 16
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963143185 Original CRISPR TTACCTCATCTGGAAATGTC TGG (reversed) Intronic
902318682 1:15644114-15644136 TTACATAATTAGGAAATGTCTGG - Intronic
903282442 1:22257645-22257667 TTTCCTCATCTGTAAATGGAAGG - Intergenic
903714933 1:25358298-25358320 TTCCTGCATATGGAAATGTCTGG - Intronic
904130339 1:28271126-28271148 TTTCCTCATCTGGCAAAGTGGGG + Intronic
906541053 1:46586307-46586329 TTAACTCATCTGGAGTTATCAGG - Intronic
906648344 1:47492147-47492169 TTTCCTCATCTGTAAATGGGCGG - Intergenic
906781330 1:48575588-48575610 TTTCCTCCTGTGGACATGTCTGG - Intronic
907108965 1:51909149-51909171 TAACCTCATCTAGAAATACCAGG - Exonic
907265013 1:53253502-53253524 CTACCTCACAGGGAAATGTCAGG + Intronic
908838014 1:68248088-68248110 TTGCCTCATGTGGAAATATGAGG - Intergenic
909584660 1:77276203-77276225 TTAACTAATCTTGAGATGTCGGG - Intergenic
910451399 1:87349871-87349893 TTACCTCATCTGTAAAACTGAGG - Intergenic
912016488 1:105043278-105043300 TTACATGTTCTGTAAATGTCAGG - Intergenic
912332366 1:108831355-108831377 TTACTTCCTGAGGAAATGTCTGG + Intronic
913164800 1:116175187-116175209 CTACTTCATCTAGGAATGTCAGG + Intergenic
913344486 1:117794446-117794468 TTAGCTCACATGGAAATGACTGG - Intergenic
915303838 1:154966699-154966721 TTTCCTCATCTGTAAAAGTGGGG - Intronic
917463177 1:175250151-175250173 TTCCCTGATCTGGAAAGGTTTGG - Intergenic
918266744 1:182849491-182849513 TTTCCTGATTTGGTAATGTCTGG + Intronic
919789444 1:201281148-201281170 TTACCTCATCTGAAAAAGAAGGG + Intergenic
920859489 1:209693865-209693887 TTAGCTCCTCTGGAACTCTCAGG + Intronic
920877756 1:209853312-209853334 TTACCTCATTCAGAAATGTGAGG + Exonic
920950455 1:210567382-210567404 TTTCCTCATCTGGAAATTAAGGG + Intronic
921780290 1:219155135-219155157 TTTCCACATATAGAAATGTCAGG + Intergenic
923806941 1:237267922-237267944 TTTCCTCATCTAGATATGTGTGG + Intronic
923822535 1:237461120-237461142 TTTCCTCATCGGAAAATGGCAGG + Intronic
1064618687 10:17191974-17191996 TTGCCTCATCTGACACTGTCAGG - Intronic
1065920806 10:30391293-30391315 TGACCTCATCTGTAAAAGGCTGG - Intergenic
1066095952 10:32072231-32072253 TTGCCTCCCCTGGAAATGACAGG + Intergenic
1066216476 10:33293168-33293190 TTACCTCATCTGAAAAAATAAGG - Intronic
1066438591 10:35416133-35416155 TTACCTGATCTGGAAACTTGTGG + Intronic
1066645261 10:37600936-37600958 TGACCTCATATGAAATTGTCTGG + Intergenic
1068422548 10:56814623-56814645 TTAGCCCATCTGGAAAGCTCAGG - Intergenic
1069739421 10:70678124-70678146 TTTCCTCATCTGCAAATGGATGG - Intronic
1070791214 10:79190409-79190431 TTTCCTCATCTGTAAATGTTAGG + Intronic
1071458111 10:85866967-85866989 TTACCTCATTTGATGATGTCCGG + Intronic
1071704345 10:87981125-87981147 TTTCTTCATCTGTAAATGTGGGG + Intergenic
1072402199 10:95115662-95115684 TTACTTCATCTTTAAATGTTTGG + Intergenic
1074882413 10:117669261-117669283 GTACCTGAGCTGCAAATGTCTGG + Intergenic
1076608282 10:131703572-131703594 GTACCTCATTTGGAAACGCCTGG + Intergenic
1078724458 11:13917161-13917183 TGACCTCATCTGCACATGTTTGG - Intergenic
1080926238 11:36759492-36759514 TTGGCACATCTGGCAATGTCTGG + Intergenic
1081811942 11:45918981-45919003 TTTCTTCATCTGGAGATATCTGG - Intergenic
1087155315 11:94896089-94896111 TTTCCTCATCTGTAAATGATGGG - Intergenic
1087695551 11:101371734-101371756 TTGCAAAATCTGGAAATGTCAGG + Intergenic
1088951720 11:114578457-114578479 TTACCTCATCTACAAAATTCAGG - Intronic
1089748247 11:120632001-120632023 CTTCCTCATCTGGAAATGAATGG + Intronic
1091446899 12:548950-548972 TTACCTCATCTGGAAAATAGGGG - Intronic
1091856458 12:3744545-3744567 TTTCCTCATCTGGAAAGGGTGGG + Intronic
1091866803 12:3845551-3845573 TTACCTCATCTAAAAATGAAGGG - Intronic
1091911521 12:4234240-4234262 TTTCCTCATCTGGAAAAGGGGGG + Intergenic
1096739193 12:53679530-53679552 TTTCCTCATTTGGAAAAATCAGG + Intergenic
1097384023 12:58928058-58928080 TTTCCTTATCTGGTAATGTGGGG - Intergenic
1098389148 12:69950999-69951021 TTCCCTATTCTGGAATTGTCAGG + Intronic
1099986490 12:89671570-89671592 TTACCTCATCTGGCAATTGGGGG - Intronic
1103404252 12:120664059-120664081 TCACCAGATCTGGAAATCTCAGG + Intronic
1104367652 12:128192589-128192611 TTTCCTCATCTGTAAATGGAAGG - Intergenic
1105484612 13:20814782-20814804 TTACTCCATCTGGAAATGCAGGG + Intronic
1107708122 13:43127050-43127072 TTACCTCATTTGGCTATGTAAGG + Intergenic
1109124198 13:58499334-58499356 TTACCTCATTTGGGATTATCTGG - Intergenic
1110230657 13:73164101-73164123 TTACCTCATCTGTAAAAATAGGG - Intergenic
1110624697 13:77639809-77639831 TATCCTACTCTGGAAATGTCAGG + Intronic
1111327484 13:86718488-86718510 TTAACTCTTCTTTAAATGTCTGG - Intergenic
1111858165 13:93667309-93667331 TTACATCGTCTGGAATTATCTGG - Intronic
1112756698 13:102642851-102642873 TTACTTTATCTGGAATTGACTGG + Intronic
1115766393 14:36627429-36627451 TTGCCTCATCTGTAAATGAGGGG + Intergenic
1116939501 14:50776692-50776714 TTACCCCATGTGAAACTGTCAGG - Intronic
1117498100 14:56326021-56326043 TTCCCTCATCTTTTAATGTCTGG - Intergenic
1117957289 14:61132381-61132403 TTTCCTCATCTGCAAAAATCAGG - Intergenic
1118210800 14:63764146-63764168 TGACTTAATCTGGGAATGTCTGG + Intergenic
1119543269 14:75454393-75454415 TTTCCTCATCTGCAAAAGTGGGG + Intronic
1123148036 14:106153467-106153489 TCTCCTCAGCTGGAAAAGTCAGG - Intergenic
1123158797 14:106257614-106257636 TCTCCTCAGCTGGAAAAGTCAGG - Intergenic
1125006288 15:34821526-34821548 TTCCCTCCTCAGCAAATGTCTGG + Intergenic
1125243776 15:37609610-37609632 TTACCTCATTAGGCAATTTCTGG - Intergenic
1128451709 15:67809713-67809735 TTTCCTCATCTGTCAATGTAGGG + Intergenic
1128882213 15:71254329-71254351 TTCCCTCATCTGTAAATGAAAGG + Intronic
1128882589 15:71257210-71257232 TTCTGTCATCTGGAAATGACGGG - Intronic
1129478428 15:75803619-75803641 TGACCTCATCTGTAAAAGACTGG + Intergenic
1129836516 15:78710939-78710961 TGACCTCATCTGTAAAAGGCTGG + Intronic
1130510669 15:84586763-84586785 TGACCTCATCTGTAAAAGGCTGG - Intergenic
1131160281 15:90101215-90101237 TTACCTCCTCTGGCCAGGTCAGG + Intronic
1131290342 15:91101331-91101353 TCACCTCTTCTGGAAAGGGCAGG - Intronic
1134335951 16:13299871-13299893 TTTCCTCATTTGCAAATGGCAGG + Intergenic
1134517690 16:14900330-14900352 TGACATCATCCGGCAATGTCAGG + Intronic
1134529377 16:14971122-14971144 TTTCCTCATCTGTAAAATTCTGG - Intergenic
1134705359 16:16298981-16299003 TGACATCATCCGGCAATGTCAGG + Intergenic
1134962182 16:18413133-18413155 TGACATCATCCGGCAATGTCAGG - Intergenic
1134966479 16:18495732-18495754 TGACATCATCCGGCAATGTCAGG - Intronic
1136565244 16:31065878-31065900 TTTCCTCATCTGGACACGTTAGG + Intronic
1137024015 16:35455570-35455592 TTTCCTCATCTGGAAAATCCAGG + Intergenic
1138469690 16:57223891-57223913 TTTCCTCATCTTTAAATGGCAGG - Intronic
1139866975 16:70069832-70069854 TTTCCTCATCTGTAAAATTCTGG + Intergenic
1140584326 16:76271097-76271119 TTAACTCTTCTTTAAATGTCTGG - Intergenic
1140753458 16:78046543-78046565 TTTCCTCATCTGTAAATTGCTGG + Intronic
1143459589 17:7093230-7093252 TTACTTCATCTTTAAATGTGTGG - Intergenic
1143587085 17:7855686-7855708 TTCCCACATCAGGAAAGGTCTGG + Exonic
1143866002 17:9924663-9924685 TTACCTTATTTTGAAATGTAAGG + Intronic
1144691130 17:17265060-17265082 TTACATTATTTGGAAATTTCTGG - Intronic
1145796446 17:27658269-27658291 TTAGCTCACCTGCAACTGTCTGG - Intergenic
1145810882 17:27763544-27763566 TTAACTCACCTGCAACTGTCTGG - Intronic
1146558038 17:33843657-33843679 ATAGCTCATCTGGCAATCTCAGG + Intronic
1146897668 17:36556814-36556836 GTACTGCATCTGGAAATGTAGGG - Intronic
1149673782 17:58439999-58440021 TGACCACTTCTGGTAATGTCAGG + Intronic
1151234402 17:72708571-72708593 TTACCTCATCTCCTAATATCGGG + Intronic
1151237801 17:72734229-72734251 TTCCCTCCTCTCTAAATGTCTGG - Intronic
1151372801 17:73659550-73659572 TGGCCTCAGCTGGAGATGTCTGG + Intergenic
1152055868 17:78025976-78025998 TTTTCTCATCTGGAAATGAAAGG - Intronic
1154122077 18:11660169-11660191 TTATGTCAGCTGGAAATGTTTGG - Intergenic
1154192383 18:12241471-12241493 TTGCCTATTCTGGACATGTCTGG + Intergenic
1156947202 18:42849055-42849077 TTTCCTCATCTGAAAATAGCAGG - Intronic
1157060150 18:44278585-44278607 CTGCCTCACATGGAAATGTCAGG - Intergenic
1158828734 18:61254367-61254389 TGACCTCAACTGGAAATTTTTGG - Intergenic
1159120105 18:64159082-64159104 TTCCATCATCTGGAAATGTGAGG - Intergenic
1159417512 18:68172429-68172451 TTAGCACATCTGCAAATGTTAGG - Intergenic
1159757615 18:72385422-72385444 ATTCCTGATTTGGAAATGTCTGG - Intergenic
1161239313 19:3213231-3213253 TTACATCATGTGGAAATGTGGGG + Intergenic
1162857201 19:13477948-13477970 TCACCACATCTGCAAATGTGTGG + Intronic
1163426199 19:17242411-17242433 TTTCCTCATCTGAAAATGGGAGG + Intronic
1163584732 19:18157455-18157477 TTTCCTCATCTGGAAACAACAGG + Intronic
1165059805 19:33199640-33199662 TTCCCTGATGTGGAAATTTCCGG + Intronic
1165162324 19:33824168-33824190 ATCCCTCATCTGGAAATGCTCGG + Intergenic
1165877405 19:39018642-39018664 TGAATTCATCTTGAAATGTCAGG - Intronic
1166407032 19:42528748-42528770 TTACCACATTTGGATATGCCAGG - Intronic
1166535799 19:43573936-43573958 TTTCCTCATCTGTAAAAGTGGGG + Intronic
1168211275 19:54892413-54892435 TGACGTCATCTGGAAAAGTGTGG - Intergenic
925878623 2:8332428-8332450 TTTCCTCATCTGTAAAAGTGAGG + Intergenic
928723503 2:34146736-34146758 TCACCTCATCTGTAAAGTTCTGG + Intergenic
929580302 2:43078063-43078085 TGACCTGATCTGGCAATGTATGG - Intergenic
935201033 2:100856834-100856856 ATAGCTCATCTGAAAAGGTCAGG - Intronic
935539498 2:104332962-104332984 TTACCTCCTCTGGCCATGGCTGG + Intergenic
936521302 2:113213445-113213467 TGACCTCCTCAGGAAATGCCAGG - Intergenic
938597027 2:132798251-132798273 TTATCTCATCTTGCAATCTCCGG + Intronic
939293140 2:140221077-140221099 TGACCTCATATGAAATTGTCTGG + Intergenic
939369107 2:141275391-141275413 GTACCTAAACTGGAAAAGTCAGG + Intronic
939552276 2:143629533-143629555 TTAGATCTACTGGAAATGTCTGG - Intronic
941347597 2:164389409-164389431 ATACCTCATCTGGCCATTTCTGG + Intergenic
941568977 2:167145560-167145582 TTCCCACATCTGGACATTTCTGG - Intronic
944769362 2:202898116-202898138 ATTCCTTATCTGGAAATGTTTGG - Intronic
948646726 2:239410008-239410030 TCACCTCACCTGGAAATGCTTGG + Intergenic
1170188206 20:13616458-13616480 ATACCTCATCAAGAAATGGCCGG + Intronic
1171342760 20:24443623-24443645 ACAGCTCATCTGGAAATGACTGG + Intergenic
1172856141 20:38004072-38004094 TTACCTCATCTGGAAAAAAAGGG + Intronic
1173256967 20:41400587-41400609 TTACCTCTTCTGGAAACCACAGG - Intergenic
1173445162 20:43111015-43111037 CTACTACATCTGGAAATGGCTGG + Intronic
1174884401 20:54316350-54316372 TTCCCTCATGTGGATATCTCAGG + Intergenic
1178166742 21:29986153-29986175 CTTCCTCAACTGGAAATCTCTGG - Intergenic
1178909641 21:36664236-36664258 TCCCCTCATCTGGAAATCTCAGG + Intergenic
1179920793 21:44506301-44506323 TTTCCTCATCTTGAGATGTGGGG - Intronic
1181505098 22:23349582-23349604 TTACCTCTTTTAAAAATGTCTGG + Intergenic
1182656214 22:31892241-31892263 TTTCCTCATCTGTAAATGAAGGG + Intronic
1183359907 22:37378044-37378066 CTTCCTCATCGGGGAATGTCTGG + Intronic
1184810918 22:46831197-46831219 CTCCCTCCTATGGAAATGTCAGG - Intronic
1185422079 22:50740369-50740391 TTTCCTCATCTGTAAATGGAGGG + Intronic
951457999 3:22914997-22915019 CTACCTCAACAGCAAATGTCAGG + Intergenic
951938229 3:28047491-28047513 TTAACTCATCCTTAAATGTCTGG - Intergenic
952611733 3:35217419-35217441 TTAACTCTTCTTGAAATGTTTGG + Intergenic
952735367 3:36685322-36685344 GCACCTCATTTGGAAGTGTCTGG - Intergenic
954128693 3:48548651-48548673 TTTCCTCATCTGTAAAAGTAGGG + Intronic
959383910 3:105677514-105677536 TTATCTCATGTAGAAATGTAAGG + Intronic
961622602 3:128236397-128236419 TTTCCTCATCTGTAAATGGCGGG + Intronic
963143185 3:141964842-141964864 TTACCTCATCTGGAAATGTCTGG - Intronic
963754740 3:149223434-149223456 TTTCCTCATCTGAAAATCTCAGG + Intergenic
963924474 3:150937120-150937142 TTACCTCTTTAAGAAATGTCTGG + Intronic
964133378 3:153316102-153316124 TTAACTCATCTGGAATTGTGTGG - Intergenic
965512760 3:169587056-169587078 TTCCCGCATCTGGAAAGGTGGGG - Intronic
966830738 3:184006165-184006187 TTACCTCAGCCGGAGATCTCTGG + Intronic
967359823 3:188617236-188617258 TTTTCTCATCTGTAAATGTAAGG - Intronic
968789979 4:2652942-2652964 TTACCACATCTGCAGATGACAGG + Intronic
970431013 4:15989122-15989144 TTTCCTCATCTAAAAATGTTGGG - Intronic
971052398 4:22875952-22875974 TTACCTCATCTGTAAAATACAGG - Intergenic
972479214 4:39482100-39482122 ACACCTCATCTTGGAATGTCTGG + Intergenic
972574717 4:40341193-40341215 TTACCTAATCTAAAAATGTCAGG - Intronic
975259521 4:72280392-72280414 TTTCCTCATCTGTAAATGGGAGG - Intergenic
975507376 4:75153213-75153235 TTAGCTCTTCTTTAAATGTCTGG + Intergenic
976049352 4:80993385-80993407 ATAACTCATCCGGAATTGTCAGG + Intergenic
977422112 4:96814816-96814838 TTACTCCATCTGAAAATGTGTGG + Intergenic
978895996 4:113888272-113888294 TAACTTCATCTGGAAACTTCAGG - Intergenic
982125506 4:152180629-152180651 CTACCTTTTCTGGAATTGTCAGG - Intergenic
984752748 4:183294632-183294654 TTATCTCATGAGAAAATGTCTGG - Intronic
984844142 4:184095760-184095782 TTCCCTCATCTGGGAATGGAGGG + Intronic
985347141 4:189017993-189018015 TAGCCCCATGTGGAAATGTCAGG - Intergenic
988524653 5:31976559-31976581 TTACTTCATCTGAGTATGTCAGG - Intronic
988531883 5:32034965-32034987 TTACCTTATCAGGAACTGGCAGG - Intronic
990040198 5:51370221-51370243 TTACAAGCTCTGGAAATGTCAGG - Intergenic
990309651 5:54525710-54525732 TTTCCTCATCTGTAAAAGTGAGG + Intronic
990587051 5:57222290-57222312 TTCCCTCATCTGTAAATGGTGGG - Intronic
990695722 5:58414731-58414753 TTACATCTTATGGAAATGTCTGG - Intergenic
990893051 5:60668648-60668670 ATTCCACATCTGGAAATGCCTGG - Intronic
991028428 5:62056016-62056038 TTAGCTCTTCTTTAAATGTCTGG + Intergenic
991777634 5:70100731-70100753 TTTCCTCATCAGGAAATTGCTGG + Intergenic
991856922 5:70976175-70976197 TTTCCTCATCAGGAAATTGCTGG + Exonic
992092623 5:73331924-73331946 TTTCTTCATCTGAGAATGTCTGG + Intergenic
993110638 5:83653223-83653245 TTACCTTACCTTGAAATGTTTGG - Intronic
995433513 5:112109373-112109395 TTGCCTCAGCTGGAGATGCCTGG + Intergenic
995710637 5:115031989-115032011 TTTCCTGAACTGGAAATGGCAGG - Intergenic
995724870 5:115171285-115171307 TCACCTCATCTGTAAATGGAGGG - Intronic
995926282 5:117379197-117379219 TTACTTCATTTGGAAATCTAGGG - Intergenic
997005461 5:129811684-129811706 TTTCCTCATCTGTAAATTACGGG + Intergenic
997721711 5:136083075-136083097 CTACCACATTTGGCAATGTCTGG - Intergenic
999671577 5:153963358-153963380 TTTCCTCATCTGTAAATGAGAGG + Intergenic
1000711743 5:164588428-164588450 TTGCCTCATCTCTAAATTTCTGG + Intergenic
1001011125 5:168099405-168099427 TTTCCTCATCTGGAAAAGTGGGG + Intronic
1001194142 5:169656253-169656275 TTTCCTCATCTGCAAATGTGAGG - Intronic
1003635096 6:7824854-7824876 TTTCCTCATCTGGAAAATACTGG - Intronic
1003835568 6:10069138-10069160 TTAGCACATCAGGAAGTGTCAGG + Intronic
1005618629 6:27599819-27599841 TTTCTTCATCTGCAAATGTAGGG - Intergenic
1007031420 6:38631003-38631025 TTACCTTACCTAGAAATGTTTGG + Intronic
1007238889 6:40411098-40411120 TTATCTCATCTGTAATTTTCTGG + Intronic
1008377106 6:50804606-50804628 TGAGCATATCTGGAAATGTCTGG - Intergenic
1008938080 6:57014002-57014024 TGACTTCATCTGGAAATGGCAGG + Intronic
1009503568 6:64448060-64448082 TTACCTCATCTGGGAAGCGCAGG + Intronic
1010128660 6:72465467-72465489 TGACCTCATCAAGAAATATCTGG + Intergenic
1013542595 6:111125380-111125402 TTACCTCCTCATGAAATTTCTGG + Intronic
1013974145 6:116058033-116058055 TTTCCTCATCTGCAACTCTCTGG - Intronic
1014471921 6:121826506-121826528 TTACCTCAATTCGAATTGTCTGG - Intergenic
1014505125 6:122246357-122246379 TTAGCTCTTCTTTAAATGTCTGG - Intergenic
1015565669 6:134567919-134567941 TTACCTCATCCAAGAATGTCTGG + Intergenic
1016218246 6:141629988-141630010 TTAATTCATCTTGAAATGTTTGG - Intergenic
1016498273 6:144689409-144689431 TTCCCACAGGTGGAAATGTCTGG + Intronic
1017618670 6:156272759-156272781 TTTCCTCATCTAAAAATGTAAGG + Intergenic
1018361273 6:163071994-163072016 TTAGTTCTTCTTGAAATGTCTGG - Intronic
1024601081 7:50982288-50982310 TTTCCTCATCTGTAAAAGACAGG + Intergenic
1026585839 7:71655576-71655598 TTTTCTCATCTGTAAATGACAGG - Intronic
1026591322 7:71698201-71698223 TTAGTTTATCTGAAAATGTCTGG - Intronic
1028403533 7:90450848-90450870 TTACCTCTTCTTTAAATGTTTGG + Intronic
1030607204 7:111650359-111650381 TGAACTAATGTGGAAATGTCAGG - Intergenic
1031067769 7:117124791-117124813 TGAGGTCATGTGGAAATGTCAGG + Intronic
1031287516 7:119888688-119888710 TTAACTCTTCTTGAAATGTTTGG + Intergenic
1031750472 7:125565303-125565325 TCCTCTCATCTGGAAATGTAAGG + Intergenic
1033041168 7:137919470-137919492 TTTCCTCATCTAGAAATGATAGG - Intronic
1033469206 7:141629175-141629197 ATGCCTAATCTGGAAATTTCAGG - Intronic
1033487358 7:141804213-141804235 TGACCTCATATGAAATTGTCTGG + Intergenic
1034214611 7:149395567-149395589 ATTCCTCATCTGCATATGTCTGG + Intergenic
1035309835 7:157959812-157959834 TTACCTCACGTGGAATTGTGGGG - Intronic
1035350547 7:158242610-158242632 TTAGTTCTTCTGGAAGTGTCTGG + Intronic
1040377286 8:46838611-46838633 TTTCATCATGTGGAAATGTTAGG + Intergenic
1041994740 8:64040231-64040253 TTACTTCATATGTGAATGTCAGG + Intergenic
1042737607 8:72005871-72005893 TTACTTCATCTGGAAAGGAATGG + Intronic
1043529075 8:81129961-81129983 TCACCTTATCTGGGAATGCCAGG + Intergenic
1045090044 8:98732361-98732383 TTTCCCCCTCTGGAAATTTCTGG - Intronic
1046431560 8:114134946-114134968 ACACATCATCTGGAAAGGTCTGG - Intergenic
1048554976 8:135466912-135466934 TTCCCTCATCTGCACATGGCAGG + Intronic
1051316071 9:15833824-15833846 TTTCCTCATCTGCAAATGATGGG - Intronic
1051738188 9:20224890-20224912 CTACTTCAACTAGAAATGTCTGG + Intergenic
1052034619 9:23666296-23666318 CTCCCTCATCTTGAGATGTCAGG - Intergenic
1055364699 9:75530160-75530182 TAATCTCATCTGAAAATGTAGGG - Intergenic
1055921748 9:81468110-81468132 CTGCCTCATCTAGAAATGTGTGG - Intergenic
1056461021 9:86810050-86810072 TTTCCTCACCTGGAAATGAATGG + Intergenic
1057415622 9:94859812-94859834 TTTGCTCATCTGTAAATGACAGG + Intronic
1057942051 9:99293780-99293802 TGACCTCTTCTGGAATTGCCCGG + Intergenic
1058978975 9:110151822-110151844 TTCCCTGCTCTGTAAATGTCAGG + Intronic
1059283850 9:113156306-113156328 TTTCCTCACCTGGAAATGAGAGG + Intronic
1059382880 9:113941966-113941988 TTTCCTCCTCTGGAAAAGGCAGG + Intronic
1059998220 9:119934340-119934362 TGACCTCATCTCGAAAGCTCAGG + Intergenic
1061184071 9:129041945-129041967 GTTCCTCGTCTGGAAATGACAGG + Intronic
1061749238 9:132764727-132764749 TTAGCTCTTCTTTAAATGTCTGG - Intronic
1061873006 9:133530592-133530614 TTACCTGATGTGGCATTGTCAGG + Intergenic
1185929481 X:4186247-4186269 CTACCTCACCTGGAGATGACTGG - Intergenic
1188096126 X:26024929-26024951 TTATCTCTTCTTTAAATGTCTGG - Intergenic
1188479107 X:30619495-30619517 ATACATTATCTGGTAATGTCTGG - Intergenic
1189144564 X:38642754-38642776 TTACATGATCAGGAAATGCCAGG - Intronic
1189881179 X:45494230-45494252 TTACTTCTTCTGTAAATGTTTGG + Intergenic
1190954663 X:55180892-55180914 TGACCTCATTTGAAATTGTCTGG + Intronic
1192162021 X:68795496-68795518 TTTCCTCATCTGTAAATCTAGGG + Intergenic
1194981223 X:100442606-100442628 TAACCTTTTGTGGAAATGTCAGG - Intergenic
1195592387 X:106644845-106644867 TTAGCTCTTCTTGAAATGTTTGG + Intronic
1196440288 X:115713604-115713626 TAACCTCATATGGTAATGTCTGG + Intergenic
1197781804 X:130167276-130167298 TTTCCTCATCTACAAATCTCAGG + Intergenic
1198973792 X:142312022-142312044 TTACTTTATCTGGAAGTGACAGG - Intergenic
1199075921 X:143525964-143525986 TTAGCTCATCTTTAAATGTTTGG + Intergenic
1199584670 X:149401843-149401865 TTAACTCATCTTTAAATGTTAGG + Intergenic