ID: 963154023

View in Genome Browser
Species Human (GRCh38)
Location 3:142077043-142077065
Sequence AGGGAGAGCTCAGTGACTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 706
Summary {0: 1, 1: 16, 2: 74, 3: 156, 4: 459}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963154011_963154023 27 Left 963154011 3:142076993-142077015 CCCCTGGCAGCAGCCATGTGGCA 0: 3
1: 9
2: 26
3: 95
4: 410
Right 963154023 3:142077043-142077065 AGGGAGAGCTCAGTGACTGTGGG 0: 1
1: 16
2: 74
3: 156
4: 459
963154014_963154023 14 Left 963154014 3:142077006-142077028 CCATGTGGCAGAAAGAGAGAATC 0: 1
1: 3
2: 10
3: 62
4: 342
Right 963154023 3:142077043-142077065 AGGGAGAGCTCAGTGACTGTGGG 0: 1
1: 16
2: 74
3: 156
4: 459
963154012_963154023 26 Left 963154012 3:142076994-142077016 CCCTGGCAGCAGCCATGTGGCAG 0: 1
1: 4
2: 15
3: 90
4: 524
Right 963154023 3:142077043-142077065 AGGGAGAGCTCAGTGACTGTGGG 0: 1
1: 16
2: 74
3: 156
4: 459
963154013_963154023 25 Left 963154013 3:142076995-142077017 CCTGGCAGCAGCCATGTGGCAGA 0: 1
1: 1
2: 17
3: 81
4: 365
Right 963154023 3:142077043-142077065 AGGGAGAGCTCAGTGACTGTGGG 0: 1
1: 16
2: 74
3: 156
4: 459

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963154023 Original CRISPR AGGGAGAGCTCAGTGACTGT GGG Intronic