ID: 963154358

View in Genome Browser
Species Human (GRCh38)
Location 3:142079684-142079706
Sequence CCCGGCAGCAGACTTTTCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1584
Summary {0: 2, 1: 24, 2: 323, 3: 557, 4: 678}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963154354_963154358 21 Left 963154354 3:142079640-142079662 CCAAGAGAAAAGAAACAAATAAC 0: 5
1: 9
2: 22
3: 164
4: 1287
Right 963154358 3:142079684-142079706 CCCGGCAGCAGACTTTTCAGTGG 0: 2
1: 24
2: 323
3: 557
4: 678
963154352_963154358 23 Left 963154352 3:142079638-142079660 CCCCAAGAGAAAAGAAACAAATA 0: 4
1: 9
2: 19
3: 193
4: 1983
Right 963154358 3:142079684-142079706 CCCGGCAGCAGACTTTTCAGTGG 0: 2
1: 24
2: 323
3: 557
4: 678
963154353_963154358 22 Left 963154353 3:142079639-142079661 CCCAAGAGAAAAGAAACAAATAA 0: 1
1: 1
2: 32
3: 374
4: 3552
Right 963154358 3:142079684-142079706 CCCGGCAGCAGACTTTTCAGTGG 0: 2
1: 24
2: 323
3: 557
4: 678

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963154358 Original CRISPR CCCGGCAGCAGACTTTTCAG TGG Intronic
900482007 1:2904040-2904062 CCCGGAAGCAGCCATTGCAGCGG - Intergenic
901231495 1:7644073-7644095 CCCGCCAGCGGAGTTGTCAGCGG + Intronic
901709823 1:11105144-11105166 CCCCGAAGCAGCCATTTCAGAGG - Intergenic
901767385 1:11511815-11511837 CCCTGCAGCAAACTTTTGTGTGG + Intronic
902120085 1:14157574-14157596 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
904461805 1:30685131-30685153 CCCGGGAACTGACTTTCCAGTGG + Intergenic
904775917 1:32906475-32906497 CCAGGCAGCAGAAGTCTCAGAGG - Intergenic
905386995 1:37611921-37611943 CCCGGCAGCAGTGTTGTCACAGG - Exonic
905684946 1:39901509-39901531 CCCGGCAGCCGACTGTGCCGAGG - Intronic
906020983 1:42629373-42629395 TCTGGCAGCAGACTTTTCAGTGG - Intronic
906352562 1:45076461-45076483 TCTGGCAGCAGACTTCTCAGTGG - Intronic
906438413 1:45817369-45817391 TCTGGGACCAGACTTTTCAGTGG + Intronic
906826862 1:48991331-48991353 TCTGGCAGCCGACTTTTCAGTGG - Intronic
906878183 1:49560751-49560773 TCTGACAGCAGACTTTTCAATGG + Intronic
906903399 1:49862685-49862707 CCTGGCGGCAGACTTTTCAGTGG + Intronic
906915688 1:50006597-50006619 CCTGGCAGCAGACTTTTCAATGG + Intronic
907004058 1:50892542-50892564 TCTGGCAGCAGAGTTTTCAGTGG - Intronic
907023970 1:51096646-51096668 TCTGGCAGGAGACTTTTCAATGG + Intergenic
908093222 1:60708495-60708517 TCTGGCAGCAGACTTCTCAGTGG + Intergenic
908145823 1:61241801-61241823 CTTGGCAGAAGACTATTCAGGGG + Intronic
908302096 1:62772380-62772402 TCTGGCAGTACACTTTTCAGTGG - Intergenic
908364017 1:63399028-63399050 CTGGGCTGCAGACTTATCAGAGG + Intronic
908598802 1:65717143-65717165 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
908908185 1:69039985-69040007 TCTGGCAGCAGATTTGTCAGTGG + Intergenic
909084230 1:71152794-71152816 CCTAGCAGCAGACTTCTCAGTGG - Intergenic
909104014 1:71385922-71385944 TCTGGCCACAGACTTTTCAGTGG + Intergenic
909167624 1:72248671-72248693 CCAGGAAGCAGACGTTGCAGTGG - Intronic
909182138 1:72438172-72438194 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
909309428 1:74128065-74128087 TCTGGCAACAGACTTTGCAGTGG - Intronic
909384982 1:75044150-75044172 TCCGGCAGCCGACTTTTCAGTGG + Intergenic
909386782 1:75067369-75067391 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
909420877 1:75463500-75463522 TCGGGCAGCAGATTTTTCAGTGG + Intronic
909615991 1:77608298-77608320 TCTGGCAGCAGACTTTTCAGTGG + Intronic
909870510 1:80732754-80732776 TCTGGCAGCAGACTTCTCAGTGG + Intergenic
910230063 1:84976330-84976352 TCTGGCAGTAGACTTTTCAGTGG + Intronic
910330830 1:86070627-86070649 TCTGGCAGCAGACTTCACAGTGG + Intronic
910546823 1:88427492-88427514 TCAGGGAGCAGACTTTTCAGTGG + Intergenic
910547549 1:88434811-88434833 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
910560456 1:88584105-88584127 TCCGGCAGCAGACTTTTCTGTGG + Intergenic
910620725 1:89250444-89250466 TTTGGCAGCAGACCTTTCAGTGG + Intergenic
910639576 1:89445230-89445252 TCAGTCAGCAGACTTTTCAGTGG - Intergenic
910716222 1:90234437-90234459 CCTGGCAGAAGACTTTTCAGTGG - Intergenic
910801168 1:91148061-91148083 TCTGGCGGCAGACTTTTCAGTGG - Intergenic
910819064 1:91326402-91326424 TCTGGCAGCAGACTTTTCAGTGG + Intronic
911034143 1:93520965-93520987 CCCGGAGGCAGAGGTTTCAGTGG + Intronic
911043879 1:93612998-93613020 CCCTGCTGCAGCCTTTTCAAAGG + Intronic
911213916 1:95171320-95171342 CCGGGCTGCAGGATTTTCAGTGG - Intronic
911239181 1:95447269-95447291 TCTGGCAGCAAACTTCTCAGGGG - Intergenic
911487347 1:98518058-98518080 TCTGGCAACAGAATTTTCAGTGG + Intergenic
911496688 1:98639503-98639525 CCTGGCAGCAGATTTTTCAGTGG + Intergenic
911826179 1:102487484-102487506 TCTGGGAGCAGACTTTTCAGTGG + Intergenic
911829907 1:102537162-102537184 CCCTGCAGCAGACTTTTGCCTGG + Intergenic
911887657 1:103325143-103325165 TTTGGCAGCAGACTTTTCAGTGG - Intergenic
911949914 1:104159623-104159645 CCTGACAGCTGACTTTTCAGTGG + Intergenic
911987985 1:104655934-104655956 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
912031655 1:105253524-105253546 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
912036420 1:105322855-105322877 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
912041343 1:105395437-105395459 TCTGGCAACAGACTTTTTAGTGG - Intergenic
912136193 1:106662705-106662727 CCCTGCAGCAGACTTCTGACTGG - Intergenic
912242865 1:107929048-107929070 ACCGGCAGTAGACTTTTCAGTGG + Intronic
912316618 1:108672634-108672656 GCAGGAAGCAGACTTTTCAGTGG + Intergenic
912396233 1:109346236-109346258 CCGGGATGCAGAGTTTTCAGTGG + Intronic
912601312 1:110935990-110936012 TCTGGCAGCAGACTTTCCAGTGG + Intergenic
912606918 1:111000872-111000894 TCTGGCAGCAGACTTTTCCATGG - Intergenic
912633062 1:111265822-111265844 TCTGGCAGCAGACTTTTCAATGG - Intergenic
912644146 1:111374752-111374774 TCTGGCAGCAGACTTCTGAGTGG + Intergenic
913032357 1:114921986-114922008 TCTGGCAGCAGACTTTTCAATGG - Intronic
913707107 1:121436151-121436173 TCTGGCAGCAGACTTTTCCAAGG + Intergenic
915747604 1:158176681-158176703 GCCTGCAGCAGATTTTTCACTGG + Intergenic
915811114 1:158911663-158911685 TCTGGCAGCATATTTTTCAGTGG + Intergenic
916227507 1:162504033-162504055 CCTGGCAGCTGCCTTTTCACTGG + Intronic
916322009 1:163514646-163514668 TCTGGCAGCAGACTTCTCTGTGG + Intergenic
916360732 1:163964427-163964449 TCTGGCAGCAGACTTCTCAGTGG + Intergenic
916369274 1:164072255-164072277 TCTGGCAGAAGACTTTTCAGTGG - Intergenic
916379338 1:164191293-164191315 TCTGGCAACAGACCTTTCAGTGG + Intergenic
916626239 1:166558289-166558311 CCCGGTTGCAGAATTTTCTGGGG - Intergenic
916910554 1:169341404-169341426 CCCAGCAGCAGACTTTTGCCTGG - Intronic
917226224 1:172786784-172786806 TCTGACAGCAAACTTTTCAGTGG - Intergenic
917246165 1:173003658-173003680 TCTGGCAGCAGTCTTTTCAGTGG - Intergenic
917300458 1:173569154-173569176 TCTGGCAGCAGACTTTTCGGTGG - Intronic
917743354 1:177983338-177983360 CTGGGCAGCAGACTCCTCAGGGG + Intronic
917889736 1:179424209-179424231 CCTAGCAACAGACTTCTCAGTGG - Intronic
917986421 1:180324950-180324972 TCTGGCAGCAGACTTTTCAGTGG - Intronic
918018544 1:180662472-180662494 TCTGGCAGCAGACTTTTCAGTGG - Intronic
918232147 1:182545769-182545791 CCTGGCAACAGACTTCTCAATGG - Intronic
918288812 1:183085663-183085685 CCCGGCTGTATACTTTTCAAGGG + Intronic
918415892 1:184308494-184308516 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
918475999 1:184926182-184926204 TCTGGCAGCAGACTTCTTAGTGG - Intronic
918539504 1:185614344-185614366 TTTGGCAGCAGACTTCTCAGTGG - Intergenic
918666043 1:187152849-187152871 TCTGGCACCAGCCTTTTCAGTGG - Intergenic
918671437 1:187222497-187222519 TCTGGCAGCAGACTTTTTAGTGG - Intergenic
918752863 1:188294170-188294192 TCTAGGAGCAGACTTTTCAGTGG + Intergenic
918871490 1:189980706-189980728 TCTGGCAGCAGACATCTCAGTGG - Intergenic
918915560 1:190632800-190632822 TCTGGCAGGAAACTTTTCAGTGG - Intergenic
918986255 1:191631061-191631083 TCTGGCAGCAGACTTTTTGGTGG + Intergenic
918989757 1:191683602-191683624 TCTGACAGCAGATTTTTCAGTGG - Intergenic
919068012 1:192716926-192716948 TCTGGCAGCAGACGTTTCAGTGG + Intergenic
919196844 1:194297151-194297173 CCAGTCAGCACACTATTCAGTGG - Intergenic
919336831 1:196246135-196246157 TCTGGGAGCAGACTTCTCAGTGG + Intronic
919477935 1:198052917-198052939 CCTGGAAGCAGACTTTTCCATGG - Intergenic
919514724 1:198509357-198509379 TCTGGCAGCAGACTTCTCAGTGG - Intergenic
920549847 1:206849219-206849241 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
920596493 1:207277452-207277474 TCTGGCAGTAGACTTTTCAGTGG - Intergenic
920923954 1:210324492-210324514 TCTGGCAGCAGACTTTTCAGGGG - Intergenic
921002526 1:211058004-211058026 TCTGGCAGCAGACTTCTCAGTGG + Intronic
921012136 1:211152316-211152338 TCTGGCAGAAGACTTTTCAGTGG + Intergenic
921295912 1:213703687-213703709 TGGAGCAGCAGACTTTTCAGTGG - Intergenic
921634775 1:217478920-217478942 TGTGGCAGCAGACTTTTCAGTGG + Intronic
921746430 1:218745177-218745199 CCTGGAAGCAGACTTCTCAGTGG + Intergenic
921769933 1:219023942-219023964 TGTGGCAGCAGACTTCTCAGTGG + Intergenic
922014305 1:221628994-221629016 TCTAGCTGCAGACTTTTCAGGGG - Intergenic
922045746 1:221944770-221944792 TCTGACAGCAGATTTTTCAGTGG - Intergenic
922065682 1:222137933-222137955 GCTGGCAGCGGACTTTTCAATGG + Intergenic
922319923 1:224478011-224478033 TCTGGCAGCAGACTTTTCAGTGG - Intronic
922371025 1:224910556-224910578 CCCTGCAGCAGACTTTTGCCTGG + Intronic
922388364 1:225112314-225112336 TCTGGCAGTAGACTTTTCAGTGG - Intronic
922394255 1:225179961-225179983 TCTGGCAGCAGACTTTTCATTGG - Intronic
923886427 1:238162947-238162969 TCTGGCAGCAGACTTTTAAGTGG - Intergenic
924490034 1:244527271-244527293 CCCTGAAGCAGCCATTTCAGAGG + Intronic
924490613 1:244534108-244534130 TCTGGCAGCAGACATTTCAGTGG - Intronic
924515973 1:244766541-244766563 TCTGGCAGCAGACTTTTTAGTGG - Intergenic
924792709 1:247268167-247268189 TCTGGCAGCAGACTTTTTAGTGG + Intergenic
924936621 1:248777439-248777461 CCCTGCAGCAGACTTCTCTCTGG - Intergenic
1062765669 10:62836-62858 TCTGACAGCAGACTTTTCAGGGG - Intergenic
1064696607 10:17973583-17973605 TCTGACAGCAGACTTTTCAGTGG - Intronic
1065381332 10:25094372-25094394 TCTGACAGCAGACCTTTCAGTGG - Intergenic
1065426740 10:25613994-25614016 TCTGGCAGCAGACTTTTCAATGG - Intergenic
1067061970 10:43082231-43082253 CCCTGCCCCAGGCTTTTCAGGGG - Intronic
1067492478 10:46724301-46724323 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1067602189 10:47616093-47616115 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1068103746 10:52589340-52589362 TCTGGCAGCAGACTTTTAAGGGG - Intergenic
1068392207 10:56413015-56413037 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1068641762 10:59415733-59415755 TCTGGCAGCAGACTCTTCAGTGG + Intergenic
1069147995 10:64919266-64919288 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1069249344 10:66247638-66247660 TCTGGCAGCAGGCTTTTCAGTGG + Intronic
1069343682 10:67441603-67441625 TCTGGCAGCAGACTTTTCAGTGG + Intronic
1069397595 10:68006826-68006848 TCTGGCAGCAGACTTCTCAGTGG - Intronic
1069577559 10:69541626-69541648 CCCTGCAGCAGACTTTTGCCTGG + Intergenic
1070040519 10:72773769-72773791 TCTGGCAACAGACTTCTCAGTGG + Intronic
1070445091 10:76491526-76491548 TCTGGCAGGAGACTTTTCAGAGG - Intronic
1071018254 10:81023043-81023065 TCTGGCTTCAGACTTTTCAGTGG + Intergenic
1071197030 10:83173804-83173826 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1071768059 10:88691093-88691115 TCTGGCAGAAGACTTTTCAGTGG + Intergenic
1071869542 10:89779352-89779374 TCTGGCAGTAGACTTTTCAGTGG - Intergenic
1071896552 10:90074341-90074363 TCTGGCAGCAGAATTTTTAGTGG - Intergenic
1071935337 10:90524546-90524568 TCTAGCAGCAGACTTTTCAGTGG - Intergenic
1071963189 10:90826143-90826165 TCTGGCAGCAGACTTTTCAGTGG + Intronic
1072058981 10:91789834-91789856 CCTGGCAGCAGACTGTTCAGTGG + Intergenic
1072115316 10:92365113-92365135 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1072282702 10:93882997-93883019 TCTGGCAGCAGATTTTTCAGTGG + Intergenic
1072843256 10:98798116-98798138 TCTGGCAGCAGATTTTTCAGTGG + Intronic
1073872600 10:107882080-107882102 TCTGGCAGCAGATTTTTCACTGG + Intergenic
1074226728 10:111492103-111492125 TCTGGCAACAGACTTTTCAGTGG - Intergenic
1074408672 10:113203459-113203481 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1074637915 10:115342964-115342986 TCTGGCGGCAGACTGTTCAGTGG - Intronic
1074638832 10:115354535-115354557 TCTGGCAGCAGCCTTCTCAGTGG - Intronic
1075830395 10:125405955-125405977 TCTGGCAGTAGACTTCTCAGTGG - Intergenic
1077427666 11:2491861-2491883 TCTGGCAGCAGAGTTTTCAATGG + Intronic
1077709856 11:4524954-4524976 TCTGGCAGCAGACTTTTTAGTGG + Intergenic
1077970467 11:7183535-7183557 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1078036975 11:7816116-7816138 TCTGGCAGTAGACTTTTCAGTGG + Intergenic
1078992912 11:16667472-16667494 TCTAGCAGCAGACTTTTCAGTGG + Intronic
1079038226 11:17039176-17039198 TCTGGCAGGAGACTTTGCAGTGG + Intergenic
1079473681 11:20806385-20806407 TCTGGCAGCAGACTTTTCAGTGG - Intronic
1079542638 11:21594260-21594282 CCCTGCAGCAGACTTTTGCCTGG - Intergenic
1079558358 11:21790347-21790369 TCTGGCAACAAACTTTTCAGTGG - Intergenic
1079687034 11:23372127-23372149 TCTGGCAGCAGACTTCTCAGTGG + Intergenic
1079692576 11:23438244-23438266 TCTGGCAGCAGACTTTTCAATGG - Intergenic
1079713087 11:23710283-23710305 CCTGGCAGCAGACTTTTGAGTGG + Intergenic
1079723117 11:23844747-23844769 TCTGGCAGTAGACTTCTCAGTGG - Intergenic
1079729123 11:23919014-23919036 TCTGGCAGCAGACTTTTCAATGG - Intergenic
1079823217 11:25158462-25158484 TTTGGCAGCAGACTTTTCAGTGG - Intergenic
1079961221 11:26926648-26926670 TCTGGAAGCAGACTTTTCAGTGG - Intergenic
1080213504 11:29815489-29815511 TCTGACAGCAGACTTTTCAGTGG - Intergenic
1080489585 11:32748889-32748911 TCTGGCAGCAGACTTTTCAGTGG - Intronic
1080707025 11:34705830-34705852 TCTGGCAGCAGACTTCTCAGTGG - Intergenic
1080796630 11:35569884-35569906 TCTGGCAGCAGATTTCTCAGTGG + Intergenic
1081073487 11:38640389-38640411 TCTGGCAGCAGACTTCTCAATGG - Intergenic
1081112285 11:39150802-39150824 TTTGGCAGCAGAGTTTTCAGTGG + Intergenic
1081144132 11:39540425-39540447 TCTGGCAGTAGACTTTTCAGTGG - Intergenic
1081212378 11:40352924-40352946 TCCTGCATCAGACTTCTCAGTGG - Intronic
1081245933 11:40766119-40766141 TCTGACAGCAGACTTCTCAGTGG + Intronic
1081400368 11:42636069-42636091 CCCTGCAGCAGACTTTTGCCTGG - Intergenic
1081555397 11:44156072-44156094 TCTGGCAGCAGACTTTTCAGTGG - Intronic
1082113274 11:48300106-48300128 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1082114557 11:48314180-48314202 CCTGGCAGCATACTTTTCAGTGG - Intergenic
1082252085 11:49993756-49993778 CCTTGCAGAAGACTTTTCAATGG + Intergenic
1082827251 11:57589047-57589069 CCAGGCAGGAGGCTATTCAGTGG + Intergenic
1082953968 11:58848992-58849014 TCTGACAGCAGATTTTTCAGTGG + Intronic
1083297909 11:61725113-61725135 CCCAGCATCAGGCTTTTAAGGGG + Intronic
1083941944 11:65900557-65900579 TCCGGCTGCAGCCTTTTCACCGG + Intronic
1084200199 11:67551961-67551983 CCCTGCAGCAGACTTTTGCCTGG - Intergenic
1084577203 11:69997043-69997065 CCAGGGAGCAGACTCCTCAGAGG - Intergenic
1084763578 11:71292515-71292537 TCTGGCAGTAGACTTCTCAGTGG - Intergenic
1085007937 11:73112337-73112359 TCCAGCAGCAGACTTTTCTGTGG - Intronic
1085178656 11:74512917-74512939 ACTGGCAGCAGACTTTTCAGTGG + Intronic
1085223639 11:74897638-74897660 TCTGGCAGGAGGCTTTTCAGTGG + Intronic
1085372053 11:76018264-76018286 TCTGGCAGCAGACTTTACAGTGG - Intronic
1085562989 11:77489092-77489114 CCTGACAGCAGGCTTTTCAGTGG + Intergenic
1085571913 11:77567356-77567378 CCCAGGAGCAGACTTTTCAGTGG - Intronic
1085814567 11:79723698-79723720 GTTGGCAGCAGGCTTTTCAGTGG + Intergenic
1085981480 11:81731490-81731512 TCTGGCCGCAGACTTTTCAGTGG - Intergenic
1086007179 11:82050507-82050529 TCTGGCAGCAGACATTTCAGTGG + Intergenic
1086828430 11:91528357-91528379 TCTGGCAGCAGACTTTTCAGGGG + Intergenic
1086847675 11:91772376-91772398 TCTGGCAGCAGACTTTGCAGTGG - Intergenic
1087080478 11:94166505-94166527 TCTGGCAGCAGACTTTTCAGTGG - Intronic
1087299513 11:96415358-96415380 TCTGTCAGTAGACTTTTCAGTGG + Intronic
1087350268 11:97021954-97021976 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1087466016 11:98507125-98507147 CCTGGCAGCAGACTTCTCAGAGG - Intergenic
1087479965 11:98687084-98687106 TCTGGCAGCAGACATTTCAGTGG - Intergenic
1087532690 11:99405068-99405090 TCTGGTAGCAGGCTTTTCAGTGG - Intronic
1087598193 11:100281435-100281457 TCTGGCAGCAGACTTTTCAGTGG - Intronic
1087690855 11:101319136-101319158 TCTGGCAGTAGACTTTTCTGTGG - Intergenic
1087824398 11:102748443-102748465 TCTGGCAGCACACTTCTCAGTGG - Intergenic
1087877133 11:103371598-103371620 TCTGGCAGCAGACTTTTCAGTGG + Intronic
1087887756 11:103499464-103499486 TCTGGCAGCAGGCTATTCAGTGG + Intergenic
1087950631 11:104217095-104217117 TCTGGCAGTAGACTCTTCAGTGG - Intergenic
1088009960 11:104987798-104987820 TCTAGCAGCAGACTTTTCAGTGG + Intergenic
1088361827 11:108999551-108999573 TCTGGCAGTAGACTTTTCAGTGG - Intergenic
1088938030 11:114424294-114424316 TCTGGCAGCAGACTTTTCAGTGG - Intronic
1088944293 11:114494046-114494068 TCTGGCAGCAGACTTCTCAGTGG - Intergenic
1088985387 11:114901364-114901386 GCAGACAGCAGACTTTTCAGTGG + Intergenic
1089239418 11:117063421-117063443 CCTGGCAGCTGACTTTACATTGG - Intronic
1089463974 11:118671851-118671873 TCTGGCAGCAGACTTCTCAGTGG + Intronic
1089761988 11:120734387-120734409 TCTGGCAGCAGACTTTTCAGTGG - Intronic
1089937281 11:122377264-122377286 TGTGGCAGCAGACTTTTCAGTGG + Intergenic
1090111383 11:123912795-123912817 TCTGGCAGCTAACTTTTCAGTGG + Intergenic
1090210167 11:124915038-124915060 CCTAGCAGCAGACTTCTCAGTGG - Intergenic
1090222117 11:125036325-125036347 CCTAGCAGCAGACTTCTCAGTGG - Intronic
1090318099 11:125815557-125815579 TTTGGCAGCAGACTTTACAGTGG - Intergenic
1090676708 11:129005602-129005624 TCTGGCAGCAGACTTTTCAGTGG - Intronic
1090717959 11:129446946-129446968 CCAGGCAGTAGACTTATTAGTGG - Intronic
1091336272 11:134769089-134769111 CCAAACAGCAGACTTCTCAGTGG + Intergenic
1091966995 12:4753020-4753042 TCTGGCAGCAGACTTTTCCATGG - Intronic
1092326552 12:7537558-7537580 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1092497845 12:9014400-9014422 TCTGACAGCAGACTTCTCAGTGG + Intergenic
1092642573 12:10531923-10531945 TCTTCCAGCAGACTTTTCAGTGG + Intergenic
1092690777 12:11107949-11107971 TGTGGCAGCAGACTTTTCAGTGG + Intronic
1092693474 12:11142748-11142770 TCTGGCAGCAGACTTCTCAGTGG + Intronic
1093123120 12:15296669-15296691 CCTGGCAGCAGACTTTTTAGTGG + Intronic
1093176380 12:15917830-15917852 CCAGGCAGCATTTTTTTCAGTGG + Intronic
1093259334 12:16916222-16916244 TCTGGCAACAGACTTCTCAGTGG - Intergenic
1093403975 12:18781992-18782014 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1093538385 12:20249688-20249710 CTTGGCAGCAGACTTTTCAGTGG + Intergenic
1093581469 12:20788878-20788900 TCTTTCAGCAGACTTTTCAGTGG - Intergenic
1093607940 12:21117064-21117086 TCTGGCAGCAGACTCTTCAGTGG - Intronic
1093620247 12:21279497-21279519 ACTGGCAGCAGACTTTTCGGTGG + Intronic
1093694533 12:22145109-22145131 TTTGGCAGCAGACTTTTCAGTGG + Intronic
1093903106 12:24659451-24659473 TCTGGTGGCAGACTTTTCAGTGG - Intergenic
1093988639 12:25565943-25565965 CCTGGCAGCAGACTTTTCAGTGG - Intronic
1094258772 12:28466507-28466529 TCTGGCAGCAGATTTTTCAGTGG + Intronic
1094380562 12:29838973-29838995 TCTGGTAGCAGATTTTTCAGTGG - Intergenic
1094787190 12:33862280-33862302 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1094815908 12:34184494-34184516 TTTGACAGCAGACTTTTCAGGGG - Intergenic
1095099364 12:38164333-38164355 TCTGGCAGCAGACTTTACATTGG - Intergenic
1095101201 12:38185777-38185799 TCTGACAGCAGACTTTTCAAGGG + Intergenic
1095133843 12:38573731-38573753 TCTGGGAGCAGAGTTTTCAGTGG + Intergenic
1095212821 12:39512798-39512820 TCTGGCAGGAGTCTTTTCAGTGG + Intergenic
1095227778 12:39697158-39697180 TCTGGGAGCAGACTTTGCAGTGG + Intronic
1095363496 12:41373408-41373430 CCCTGAAGCAGCCATTTCAGAGG + Intronic
1095573416 12:43708132-43708154 TCTGGCAGCAGACTCTTCATTGG - Intergenic
1095788813 12:46142236-46142258 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1095860432 12:46910203-46910225 CCTGGCAGCAGACTTTTCAGTGG + Intergenic
1097036244 12:56126356-56126378 CTGGGCAGCAGAATTGTCAGTGG + Exonic
1097401627 12:59134748-59134770 CCCTGCAGCAGACTTTTGTATGG + Intergenic
1097425860 12:59444252-59444274 TCTGACAGCAGACTTTTCAGTGG - Intergenic
1097466432 12:59930386-59930408 TCCAGCAGCAGACTTCTCAGCGG + Intergenic
1097770128 12:63573728-63573750 TCTGGCAGCAGACTTTTCAGTGG + Intronic
1098060522 12:66556219-66556241 TCTAGCAGCAGACTTTTCAATGG + Intronic
1098142690 12:67467411-67467433 TCTGGCAGCAGACTTTTCAGCGG - Intergenic
1098207717 12:68130953-68130975 TCTGGCAACACACTTTTCAGTGG - Intergenic
1098333785 12:69381201-69381223 CCCTGAAGCAGCCATTTCAGAGG + Intronic
1098705775 12:73686759-73686781 CCTGGCAGCAGACATTTCAGTGG + Intergenic
1098880675 12:75914132-75914154 GCAGGCAACAGTCTTTTCAGAGG - Intergenic
1098959221 12:76720902-76720924 TCTGGCAGCAGACTTCTCAGTGG + Intergenic
1099024689 12:77450007-77450029 TCTGGCAGTAGACTTCTCAGTGG + Intergenic
1099088406 12:78276320-78276342 CCTAACAGCAGACTTTTCAGCGG - Intergenic
1099126843 12:78770760-78770782 CATGACAGCAGACTTTTCATTGG - Intergenic
1099434012 12:82621858-82621880 TCTGACAACAGACTTTTCAGTGG + Intergenic
1099465374 12:82979934-82979956 TGAGGCAGCAGACTTTTCAGTGG - Intronic
1099523499 12:83691859-83691881 TCTGACAGCAGACTTCTCAGTGG + Intergenic
1099564693 12:84228730-84228752 CCTGGCAGCAGGCTTTTCAGTGG - Intergenic
1099609917 12:84855630-84855652 TCTGGCAGCAGGCTTTTCAATGG - Intergenic
1099808395 12:87548627-87548649 TCTGGCAGCAGACTTCTCAGTGG + Intergenic
1099882424 12:88482282-88482304 TCTGGCAGCAGACATTTTAGTGG + Intergenic
1099992470 12:89738714-89738736 TCTGGCAGTAGACTTTTCAGTGG + Intergenic
1100060836 12:90574061-90574083 TTTGGCAGCAGACTTTTCAGTGG - Intergenic
1100360593 12:93876165-93876187 CCTGGCAGAAGACTTTACAGTGG - Intronic
1100499095 12:95156342-95156364 CCCCGAAGCAGCCATTTCAGAGG - Intronic
1100875913 12:98961277-98961299 CCTGGTAGCAGACTTTTCAGCGG + Intronic
1100905086 12:99288209-99288231 TCTGGCAGCAGAATTCTCAGTGG + Intronic
1100908987 12:99336852-99336874 CCTGGCAGCAGACTTCTCAGTGG - Intronic
1100946571 12:99790158-99790180 TCTGGCAGCAGACTTTTCAATGG + Intronic
1101025956 12:100607272-100607294 TCTGGCAGCAAATTTTTCAGTGG - Intronic
1101226845 12:102696142-102696164 TCTGGCAGCAAATTTTTCAGTGG + Intergenic
1101607722 12:106260536-106260558 TCTGGCAGCAGACTTTTCAGTGG + Intronic
1101792684 12:107942586-107942608 TCTGGCAACAGACTTCTCAGTGG + Intergenic
1104356214 12:128089357-128089379 GCCCGCAGAAGACTCTTCAGAGG - Intergenic
1105558824 13:21471623-21471645 ACTGACAGCAGACTTTTCAGTGG - Intergenic
1106262299 13:28078271-28078293 CCCTGCAGCAAACTTTTCTCAGG + Intronic
1107021257 13:35754642-35754664 TCTGGCAGGAGACTTCTCAGTGG - Intergenic
1107083754 13:36403969-36403991 TTTGGCAGCAGACTTTTCACTGG - Intergenic
1107178299 13:37425087-37425109 TCTGTCAGCAGTCTTTTCAGTGG + Intergenic
1107228374 13:38078030-38078052 TCTGGCACCAGACTTTTCAGTGG + Intergenic
1107265815 13:38553012-38553034 TCTTGTAGCAGACTTTTCAGTGG - Intergenic
1107287607 13:38813410-38813432 CCTGGCAGCAGACTTTACAGTGG - Intronic
1107370022 13:39735860-39735882 TCTGGCAGCAGACTTTTCAGTGG - Intronic
1107523967 13:41212119-41212141 TCTGGCAGCAAACTTTTCAGTGG - Intergenic
1107552012 13:41485880-41485902 TCTGGCAGCAGATTTTTCAGTGG - Intergenic
1108099439 13:46938136-46938158 TCTGGCAGCAGACTTTCCAGTGG + Intergenic
1108255755 13:48609728-48609750 TTGGGCAGCAGACTTTACAGTGG - Intergenic
1108328765 13:49362890-49362912 TCTGGCAGCAGACTTTTCAGTGG + Intronic
1108646607 13:52435994-52436016 CCTGCTAGCAGAGTTTTCAGTGG - Intronic
1108878942 13:55085547-55085569 TCTGGCAGCAGACATTTCAGTGG - Intergenic
1108961975 13:56245868-56245890 ACTGGTAGCAGGCTTTTCAGTGG - Intergenic
1109016529 13:57021819-57021841 TCTGGCAGCAGACTTTTCACTGG + Intergenic
1109022561 13:57117392-57117414 TCTGGAGGCAGACTTTTCAGTGG - Intergenic
1109336505 13:61001861-61001883 CCTGGCAGTAGACTTTTCATTGG - Intergenic
1109506913 13:63313540-63313562 TCTGGCAGCAGACTTTCCAGTGG + Intergenic
1109522344 13:63530722-63530744 TCTGGAAGCATACTTTTCAGTGG - Intergenic
1109567250 13:64133237-64133259 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1109582548 13:64361889-64361911 TCTGGCAGCAGACTTCTCAGTGG - Intergenic
1109961406 13:69637212-69637234 TCTGGAAGCAGACTCTTCAGTGG - Intergenic
1110044757 13:70813755-70813777 CCCAGCAGCAGACTTTTGCCTGG - Intergenic
1110078758 13:71285014-71285036 TCTGGCAGCAGAGTTTTCAATGG - Intergenic
1110388557 13:74944571-74944593 TCTGACAGAAGACTTTTCAGTGG + Intergenic
1110486770 13:76054153-76054175 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1110501447 13:76232452-76232474 TCTGGCAGCACACTTCTCAGTGG + Intergenic
1110665609 13:78114473-78114495 TCTGGCAGGAGACTTTTCAGTGG - Intergenic
1110806744 13:79763819-79763841 TCTGGCAGCAGGCTTCTCAGTGG - Intergenic
1110955728 13:81550094-81550116 CCCTGCAGCAGACTTCTCCCTGG + Intergenic
1110974361 13:81810051-81810073 TCAGTCAGCAGACTTTTCAGTGG + Intergenic
1111221329 13:85208625-85208647 CCCTGCAGCAGACTTTTGCTTGG - Intergenic
1111334573 13:86803127-86803149 CCCTGCAGCAGACTTCTGACTGG + Intergenic
1111365045 13:87232851-87232873 TCTTTCAGCAGACTTTTCAGTGG - Intergenic
1111449315 13:88392884-88392906 TCTGGCAGCAGACTTCTCAGTGG + Intergenic
1111513125 13:89292653-89292675 CCTGGCAGCAGACTGTTCAGTGG - Intergenic
1111584017 13:90261373-90261395 CCCTGCAGCAGACTTCTCTCTGG + Intergenic
1111639517 13:90949081-90949103 CCTGGAAGCAGACTTTTCAGTGG + Intergenic
1112053469 13:95668604-95668626 TCTGGCAGCAGATTTCTCAGTGG - Intergenic
1112466202 13:99646982-99647004 CCCAGCAGCAGCCTCTCCAGAGG - Intronic
1112618678 13:101033012-101033034 TCTGGCAGCAGACTTTTCAATGG - Intergenic
1112705755 13:102067955-102067977 TCTGGCAGCAGACTTCTCAGTGG + Intronic
1112866052 13:103899558-103899580 TCTGGCAGCAGACTTCTCAGTGG + Intergenic
1112901314 13:104361407-104361429 TCAGGCAGCAGACTTTTCAGTGG - Intergenic
1113208563 13:107946626-107946648 TCTGGCAGCAGACTTCTCAGTGG + Intergenic
1113244051 13:108375287-108375309 TCCATCAGCAGACTTCTCAGTGG - Intergenic
1113558850 13:111260405-111260427 TCTGGCAGCAGACTTCTCAGTGG + Intronic
1113703969 13:112413431-112413453 TCTGGCAGCAGACTTCTCAGTGG - Intronic
1114251041 14:20960786-20960808 TCTGGTGGCAGACTTTTCAGCGG + Intergenic
1114433616 14:22684716-22684738 TCTGACAGCAGACTTCTCAGTGG + Intergenic
1114687947 14:24552680-24552702 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1114984957 14:28215769-28215791 TCTGACAGCAGACTTTTCGGTGG - Intergenic
1115275878 14:31608034-31608056 TCTGGCAGCAGACTTTTCAGTGG + Intronic
1115381365 14:32744128-32744150 GCAGGCAGCAGACTTTTCAGTGG - Intronic
1115476878 14:33823314-33823336 TCTGGCAGCAGACTTCTCAGTGG + Intergenic
1115481733 14:33867604-33867626 CCCTGCAGCAAACTTTTCCCTGG + Intergenic
1115619911 14:35131457-35131479 TCTGGCAGCAGACTTTTCAGTGG - Intronic
1115861389 14:37689610-37689632 TCCAGCAGCAGACTTTTCAGTGG + Intronic
1115930323 14:38483947-38483969 TCTGGCAGCAGATTTCTCAGTGG + Intergenic
1116021439 14:39467217-39467239 TTTGGCAGCAGACTTTCCAGTGG - Intergenic
1116058062 14:39887644-39887666 TCTGACAGCAGACTTTTCAGTGG + Intergenic
1116154892 14:41190679-41190701 TCTGGCAGCAAACTTCTCAGTGG + Intergenic
1116192782 14:41681411-41681433 TCTGACAGCAGACTTCTCAGTGG + Intronic
1116392872 14:44414831-44414853 TCTGGCAGCAGACTTCTCACTGG + Intergenic
1116497602 14:45581576-45581598 TCTGGCAGCAGACTTCTCAGTGG - Intergenic
1116669262 14:47820245-47820267 TCTGGCAGCAGACTTCTCAGTGG - Intergenic
1116724965 14:48552221-48552243 TCTGGCAGCACACTTTTCAGTGG - Intergenic
1116766147 14:49072329-49072351 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1116889317 14:50251665-50251687 TCTGGCAGCAGACTTTTCAGTGG + Intronic
1116930505 14:50686414-50686436 TCTGGCAGCAGACTCTTCAGTGG - Intergenic
1116932119 14:50701476-50701498 CCCTGGAGCAGAACTTTCAGAGG - Intergenic
1117110528 14:52448331-52448353 CCTAGCAGCTGACTTTTCAGTGG + Intronic
1117159183 14:52971996-52972018 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1117161245 14:52992640-52992662 TCTGGCAGCAGACTTCTCAGTGG - Intergenic
1117264715 14:54075174-54075196 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1117482870 14:56166712-56166734 TCTGGCAGCAGACTTTTCAGTGG - Intronic
1117483810 14:56173974-56173996 CCAGGAAGCAGAGGTTTCAGTGG - Intronic
1117606753 14:57438208-57438230 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1117634621 14:57729005-57729027 TCTGGCAGCAGACTTTTCAGTGG - Intronic
1117990147 14:61425077-61425099 CCCTGCAGCAGACTTCTGACTGG - Intronic
1118099061 14:62574536-62574558 CCTGGTAGCAGACTTTTCAGTGG + Intergenic
1118199204 14:63656724-63656746 CCCGGCAGCATACTTATCATTGG - Intergenic
1118431008 14:65718811-65718833 TCTGACAGCAGACTTTTCAGTGG - Intronic
1118538801 14:66800524-66800546 TTTGGCAGCAGATTTTTCAGTGG - Intronic
1118543722 14:66860266-66860288 TCTGGCAGCAGAGGTTTCAGTGG + Intronic
1118549232 14:66931196-66931218 TCTGGCAGCAGATTTCTCAGTGG - Intronic
1119096602 14:71838744-71838766 TCCGGCAGCAGACTTTTCAGTGG - Intergenic
1119936837 14:78599847-78599869 CCAGGCAGCAAGCTTTTCATGGG - Intronic
1120107467 14:80513320-80513342 TCTGTCAGCAGACTTTTCAGTGG - Intronic
1120123288 14:80709211-80709233 CCGGGAAGCAGAGTTTGCAGTGG - Intronic
1120275972 14:82372484-82372506 TCTGGCAGCAGATTTTTCAGTGG + Intergenic
1120340509 14:83215535-83215557 TCTGAGAGCAGACTTTTCAGTGG - Intergenic
1120426511 14:84354328-84354350 CCTGACAGCAGACTTCTCAGTGG + Intergenic
1120697630 14:87661428-87661450 TCTGGCAGCAGATTTTTCAGTGG + Intergenic
1120770889 14:88379328-88379350 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1120808389 14:88777230-88777252 TCTGGCAGAAGACTTTACAGTGG + Intronic
1121758884 14:96426755-96426777 TCTAGCAGCAGACTTTTCAGTGG - Intronic
1122145379 14:99685429-99685451 CCCAGCCCCAGACTTCTCAGGGG + Intronic
1122595261 14:102885935-102885957 CCCACCAGCAGACTGTTCTGAGG + Intronic
1123465389 15:20511212-20511234 GCCAGCAGCAGCCTGTTCAGGGG - Intergenic
1123652727 15:22489825-22489847 GCCAGCAGCAGCCTGTTCAGGGG + Intergenic
1123743150 15:23298689-23298711 GCCAGCAGCAGCCTGTTCAGGGG + Intergenic
1124037277 15:26066188-26066210 CCTGGCAGCAAACTTTTCAGTGG - Intergenic
1124081188 15:26499654-26499676 TCTGGCAGCAGACTTTTTAGTGG - Intergenic
1124276115 15:28327191-28327213 GCCAGCAGCAGCCTGTTCAGGGG - Intergenic
1124306585 15:28584416-28584438 GCCAGCAGCAGCCTGTTCAGGGG + Intergenic
1124844026 15:33273357-33273379 TCTGGCAGCAGAGTTTTCAGTGG - Intergenic
1125365460 15:38910430-38910452 TCTGGCAACAGACTTCTCAGAGG - Intergenic
1125565907 15:40678139-40678161 TCTGGCGGCAGACTTTTCAGTGG - Intergenic
1125566244 15:40680839-40680861 TCTGGCAGCAGACTTATCAGTGG - Intergenic
1125567332 15:40686579-40686601 CCCTGAAGCAGCCATTTCAGAGG + Intergenic
1125877672 15:43164907-43164929 TCTGGCAGCAGACTTCTCAGTGG - Intronic
1126053029 15:44704899-44704921 TCTGGCAGCAGACTTTCCAGTGG - Intronic
1126184025 15:45813123-45813145 TCTGGCAGCAGACTTTTCACTGG + Intergenic
1126250607 15:46564002-46564024 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1126440797 15:48685593-48685615 CCTGGCAGCAGACTTTTCAGTGG + Intergenic
1126517433 15:49552331-49552353 TCTGGCAGCAGTCTTTTCAGTGG - Intronic
1126571937 15:50162113-50162135 TCTGGTAGCAGACTTTTCAGTGG - Intronic
1126709254 15:51439484-51439506 TCTGCCAGCTGACTTTTCAGTGG - Intergenic
1127012642 15:54646467-54646489 TCTGGCAGCAGAATTTTCAGGGG + Intergenic
1127022477 15:54763860-54763882 TCTGGCAGTAGATTTTTCAGAGG + Intergenic
1127033886 15:54893950-54893972 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1127132851 15:55885091-55885113 TCAGGAAGCAGACTTTTCAGTGG + Intronic
1127155542 15:56121331-56121353 TCTGGCAGCAGACTTTTCAGTGG - Intronic
1127208323 15:56743858-56743880 CCAGGAGGCAGAGTTTTCAGTGG + Intronic
1127476918 15:59343356-59343378 TCTGGCAGCAGACTTTTCAGTGG - Intronic
1127832263 15:62761353-62761375 CCCTGCACCAGACTATGCAGCGG - Intronic
1127837617 15:62803169-62803191 CTTAGCAGCAGACTTCTCAGTGG - Intronic
1127971308 15:63964295-63964317 TCTGGCAGCAGACTTTGTAGTGG - Intronic
1128900839 15:71421515-71421537 TCTGGCAGCAGATATTTCAGTGG - Intronic
1129299923 15:74619660-74619682 CCAGGGAGCAAACTTTCCAGGGG - Intronic
1129501320 15:76040210-76040232 TCTGGCAGCAGACTTTTCAGTGG + Intronic
1129642619 15:77395599-77395621 ACTGGCGGGAGACTTTTCAGTGG + Intronic
1129715391 15:77845506-77845528 CCCTGCAGCAGACTTTTCCCTGG - Intergenic
1130440943 15:83953883-83953905 TCTGGAAACAGACTTTTCAGTGG - Intronic
1131323322 15:91419131-91419153 TCTGGCAGCAGACTTCTCAGTGG - Intergenic
1132439048 15:101840953-101840975 TTTGGCAGCAGACTTTTCAGTGG - Intergenic
1134406829 16:13968138-13968160 TCTGGCAGCAGACTTTTCAATGG - Intergenic
1135424632 16:22326192-22326214 CCCGGCCACACACTCTTCAGCGG + Exonic
1136388958 16:29949930-29949952 TCTGGCAGCAGACTTTTCAGTGG - Intronic
1136679392 16:31947422-31947444 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1138017967 16:53448230-53448252 CCGGGCAGCAGAGGTTGCAGTGG - Intronic
1138844762 16:60552539-60552561 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1138864839 16:60804475-60804497 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1138997649 16:62474321-62474343 CCCTGCAGCAGACTTTTCCCTGG - Intergenic
1139004737 16:62557027-62557049 TCTGGCAGCAGACTTCTCTGTGG - Intergenic
1139103629 16:63800287-63800309 TCTAGCAGCAGATTTTTCAGTGG - Intergenic
1140157893 16:72453341-72453363 TCTGGCAGCACACTTTTCAGTGG - Intergenic
1141037514 16:80641252-80641274 TATGGCAGCAAACTTTTCAGTGG + Intronic
1141143483 16:81513269-81513291 CCTGCCAGCAGGCTATTCAGAGG + Intronic
1141685160 16:85565909-85565931 CAGGGCAGCAGGCTTTTCTGAGG + Intergenic
1142559783 17:803135-803157 CCAGGCAGGAGACTCTTCACAGG - Intronic
1142919777 17:3174230-3174252 TCTGGCTGCAGACTTTTCAGTGG + Intergenic
1143413906 17:6730942-6730964 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1144350605 17:14391917-14391939 CCTGGCAGTAGACTTCTCAGTGG + Intergenic
1144718411 17:17450579-17450601 CCTGGCAGCAGCCCTTCCAGAGG + Intergenic
1146126731 17:30236929-30236951 ACCGGCCGCACAGTTTTCAGGGG - Intergenic
1146215695 17:30978081-30978103 TCTGGCAGCAGACTTTTCAGTGG - Intronic
1149054446 17:52346275-52346297 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1149157180 17:53646142-53646164 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1149239964 17:54637322-54637344 TCTGGCAGCGGACTTTTCAATGG + Intergenic
1150192481 17:63258203-63258225 TCTGGCAACAGACTTCTCAGTGG - Intronic
1150541523 17:66104717-66104739 TCTGGCAGCAGACTTCTCAGTGG + Intronic
1151016437 17:70559103-70559125 CCAGGCACAAGACTTTACAGTGG - Intergenic
1151820684 17:76495139-76495161 CCCGGCAGCCGGGTTTTCACGGG + Intronic
1152035125 17:77867623-77867645 CCCGGCAGGAGCCTTTCCTGTGG - Intergenic
1152508718 17:80771072-80771094 CTCTGCAGCGGACTCTTCAGGGG - Intronic
1153075120 18:1154343-1154365 TCTGGCAGCAGGTTTTTCAGTGG - Intergenic
1153099799 18:1453420-1453442 TCTGGCAGCACACTTTTCAGTGG + Intergenic
1153268134 18:3292092-3292114 TCTGGCAGCAGACTTCTCAGTGG - Intergenic
1153356343 18:4140881-4140903 TCTGGCAGCAGACTTCTCAGTGG - Intronic
1153363526 18:4226086-4226108 CCTGGCAGCAGACTTTTCAGTGG + Intronic
1153622068 18:6988944-6988966 CTCGCCAGCAGGCCTTTCAGAGG - Intronic
1153714740 18:7836838-7836860 TCTGGCAGCAAACTTTTCAGTGG - Intronic
1153980090 18:10301330-10301352 CCAGGCAGCAGGCTGTTAAGAGG + Intergenic
1154178626 18:12109199-12109221 CCCTGCAGCAGACTTTTGCTTGG + Intronic
1155113878 18:22744800-22744822 CCCAGCAACAGACTTTTCAATGG + Intergenic
1155282340 18:24252365-24252387 TCTGGCAGCAGGCTTTTCAGTGG + Intronic
1155443620 18:25886874-25886896 TCTAGCAGCAGTCTTTTCAGTGG + Intergenic
1155534041 18:26796961-26796983 AAAGGCAGCAGACTTTTCATTGG + Intergenic
1155767680 18:29655269-29655291 TCTGGCAGCAGACTTGTCAGTGG + Intergenic
1155781901 18:29848321-29848343 TCTGGCAGAAGACTTTTCAGTGG - Intergenic
1156025798 18:32653786-32653808 TCTGGCAACAGACTTTTCAGTGG - Intergenic
1156055782 18:33000625-33000647 TTTGGCAGCAGACTTTTCAGCGG + Intronic
1156094456 18:33512056-33512078 TCTGGCAGCAGACATTTCAGTGG + Intergenic
1156669293 18:39448173-39448195 CCAGGCAGCAGAGGTTGCAGTGG + Intergenic
1157287449 18:46386692-46386714 CCTGGCAGCTGTCCTTTCAGTGG + Intronic
1157379187 18:47195739-47195761 TCTGGCAGCAGACTTCTCAATGG + Intergenic
1157937174 18:51885692-51885714 CCTGGCAGCAGACTTTTCAGTGG + Intergenic
1158024815 18:52884050-52884072 TCTGGCAGCAGAGTTTTCGGTGG - Intronic
1158361325 18:56677313-56677335 TCTGGAACCAGACTTTTCAGTGG - Intronic
1158431483 18:57391338-57391360 TCTGGCAGCACACTTTTCAGTGG + Intergenic
1158468814 18:57715663-57715685 TCTGGCAGCAGACTTTTCAGTGG + Intronic
1158948817 18:62473095-62473117 TCCGTCAGCAGACTTTTCAGTGG - Intergenic
1159080784 18:63733185-63733207 TCTGGCAGCAGACTTTTCAATGG + Intergenic
1159718567 18:71856776-71856798 TCTGGCAGCAGACTTGTTAGTGG + Intergenic
1159775172 18:72596765-72596787 TCTGGCAGCAGATTTCTCAGTGG - Intronic
1159896290 18:73999981-74000003 TCTGGCTGCAGATTTTTCAGTGG - Intergenic
1162666574 19:12218601-12218623 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1163185231 19:15634127-15634149 TCTGGCAGAAGACTTCTCAGTGG - Intronic
1164039683 19:21483672-21483694 CCCGGCAGCCCCCGTTTCAGGGG + Intronic
1165645666 19:37433646-37433668 TCTGGCAGCAGACTTTTCAGTGG + Intronic
1165964173 19:39561206-39561228 CCTGGCAGCAGATTTTTTAGTGG - Intergenic
1166176907 19:41080255-41080277 ACTAACAGCAGACTTTTCAGTGG - Intergenic
1166408067 19:42537549-42537571 TCTGGCAGCAGACTTTTCAGTGG - Intronic
925249417 2:2419731-2419753 TCTAACAGCAGACTTTTCAGTGG - Intergenic
925269623 2:2593379-2593401 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
925484644 2:4314702-4314724 TCTGGCAGCATACTTCTCAGTGG - Intergenic
926148677 2:10412441-10412463 CCTGGAAGCAGACTATCCAGGGG - Intronic
926478823 2:13360779-13360801 TCAGGCAGCAGACTTTTCAGTGG + Intergenic
927569968 2:24150776-24150798 TCTGGCAGCAGACTTTTCAGTGG - Intronic
927829490 2:26336872-26336894 CCTGGCAGTAGCCATTTCAGTGG + Intronic
928293757 2:30062919-30062941 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
928484317 2:31713754-31713776 TCTGGCAGCAGGCTTTTAAGTGG + Intergenic
928485890 2:31730673-31730695 TCTGGCAGCAGACTTCTCAGAGG + Intergenic
928495481 2:31827545-31827567 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
928609721 2:32980925-32980947 TCTGGCAGCAGGCTTTTCACTGG - Intronic
928715338 2:34054252-34054274 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
928763278 2:34610031-34610053 TCTTGCAGCAGACTTTTCAGTGG - Intergenic
928768166 2:34672527-34672549 CCTGGCAGCAGACTTTTTAGTGG + Intergenic
928783767 2:34856242-34856264 TTTGGCAGCAGACTTTTCAATGG + Intergenic
928834520 2:35528082-35528104 ACTGACAGCAGACTTTTCAGTGG - Intergenic
928851828 2:35757765-35757787 TCTGGCAGCAGGCTTTTCAGTGG - Intergenic
929215425 2:39406521-39406543 TCTGACAGCAGACTTTTCAGTGG + Intronic
929388459 2:41440706-41440728 TCTGGCAGCAGAGTTTTCAGTGG - Intergenic
929529095 2:42735311-42735333 TCTGGCAGCAGACTTCTTAGTGG - Intronic
929601591 2:43207925-43207947 CCCTGCAGCTGACATTTTAGTGG + Intergenic
929926368 2:46215423-46215445 TCTGACAGCAGACTTTTCAGTGG - Intergenic
930041294 2:47126861-47126883 TCTGACAGCAGACTTCTCAGTGG - Intronic
930288626 2:49466171-49466193 TCTACCAGCAGACTTTTCAGTGG - Intergenic
930475674 2:51877890-51877912 TCTGGCAGCAAACTTTTCAGTGG + Intergenic
930687544 2:54325599-54325621 CCCTGCAGCAGGCTTTTCCCTGG - Intergenic
930778507 2:55198804-55198826 TCTGGCAGCAGACATTTTAGTGG + Intronic
930944702 2:57060017-57060039 CCTGGCAGCAGATTTTTTAGTGG - Intergenic
930970377 2:57387558-57387580 TCTGGCAGCAGACTTTTAAGTGG + Intergenic
930981075 2:57526940-57526962 TCTGGCAGCAGACTTCTCAGTGG - Intergenic
931161715 2:59699997-59700019 CCTGTCAGCAGACTTTTCAGTGG - Intergenic
931406672 2:61986225-61986247 TCTGGCAGCAGGCTTTTCAGTGG - Intronic
931568827 2:63646753-63646775 TCTGGAAGCAGACTTTTCAGTGG - Intronic
931583085 2:63797972-63797994 TCTGGCAGAAGACTTTTCAGTGG + Intronic
931637464 2:64353602-64353624 TCTGACATCAGACTTTTCAGTGG + Intergenic
932847586 2:75151579-75151601 CCCTGCAGCAAACTTTTGACTGG - Intronic
932889726 2:75581763-75581785 TCTGGCAGTAGACTTTTCAGTGG + Intergenic
932931489 2:76045002-76045024 TCTGGCAGCAGACTTCTCAGTGG + Intergenic
933053588 2:77632751-77632773 TCTGGCAGCAGACTTTTCCATGG - Intergenic
933227340 2:79766375-79766397 TCTGGCAGCAGACTTTTCAGTGG - Intronic
933333009 2:80919183-80919205 TTTGGCAGCAGACTTTTCAGTGG - Intergenic
933339311 2:81002424-81002446 CCTGGCAGCAGAGTTTTCAGTGG - Intergenic
933341473 2:81031965-81031987 TCTTGCAGCAGACTTTTTAGTGG - Intergenic
933539370 2:83619070-83619092 CCCTGCAGCAGACTTTTGCCTGG + Intergenic
935018699 2:99209915-99209937 ACCGGCAGCTGACTTCTTAGTGG - Intronic
935078399 2:99768843-99768865 TCTGGCCGCAGACTTTTCAGCGG - Intronic
935356404 2:102205580-102205602 TCTAGCAGCAGACTTTTCAGTGG - Intronic
935437689 2:103054474-103054496 TCTGGCAGCAGACTCTTCACTGG - Intergenic
935576351 2:104715543-104715565 TCCGGCAGCAGACATTTCAGTGG - Intergenic
935835596 2:107049630-107049652 TCTCACAGCAGACTTTTCAGTGG - Intergenic
935989729 2:108708215-108708237 TCTGGCAGCAGACTTCTCAGTGG + Intergenic
936640763 2:114310421-114310443 TCTGGAATCAGACTTTTCAGTGG - Intergenic
936825217 2:116574284-116574306 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
936832019 2:116657964-116657986 TATGGCAGCAGACTTTTCAATGG + Intergenic
936885227 2:117301807-117301829 TCTAGCAGCAGACTTTTCAGTGG + Intergenic
937380758 2:121374357-121374379 CCCTGCAGCAGACTTTTGCCTGG - Intronic
937551996 2:123106150-123106172 TCTGGCAGCAGACTTCTCAGTGG - Intergenic
937560780 2:123221098-123221120 TCTGACAGTAGACTTTTCAGTGG + Intergenic
937617779 2:123946074-123946096 ATTGGCAGCAGACTTTTCAGTGG + Intergenic
937793812 2:125993319-125993341 TCTGGCAGCAGACTTCTCAGTGG - Intergenic
938217178 2:129528162-129528184 TCTGGCAGCAGACTTCTCAGTGG + Intergenic
938566446 2:132523010-132523032 ACCTGCAGCAGGCTCTTCAGAGG - Intronic
938619514 2:133034162-133034184 TCTGGCAACAGACTGTTCAGTGG + Intronic
939244624 2:139608206-139608228 TCTGGCAGCAGACTTTTCAATGG - Intergenic
939443008 2:142274312-142274334 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
939483210 2:142776233-142776255 TCTGGCAGCAGACTTTTCAGCGG - Intergenic
939707715 2:145476312-145476334 TCTGGCAACAGACTTTTCAGTGG - Intergenic
939725500 2:145715883-145715905 TCTGGCAGCAGACTTTCCATTGG + Intergenic
939800615 2:146702206-146702228 CCTGGCAGCAGGCTACTCAGTGG + Intergenic
940468844 2:154066522-154066544 TCTGGCAGCAGACTTTTCAGTGG + Intronic
940503580 2:154525759-154525781 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
940547344 2:155104335-155104357 CCTGGCAGCAGATGTTTCAGTGG + Intergenic
940629544 2:156220553-156220575 TTTGGCAGCAGACCTTTCAGTGG + Intergenic
940803231 2:158155886-158155908 TCTGGCACCAGACTTCTCAGTGG + Intergenic
940947949 2:159639041-159639063 TCTGGCAGCACACTTTTCAATGG + Intergenic
941202284 2:162526489-162526511 CCCCGAAGCAGCCATTTCAGAGG + Intronic
941227851 2:162870348-162870370 TCTGCCAGCAGACTTTTCAGTGG + Intergenic
941302853 2:163826175-163826197 TCTGGCAGAAGACTTTTCAGTGG - Intergenic
941528065 2:166630619-166630641 TCTTGCAGCAGACTTTTCAGTGG - Intergenic
941560055 2:167033674-167033696 TCTGGCAGCAGACTTCTCAGTGG + Intronic
941678787 2:168372871-168372893 TCTGGCCCCAGACTTTTCAGTGG + Intergenic
941742423 2:169048824-169048846 TCTGTCAGCAGACTTTTCAGGGG + Intergenic
942391597 2:175500805-175500827 TCTGGCAGCAGAGTTTTTAGTGG - Intergenic
942515472 2:176748122-176748144 CCCTGGAACAGACATTTCAGAGG + Intergenic
942569710 2:177301705-177301727 TCTGGCAGCAGACTTCTCAGTGG - Intronic
942750315 2:179279079-179279101 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
942814119 2:180032268-180032290 TCTGGCAACAAACTTTTCAGTGG - Intergenic
942846066 2:180427215-180427237 CACTGAAGCAGACTTCTCAGTGG + Intergenic
942975529 2:182013380-182013402 TCTGGCAGCAGACTTCTCAATGG - Intronic
943117312 2:183690141-183690163 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
943128088 2:183821514-183821536 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
943170258 2:184388340-184388362 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
943309894 2:186312420-186312442 TCTGGTAGCAGACTTCTCAGTGG + Intergenic
943484532 2:188463361-188463383 TCTGACAGTAGACTTTTCAGTGG - Intronic
943485283 2:188472116-188472138 TCTGGCAGCAGAATTTCCAGTGG - Intronic
943866858 2:192936640-192936662 TCTGGCAGCAGAATTTTCAGTGG - Intergenic
943913279 2:193595070-193595092 TCTGGCAACAGACTTTTCAGTGG + Intergenic
943923489 2:193740162-193740184 TCTGGCAGCAGATTTTCCAGTGG + Intergenic
943933767 2:193887625-193887647 AGAGGCAGCAGAGTTTTCAGTGG + Intergenic
944005091 2:194895370-194895392 TCTGGCAGCAGACTTCTCAGTGG - Intergenic
944021462 2:195110165-195110187 TCTGGCAGCAGACCTTCCAGTGG + Intergenic
944078833 2:195761625-195761647 TCTGGCAGCAGACTTTTCATTGG + Intronic
944377190 2:199059390-199059412 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
944616181 2:201463406-201463428 TCTTGCAGCAGACTTATCAGTGG - Intronic
944760642 2:202810137-202810159 TCTGGCAGTAGACTTTTCAGTGG + Intronic
944955492 2:204803071-204803093 TCTGGCAGCAGACTTTTCAGTGG + Intronic
944963164 2:204899960-204899982 TCTGGCAGTAGACTTCTCAGTGG - Intronic
945211019 2:207382050-207382072 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
945334372 2:208573901-208573923 TCTGGCAGTAGACTTCTCAGTGG + Intronic
945461759 2:210117538-210117560 TCTGGTAGCAGACTTCTCAGGGG + Intronic
945739524 2:213643308-213643330 TCTGGCAGCAAACTTTTCAGTGG - Intronic
945754269 2:213827857-213827879 TCTGGCAGCAGACTTTTCAGTGG - Intronic
946197971 2:218049433-218049455 TCTGGCAGCAGACTTCTTAGTGG - Intronic
946984904 2:225260047-225260069 TCTGGCTGCAGACTTTTCAGTGG + Intergenic
947439510 2:230107133-230107155 TCTGGCAGCAGACTTTTCAATGG - Intergenic
947677707 2:231998911-231998933 GCCAGTAGCAGCCTTTTCAGAGG + Intronic
947686902 2:232095900-232095922 TGTGGCAGCAGACTTTCCAGTGG - Intronic
947892874 2:233641854-233641876 TCTGGCAGCAGCCTTTTCAGTGG - Intronic
948475303 2:238214702-238214724 TCCGGCAGCAGACTTTTCAGTGG - Intergenic
1168813633 20:722072-722094 CCCGGCAGCTGGCTTCTCCGGGG - Intergenic
1168917032 20:1498413-1498435 TCTGGCAGCAGATTTTTCAGGGG - Intergenic
1168941075 20:1711869-1711891 CCAGGCACCAGGCTTTCCAGTGG + Intergenic
1169587213 20:7098360-7098382 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1169628865 20:7602377-7602399 TCTGGCAACAGACTTTTCAGTGG + Intergenic
1170086768 20:12542788-12542810 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1170311680 20:14998925-14998947 TCTGGCAGCAGACTTCTCAATGG + Intronic
1170709001 20:18773302-18773324 TCTGGCAGCAGACTTCTCAGTGG - Intergenic
1170863898 20:20136081-20136103 TCTGGCAGCAGACTTTTCAGTGG - Intronic
1171777770 20:29386514-29386536 TCTGACAGCAGACTTTTCAGGGG - Intergenic
1171779587 20:29407411-29407433 TCTGGCAGCAGACTTTACAGTGG + Intergenic
1171819531 20:29821707-29821729 TCTGACAGCAGACTTTTCAGGGG - Intergenic
1171823041 20:29873213-29873235 TCTGGCAGCAGACTTTACAGTGG + Intergenic
1171897064 20:30817099-30817121 TCTGGCAGCAGACTTTACAGTGG - Intergenic
1171898298 20:30831476-30831498 TCTGACAGCAGACTTTTCAGGGG + Intergenic
1172419198 20:34799641-34799663 TCTGGCAGCAGACGTTTTAGTGG + Intronic
1172825851 20:37785111-37785133 TCTGGCAGCAGACTTCTCAGTGG - Intronic
1173099103 20:40067187-40067209 TTTGGCAGCAGACTTTTCAGTGG + Intergenic
1173374660 20:42472495-42472517 CCCGGCAGCTGACCCTGCAGTGG - Exonic
1174691054 20:52505013-52505035 TCTGGCAACAGAATTTTCAGCGG + Intergenic
1174831611 20:53818647-53818669 TTTGGCAGCAGACTTTTTAGTGG - Intergenic
1174938754 20:54900199-54900221 TTTGGCAGCAGACTTTTCAGTGG + Intergenic
1176654910 21:9579633-9579655 CCGGGCAGGAGCCTTTGCAGGGG + Intergenic
1176899523 21:14422170-14422192 TCTGGCAGCAGACATTTCAGTGG + Intergenic
1176917756 21:14646310-14646332 TCCGGCAACAGACTTTTCAGTGG + Intronic
1177105370 21:16947915-16947937 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1177137355 21:17319251-17319273 TCTGGCAGCAGACTTCTCAGTGG + Intergenic
1177275801 21:18911704-18911726 TCTGGCAGCAGAATTCTCAGTGG - Intergenic
1177503839 21:21996437-21996459 CCCTACAGCAGACTTTACAGGGG - Intergenic
1177532093 21:22373800-22373822 CCCTGCAGCAGACTTCTGGGTGG + Intergenic
1177850179 21:26336283-26336305 TCTGATAGCAGACTTTTCAGGGG + Intergenic
1179652697 21:42822414-42822436 ACTGGCAGCAGACTTCTCAGTGG + Intergenic
1179842473 21:44086260-44086282 CCCTGCAGCAGGATTCTCAGAGG + Intronic
1180251398 21:46592519-46592541 CCCTGCAGCAGACTTTTGCTTGG - Intergenic
1180323517 22:11346399-11346421 TCTGACAGCAGACTTTTCAGGGG - Intergenic
1181152400 22:20894237-20894259 CCAGGCAGTGGACTTTTCTGGGG + Intergenic
1181717126 22:24739482-24739504 TCTGGCAGCAGACTTTTCAGTGG + Intronic
1182178912 22:28323907-28323929 GCTGGCAGCAGACATTTGAGTGG + Intronic
1184147918 22:42622397-42622419 CCCCGCAGCTGACCTTCCAGTGG - Intronic
1184862703 22:47183448-47183470 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
949156062 3:828649-828671 TCTGGAAGCAGACATTTCAGTGG + Intergenic
949158666 3:855656-855678 TCTTGCAGCAGACTTTTCAGTGG + Intergenic
949428652 3:3947887-3947909 TCTGGCAGCAAACTTTTCAGTGG - Intronic
949448305 3:4159903-4159925 TTTGGCAGCAGACTTTTCAGTGG - Intronic
949452653 3:4204329-4204351 TCTGGCAGCAGACTTCTCAGTGG - Intronic
949829045 3:8195173-8195195 TTTGGCAGCAGACTTTTAAGTGG - Intergenic
950009027 3:9709441-9709463 CCGGGCAGCAGAGGTTGCAGTGG - Intronic
950347604 3:12311807-12311829 TCACGAAGCAGACTTTTCAGAGG - Intronic
950695362 3:14697020-14697042 TCTGGCAGCAGACTTTTCAGTGG - Intronic
950800475 3:15548010-15548032 TCTCGCAGCAGACTTTGCAGTGG - Intergenic
951032053 3:17893759-17893781 TCTGGCAGCAGACTTTTCAGTGG - Intronic
951100639 3:18684317-18684339 CCCTGCAGCAGACTTTTGCCTGG - Intergenic
951204617 3:19912240-19912262 TCTGGCAGTAGACTTTTCAGTGG + Intronic
951255188 3:20440360-20440382 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
951259717 3:20493765-20493787 TTCGGCAGTAGACTTTTTAGTGG - Intergenic
951310099 3:21115400-21115422 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
951398884 3:22205159-22205181 TCTGGCAGCACACTTTTCAGTGG + Intronic
951423314 3:22512611-22512633 TCTGGCAGCAGAATATTCAGTGG + Intergenic
951435272 3:22655748-22655770 TCTGGTAGCAGACTTTTCAGTGG - Intergenic
951436783 3:22674756-22674778 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
951494819 3:23314797-23314819 TCTGACAGCAGTCTTTTCAGTGG - Intronic
951860850 3:27250764-27250786 TCTGGCAGCAGACTTTTCAGTGG - Intronic
951972949 3:28468609-28468631 CCTGTCAGCAAACTGTTCAGTGG + Intronic
952149259 3:30568731-30568753 TCTGGAAGCAGACTTTTCAGTGG + Intergenic
952202948 3:31150002-31150024 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
952567047 3:34671092-34671114 TCTGGCAGTAGACTTTTCAGTGG + Intergenic
952676884 3:36043256-36043278 TCTGGCAGCACACTTTTCAGTGG - Intergenic
952811551 3:37408946-37408968 TCTGGCAGCAGACTTCTCAGTGG - Intronic
953088358 3:39697208-39697230 TGCAGCAGCAGACTTCTCAGTGG + Intergenic
953217408 3:40932392-40932414 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
953322086 3:41981842-41981864 TCTGGCAGTGGACTTTTCAGTGG - Intergenic
953363926 3:42325518-42325540 CACTGCAGCAGAATTTTCATAGG + Intergenic
955336079 3:58087526-58087548 CCGGGCAGCAGAGGTTGCAGTGG - Intronic
955395501 3:58554308-58554330 CCCTGCAGCAGACTTCTGCGTGG + Intergenic
956476316 3:69623544-69623566 TCTGGCGGCAGATTTTTCAGTGG + Intergenic
956549684 3:70443808-70443830 TCTGGCAGCAGACTTCTCTGTGG + Intergenic
957085546 3:75673199-75673221 TCTGGCAGCCGACTTTACAGTGG - Intergenic
957087428 3:75694249-75694271 TCTGACAGCAGACTTTTCAGGGG + Intergenic
957268017 3:77992559-77992581 TCCGGCAGCAGACTTTTCAGTGG - Intergenic
957434350 3:80154417-80154439 TCTGACAGTAGACTTTTCAGTGG - Intergenic
957485690 3:80859182-80859204 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
957672404 3:83322751-83322773 TCCGGAAGCAGACTTTTCACTGG - Intergenic
957907453 3:86576693-86576715 TCTGACAGTAGACTTTTCAGTGG - Intergenic
957916016 3:86688604-86688626 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
957925643 3:86806826-86806848 TTTGACAGCAGACTTTTCAGTGG + Intergenic
957977276 3:87462443-87462465 TCTGGCAGCAGACTTCTCAGAGG + Intergenic
958078534 3:88714474-88714496 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
958147294 3:89641873-89641895 ACTGGAAGCAGACTTTTCAGTGG + Intergenic
958617719 3:96516461-96516483 TTTGGCAGCAGACTTTTCAGTGG + Intergenic
958632113 3:96698273-96698295 TCTGGCATCAGATTTTTCAGTGG - Intergenic
958650065 3:96927009-96927031 CCCTGCAGCAGACTTTATACTGG + Intronic
958683028 3:97354898-97354920 TCTGGCAGAAGACTTCTCAGTGG + Intronic
958756709 3:98258519-98258541 TCTGGCAGCAGACTTTTCAATGG - Intergenic
958757554 3:98269361-98269383 TCTGGCAGCAAACTTTTCAGTGG - Intergenic
958840156 3:99193539-99193561 CCCGGCAGCAGACTTTTCAGTGG + Intergenic
959113585 3:102149821-102149843 TCTGGCAGCGGACTTCTCAGTGG + Intronic
959118310 3:102204448-102204470 TCTGGCAGCAGACTTTTCAGTGG - Intronic
959124861 3:102278552-102278574 TCTGGCAGCAGACTTCTCAGTGG - Intronic
959216021 3:103451029-103451051 TCTGGCAGCAGACTCTTCAGTGG + Intergenic
959304088 3:104637536-104637558 TCTGGAAGCAGACTTTTCAGTGG + Intergenic
959408603 3:105993501-105993523 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
959474543 3:106792589-106792611 TCTGGCAGTAGACTTTTCAGTGG + Intergenic
959507930 3:107176302-107176324 CCCTGCAGCAGACTTTTTCCTGG - Intergenic
959547237 3:107611580-107611602 TCTGGGAGCAGTCTTTTCAGTGG - Intronic
959717266 3:109446274-109446296 ACTAGCAGCAGATTTTTCAGTGG + Intergenic
959797942 3:110455506-110455528 TCTGGCTGCAGACTTCTCAGTGG - Intergenic
959841891 3:110985790-110985812 TCTGCCAGCAGACTTCTCAGTGG + Intergenic
960207136 3:114916741-114916763 TCTGGCATCAGACTCTTCAGTGG - Intronic
960214291 3:115011448-115011470 TCTGGCAGCAGACTTTTCACTGG + Intronic
960565135 3:119124954-119124976 TCTGGCAGCAGACTTTTCAGTGG + Intronic
960784813 3:121361138-121361160 CTGGGCAGCAGACTTTTCAGTGG - Intronic
960792394 3:121447869-121447891 TCTGGCAGCAGACTTTTTAGTGG - Intronic
960862512 3:122166398-122166420 TCTGGCAGCAGACTTATCAGTGG - Intergenic
960870189 3:122240181-122240203 TCTGGCAGCAGACTTTTCAGTGG + Intronic
961610702 3:128135175-128135197 TCTGGCAGCAGACTTCTCAGTGG + Intronic
961952539 3:130764551-130764573 GCCGGCAGCAGACTTTTGAGTGG + Intergenic
961964220 3:130886183-130886205 TCTGGCAGCAGACTTTTCAGTGG - Intronic
962078544 3:132112863-132112885 TCTGGCAGCAGACTTTTTAGTGG - Intronic
962193783 3:133338348-133338370 TCTGGCAGCAGACTTCTTAGTGG + Intronic
962465714 3:135656358-135656380 TCTGGCAACAGACTTTTCAGTGG + Intergenic
962483528 3:135818265-135818287 TCTGGCAGTAGACTTTTCAGTGG + Intergenic
962584642 3:136829766-136829788 TCTGCCAGTAGACTTTTCAGTGG - Intronic
962638630 3:137359864-137359886 TCTTGCAGCAGACTTTTCAGTGG - Intergenic
962668003 3:137675339-137675361 TCTGGCAGCAGACTTTTTAGTGG + Intergenic
962688565 3:137870567-137870589 TCTGGCAGTAAACTTTTCAGTGG + Intergenic
962817374 3:139014074-139014096 TCCAGCAGCAGACTTTTCAGTGG - Intronic
962862439 3:139417226-139417248 TCTGGCTGCAGACTTCTCAGTGG - Intergenic
962870723 3:139490304-139490326 CCTGGCAGTAGACTTTTCAGTGG - Intergenic
963154358 3:142079684-142079706 CCCGGCAGCAGACTTTTCAGTGG + Intronic
963179695 3:142340716-142340738 TCTGGCAGCAGACTTTTCAGTGG + Intronic
963310292 3:143701957-143701979 TCTGGCAGCAGACTTTTCAGTGG + Intronic
963330725 3:143911747-143911769 TCTGGCAGCAGACTTCTCATTGG + Intergenic
963411512 3:144933159-144933181 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
963443882 3:145376371-145376393 TCTGGAAGCAGACTTCTCAGTGG + Intergenic
963448240 3:145441795-145441817 TTTGGCAGCAGACTTTTTAGTGG + Intergenic
963515496 3:146302951-146302973 TCTGACAACAGACTTTTCAGTGG + Intergenic
963591981 3:147271450-147271472 CCTGGCAGCAGACTTTTCAGTGG + Intergenic
963672980 3:148275369-148275391 TCTGGCAGTAGACCTTTCAGTGG + Intergenic
963763120 3:149305874-149305896 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
963816635 3:149838412-149838434 CCCTGCAGCAAACTTTTGACTGG + Intronic
964059400 3:152503742-152503764 TCTGGCAGCAGACTTTTAAGTGG - Intergenic
964208871 3:154206235-154206257 TCTGGCAGCAGACTTTTCAGTGG - Intronic
964239665 3:154576374-154576396 TCTGACAGCAGACTTTTCAGTGG + Intergenic
964253890 3:154751883-154751905 TCTGGCAGCAGGCTTTTCAGTGG + Intergenic
964258711 3:154809788-154809810 TCTGTCAGCAGACTTCTCAGTGG - Intergenic
964318362 3:155467640-155467662 TCTGGCTGCAGACTTTTCAGTGG + Intronic
964339164 3:155690091-155690113 TCTTGCAGCAGACTTTTCAGTGG + Intronic
964759167 3:160117100-160117122 TCTGGCAGCAGACCTTTCAGTGG + Intergenic
964804261 3:160589341-160589363 TCTGGAAGCAGACTTTCCAGTGG + Intergenic
964810285 3:160655779-160655801 TTTGGCAGCAGAGTTTTCAGTGG + Intergenic
964871893 3:161321457-161321479 TCTGGCAACAGACTTTTTAGTGG + Intergenic
964944247 3:162199573-162199595 CCGGGAAGCAGAGCTTTCAGTGG + Intergenic
964964885 3:162480245-162480267 TCTGGCAGCAGAGTTTTCAGTGG - Intergenic
964992735 3:162834286-162834308 CCTGGCGGCCAACTTTTCAGTGG - Intergenic
965099776 3:164280309-164280331 GCTGGCAGCAGAATTCTCAGTGG + Intergenic
965118152 3:164518489-164518511 TCTGGCAGCAGACTTTTCGGTGG - Intergenic
965144802 3:164888189-164888211 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
965175086 3:165321304-165321326 TCTGATAGCAGACTTTTCAGTGG - Intergenic
965236712 3:166134502-166134524 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
965358884 3:167711809-167711831 CCTAGCAGAAGACTTTTCAGTGG + Intronic
965526879 3:169730203-169730225 TCTGGCAGCAGACTTCTCAGTGG - Intergenic
965527060 3:169732091-169732113 TCTGGCAGCAGATTTTTCAGTGG + Intergenic
965975160 3:174612140-174612162 CCTGGCAGCAGACTTTCCAGTGG - Intronic
965996803 3:174893094-174893116 TCTGGCAGCAGACTCTTCAGTGG + Intronic
966142314 3:176769994-176770016 CTGGACAGCAGACTTGTCAGTGG + Intergenic
966329173 3:178791777-178791799 TCTGGCAGCAGACATCTCAGTGG + Intronic
966348761 3:179006644-179006666 TCTGGCAGCAGACTTTCCAGTGG + Intergenic
966401188 3:179548440-179548462 TCTGGCAGCTGACTTTTCAGTGG + Intergenic
966591853 3:181693013-181693035 CTCACCAGCAGACTTGTCAGTGG - Intergenic
967659936 3:192093943-192093965 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
967677672 3:192318885-192318907 TCTGGCAGCAGACTTCTCAGTGG + Intronic
967738009 3:192973901-192973923 TCTGGCAGCAGACTTCTCAATGG + Intergenic
968096560 3:195935299-195935321 TCTTGGAGCAGACTTTTCAGTGG + Intergenic
968218800 3:196917608-196917630 TCTGGCAGCAGACATCTCAGTGG + Intronic
968428928 4:543368-543390 TCTGGTAGCAGACTTTTCAGTGG - Intergenic
968682309 4:1929501-1929523 CCAGTCAGCAGACTTTCCAAAGG + Intronic
968762340 4:2449240-2449262 CCCGACAGCTTACTTTGCAGGGG + Intronic
969473737 4:7408448-7408470 TCCGGCAACAGACTTCTCAAAGG - Intronic
970379066 4:15488418-15488440 TCTGGCAGCAGACTTCTCAGTGG - Intronic
970413234 4:15831632-15831654 TCTGGCAGCAGACTTTTCAGTGG - Intronic
970441927 4:16087667-16087689 TCTGGCAGCAGACTATTCAGTGG + Intergenic
970442739 4:16096076-16096098 TCTGGCAGCAAGCTTTTCAGTGG + Intergenic
970821678 4:20223381-20223403 TCTGGCAGCAGACTTCTCAGTGG - Intergenic
971095493 4:23397655-23397677 TCTGGCAGCTGACTTTTCAATGG - Intergenic
971665038 4:29472523-29472545 TCTGGCAGCAGACTTTTCCATGG + Intergenic
971718948 4:30219589-30219611 CCTGGCAACAGACTTTTTAGTGG - Intergenic
971838396 4:31799720-31799742 TCTGACAGCAGACTTTTTAGTGG - Intergenic
971914344 4:32849214-32849236 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
972009612 4:34160173-34160195 TGTGGCAGCAGACTTTCCAGTGG + Intergenic
972103974 4:35460005-35460027 TCTGGGAGCAGATTTTTCAGTGG - Intergenic
972143004 4:35984783-35984805 TCTGGCAGCAGACTTTTCAGTGG + Intronic
972207966 4:36800468-36800490 TCTGGCAGCAGACTTTTCAATGG + Intergenic
972237276 4:37149216-37149238 GCTGGCAACAGACTTTTCAGTGG - Intergenic
972270595 4:37508026-37508048 TCTAGCAGTAGACTTTTCAGAGG - Intronic
972278246 4:37579622-37579644 TCTGGCAGCAGACTTTTCAGTGG - Intronic
972468482 4:39381817-39381839 TCTGGCAGCAGACTTTGCAGTGG - Intergenic
972856727 4:43115820-43115842 TCCGGCAGCAGACTTTTCAGTGG + Intergenic
972867318 4:43249274-43249296 GCAGGCAGTAGACTTCTCAGTGG - Intergenic
972887498 4:43510253-43510275 CCCTGCAGCAGACTTCTGATTGG + Intergenic
972904774 4:43731299-43731321 TCTGACAGCAGACTTTTCAGTGG + Intergenic
972996961 4:44892302-44892324 TCACGCAGTAGACTTTTCAGTGG - Intergenic
973763464 4:54141823-54141845 TCTGGCCTCAGACTTTTCAGTGG + Intronic
974292468 4:59949930-59949952 TCTGGCAGCAGACTTCTCGGTGG + Intergenic
974333366 4:60507756-60507778 TCTAGCAGCAGACATTTCAGTGG + Intergenic
974352730 4:60771369-60771391 TCTGGCAGCGGACTTTTCAGTGG - Intergenic
974593090 4:63981692-63981714 TCTGCCAGCAGACTTTTCAGTGG - Intergenic
974893059 4:67905681-67905703 TCTGGCAGCAGACTTTTCATTGG - Intergenic
975252914 4:72199926-72199948 TCTGGAAGCAGACTTTTCAGTGG + Intergenic
975312901 4:72923561-72923583 TCTGGTAGCAGAGTTTTCAGTGG - Intergenic
975335670 4:73172216-73172238 TCTAGCAGCAGACTTTTCAGTGG + Intronic
975365294 4:73521767-73521789 TCTGGCAGCAGAGTTTTCAGTGG - Intergenic
975369289 4:73566508-73566530 TCTGGCAGCAGATTTTTCAGTGG - Intergenic
975502079 4:75098385-75098407 TCTGGCAGTAGATTTTTCAGTGG - Intergenic
975592640 4:76016201-76016223 TCTAGCAGCAAACTTTTCAGTGG - Intronic
975629954 4:76389753-76389775 TCTGGCAGCAGGCTTTTCAGTGG + Intronic
976029852 4:80739532-80739554 TCTGGCAGCACACTTTTCAGTGG - Intronic
976041265 4:80887374-80887396 TCTGGAAGCAGACTTCTCAGTGG + Intronic
976082629 4:81373723-81373745 TCAGGCAGGAGACTTTTCACCGG - Intergenic
976161397 4:82203082-82203104 TCTGGCAGCAGACTTCTCAATGG + Intergenic
976171430 4:82308970-82308992 TCTGGCAGCTGACTTTTCAGTGG - Intergenic
976451627 4:85197668-85197690 TTTGGCAGCAGACTTTTCAGTGG - Intergenic
976453749 4:85221988-85222010 ACTGGCAGCACACATTTCAGTGG - Intergenic
976722259 4:88180216-88180238 CCTGGCAGCAGACTTTTCAGTGG + Intronic
976728306 4:88238271-88238293 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
976943578 4:90737463-90737485 TATGGCAGCAGCCTTTTCAGTGG - Intronic
977044634 4:92053167-92053189 TATGGCAGCAGACTTCTCAGGGG + Intergenic
977185074 4:93926683-93926705 TCTGGCAGCAGACTTTTTAGTGG + Intergenic
977307643 4:95344234-95344256 CCTGGCAGCAGACTTCTCAGTGG + Intronic
977396840 4:96481875-96481897 TCTGGCAGCAGATTTTTCAGTGG + Intergenic
977396875 4:96482613-96482635 TCTGGCAGCAGATTTTTCAGTGG - Intergenic
977458492 4:97295085-97295107 TCCGGCCGCAGACTTTTCAGTGG - Intronic
977753551 4:100637244-100637266 TCTGGCAGCAGACTTTTCAATGG + Intronic
977873448 4:102121869-102121891 TCTGGCAGCAGACTTTTCCGTGG - Intergenic
977985806 4:103381470-103381492 GCTGGCAGCAGACTTTTCAGTGG + Intergenic
978112612 4:104980350-104980372 TCTGGCAGCAGACTTTTCCATGG + Intergenic
978116347 4:105024266-105024288 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
978212490 4:106155206-106155228 TCCGGCAGCAGACTTTTCAGTGG - Intronic
978297792 4:107228034-107228056 TCTGGCAGCAGACTTTTCAGTGG + Intronic
978520212 4:109607735-109607757 TCTAGCAGCAGACTTTTCAGTGG - Intronic
978654933 4:111053352-111053374 TCTGGCAGCAGAATTCTCAGTGG + Intergenic
978922250 4:114199107-114199129 TCTGACAGCAGACTTTTCAGTGG - Intergenic
979213100 4:118130917-118130939 TCTGAAAGCAGACTTTTCAGTGG - Intronic
979413640 4:120408575-120408597 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
979573193 4:122253942-122253964 ACTGGCAGCAGACTTTTCAGTGG + Intronic
979594868 4:122523943-122523965 TCTGCCAGCAGACTTTTCAATGG - Intergenic
979644413 4:123051789-123051811 CTTGGCAGCAGAATTTTCAGTGG - Intronic
979879046 4:125930823-125930845 TCTGGCATCAGACTTTTCAGTGG + Intergenic
979906525 4:126300519-126300541 CCCTTCAGCAGACTTTTGACTGG + Intergenic
980172229 4:129304230-129304252 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
980413172 4:132448919-132448941 TCTGGCAGCAGACTTTTCAGAGG + Intergenic
980443180 4:132873277-132873299 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
980621157 4:135306301-135306323 CCAGGCACCAAACTTTTCTGAGG - Intergenic
980956308 4:139432594-139432616 TCTGGCAACAGACTTTTCAGTGG - Intergenic
981203586 4:142013549-142013571 TCCAGCAGCTGACTTTTCAGAGG - Intergenic
981287081 4:143030421-143030443 TCTGGCAGCAGACTTCTCAGTGG - Intergenic
981297916 4:143154628-143154650 TCTGACAGCAGACTTTTCAGTGG - Intergenic
981394972 4:144236541-144236563 GTCGGCAATAGACTTTTCAGTGG + Intergenic
981518059 4:145632348-145632370 ACTGGAAGCAGGCTTTTCAGTGG - Intronic
981530611 4:145750486-145750508 TTTGGCAGCAGACTTTTCAGTGG - Intronic
981837116 4:149066776-149066798 TCTGCCAGCAGACTTCTCAGTGG + Intergenic
981870885 4:149485058-149485080 TCTGGCAGCAGACTTTTCACTGG - Intergenic
981895839 4:149797722-149797744 TCTAGCAGCAGACTTTTCAATGG + Intergenic
981975739 4:150725379-150725401 TCTGGCAGCAGACTTTTCAGCGG + Intronic
981996350 4:150979182-150979204 TCCGGCAGCTGACTTTTCAGTGG + Intronic
982340034 4:154286998-154287020 TCTGGAAGTAGACTTTTCAGTGG + Intronic
982622947 4:157729271-157729293 TCTGGCAGCAGACTTCTCAGTGG + Intergenic
982932928 4:161430851-161430873 ATTGGCAGCAGACTTTTCAGTGG + Intronic
983287629 4:165760110-165760132 CCAGGGGGCTGACTTTTCAGAGG - Intergenic
983348829 4:166561144-166561166 TTTGGCATCAGACTTTTCAGTGG - Intergenic
983389112 4:167104882-167104904 TCTGGCAGCAGACTTTTCACTGG + Intronic
983493320 4:168414026-168414048 TCTGGCAGCAGACTTCTCAGTGG + Intronic
983586441 4:169360429-169360451 TCTGGCAGCAGACTCTTCAGTGG - Intergenic
983683814 4:170384239-170384261 TCTGGCAGTGGACTTTTCAGTGG - Intergenic
983931983 4:173462349-173462371 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
984529533 4:180900011-180900033 TCTGGTAGCAGACTTTTCAGTGG - Intergenic
984915628 4:184720676-184720698 TCTGGCAGCAGACTTTTCAGTGG + Intronic
985006080 4:185536233-185536255 AGCTGCAGCAGACTTTTAAGAGG + Intergenic
985444458 4:190014298-190014320 TCTGGCAGCAGACTTTACGGTGG + Intergenic
986046878 5:4046618-4046640 TCTGGCAACAGACTTTTCAGTGG + Intergenic
986096808 5:4564465-4564487 GCTGGCATCAGACTTCTCAGGGG + Intergenic
986155736 5:5174296-5174318 TCTGACAGCAGACTTCTCAGTGG - Intronic
986369626 5:7067195-7067217 CCTTTCAGCAGACTTTTCAGTGG + Intergenic
986492918 5:8310471-8310493 TCTGGCAGCAGACTTTTCATTGG + Intergenic
986548516 5:8926103-8926125 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
986756528 5:10841530-10841552 TCTGGTAGCAGACTTTTCAGTGG + Intergenic
986885052 5:12224378-12224400 TCCAGCAGCAGACTTCTCAGTGG - Intergenic
986899182 5:12411267-12411289 TCTGGCAGCAGACTTCTTAGTGG - Intergenic
987164163 5:15176010-15176032 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
987952977 5:24700498-24700520 TCTGGCAGCAGACTTTTTAATGG - Intergenic
987967335 5:24893466-24893488 CCCTGCAGCAGACTTCTCCCTGG + Intergenic
988065039 5:26221864-26221886 TTTTGCAGCAGACTTTTCAGTGG + Intergenic
988181367 5:27798333-27798355 CCTGGCAACAGACTTCTCAGCGG + Intergenic
988265158 5:28940224-28940246 TCTGGCAGCAGGCTTCTCAGTGG - Intergenic
989083082 5:37646709-37646731 CCTGGCAGCAGACTTTTCAGTGG - Intronic
989434347 5:41393357-41393379 TCTGGCAGCAGACTTTTTAGTGG + Intronic
989472225 5:41833299-41833321 TCTGGCAACAGACTTTTCAGTGG + Intronic
989629476 5:43466292-43466314 TCTGGCAGCAGACTTTTCAGTGG + Intronic
989672792 5:43937959-43937981 TGTGGCAGCAGACTTTGCAGTGG + Intergenic
989970558 5:50519745-50519767 TCTGGCAGCAGACTTTTCCAAGG - Intergenic
990214035 5:53511567-53511589 TCTGGCAACAGACTTTTCAGTGG - Intergenic
990774409 5:59288746-59288768 TCTGGCAGCAGACTTCTCAGTGG + Intronic
990932946 5:61113880-61113902 CTTGGCAGCAGACTTTTCAGTGG - Intronic
991180406 5:63745132-63745154 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
991205435 5:64044068-64044090 TCTGGCAGCAGATTTTTCACTGG + Intergenic
991208909 5:64082380-64082402 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
991237951 5:64420669-64420691 TCTGGCAGCAGACTTTTCAGAGG + Intergenic
991681766 5:69147375-69147397 TCTGGCAGCAGAATTTTCAGTGG - Intergenic
992002362 5:72448420-72448442 CCCAGAAGCAGACTTCTCTGGGG + Intronic
992345389 5:75870809-75870831 TCTGGCAGCAGTCTTTTCAGTGG + Intergenic
992454047 5:76900084-76900106 TCTGACAGCAGACTTTTCAGTGG - Intronic
992531587 5:77657778-77657800 CTTGGCAGCAGACTTCTCAGTGG - Intergenic
992579245 5:78154299-78154321 TGTGGCAGCAGACTTTTCAGTGG - Intronic
992587426 5:78254505-78254527 GGTGGCAGTAGACTTTTCAGTGG + Intronic
993114072 5:83698258-83698280 TCTGGCAGCAGACTTCTCAGTGG - Intronic
993138485 5:83999934-83999956 TCTGGCAGCAGACTTTTCAGTGG + Intronic
993206887 5:84893670-84893692 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
993269032 5:85769503-85769525 TCTGACAGCAGACTTTTCAGTGG - Intergenic
993309705 5:86313955-86313977 CCCTGCAGCAGACTTTTTTCTGG - Intergenic
993582489 5:89679378-89679400 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
993623516 5:90194814-90194836 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
993677469 5:90834484-90834506 TCTGGTAGCAAACTTTTCAGTGG - Intronic
994101544 5:95898679-95898701 GCCTGCAGCAGATTTTTCACTGG + Exonic
994217659 5:97157469-97157491 TCTGGCAGCAGACTTCTCTGTGG - Intronic
994226404 5:97256010-97256032 TCTGGCAGCAGCCTTTTCAGTGG + Intergenic
994235409 5:97356832-97356854 TCTGGCACCAGACTTTTCAATGG - Intergenic
994265116 5:97705919-97705941 ACTGACAGCAGAATTTTCAGTGG + Intergenic
994428541 5:99626552-99626574 TCCGGCAGTAGACTTTTCAGTGG - Intergenic
994627981 5:102244685-102244707 TCTGGCAGCAGACTTTTCAGTGG + Intronic
994660197 5:102643611-102643633 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
994845557 5:104985018-104985040 TCTAGCAGCAGAATTTTCAGTGG - Intergenic
994974298 5:106781758-106781780 CGTGGCAACAGACTTTTCAGTGG + Intergenic
995049841 5:107689673-107689695 TCTGGCAACAGACTTCTCAGGGG + Intergenic
995146663 5:108794734-108794756 TGTGGCAGCAGCCTTTTCAGTGG - Intronic
995265528 5:110154466-110154488 ACAGGCAGCAGACTTCTTAGTGG + Intergenic
995290072 5:110441970-110441992 TCTGGCAACAGACTTTTCAGTGG - Intronic
995312683 5:110731454-110731476 CCCTGCAGCAGACTTTTGCCTGG + Intronic
995572954 5:113501192-113501214 TCTGGCAACAGACTTCTCAGTGG - Intergenic
995777788 5:115744282-115744304 TCTGGCAACAGACTTTCCAGTGG - Intergenic
996116227 5:119622975-119622997 TCTGGCACCAGACTTTTCAGTGG - Intronic
996133205 5:119807761-119807783 TCTGACACCAGACTTTTCAGTGG - Intergenic
996246566 5:121271387-121271409 CCCCGCAGCAAACTTTTGCGTGG + Intergenic
996459724 5:123727137-123727159 TCTGAAAGCAGACTTTTCAGTGG + Intergenic
996906555 5:128607608-128607630 TCTGGCAGCAGACGTTTCAGGGG - Intronic
996962350 5:129266236-129266258 GCTGGCAGCTGACTTTTCAGTGG + Intergenic
997003230 5:129786500-129786522 TCTGGCAGCAGACTTCTCAATGG + Intergenic
997060046 5:130489830-130489852 CCTGGCAGCAGACTTTTCAATGG + Intergenic
997071820 5:130631665-130631687 TCTGGCAGCAGACATTTTAGTGG - Intergenic
997104898 5:131007349-131007371 TCTGGCAGCCGACTTTTCGGTGG + Intergenic
997186443 5:131886448-131886470 ACTAGGAGCAGACTTTTCAGTGG + Intronic
997813708 5:136996359-136996381 ACCAGCATCAGACTCTTCAGAGG + Intronic
997832861 5:137166210-137166232 TCTGGCAGCAAACTTTTCAGTGG + Intronic
998634218 5:143934187-143934209 TCTGGCATCAGACTTTTTAGTGG + Intergenic
998695405 5:144632509-144632531 TCGGGCAGCAGACTTTTCTGTGG + Intergenic
999002289 5:147937805-147937827 CTTGGAAGCAGATTTTTCAGTGG - Intergenic
999473702 5:151878831-151878853 CCCTGCAGCAGACTTTTGCTTGG - Intronic
999800481 5:155029042-155029064 TCTGGCAACAGACGTTTCAGTGG + Intergenic
1000153089 5:158522675-158522697 ACTGGCAGCAAACTTTTCATAGG - Intergenic
1000159673 5:158585123-158585145 TCTAGCAACAGACTTTTCAGTGG - Intergenic
1000271521 5:159688678-159688700 TCAGGCAGCAGACTTTTCAGTGG + Intergenic
1000383404 5:160649441-160649463 CCCTGCATCAAACTTTTCACTGG - Intronic
1000400307 5:160819221-160819243 TCTGGCAGGAGACTTTACAGTGG + Intronic
1000433715 5:161181784-161181806 TCTGGCAGAAGACTTTTCAGTGG + Intergenic
1000455127 5:161439191-161439213 TCTGGTAGCAGACTTTTCAGTGG + Intronic
1000496337 5:161989618-161989640 CCCGGCAGCAAACTTCTGACTGG + Intergenic
1000539167 5:162518753-162518775 TCTAGCAGCAGACTTTTCAGTGG - Intergenic
1000651130 5:163820492-163820514 TCTGGCAACAGACTTTTCAGTGG - Intergenic
1001177869 5:169488721-169488743 TTTGGCAGCAGACTTTTCAATGG + Intergenic
1002349590 5:178574541-178574563 CCCGGGAGCAACCTTTTCATTGG - Intronic
1003262078 6:4526781-4526803 TCCAGCAGCCGACTTTTCAGAGG + Intergenic
1004430241 6:15536608-15536630 CCCTGCAGCAGACTTTTGCCTGG - Intronic
1004630398 6:17415667-17415689 ACCGGCTGCAAGCTTTTCAGGGG - Intronic
1005037202 6:21567817-21567839 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1006018310 6:31100937-31100959 TCTGGCAGCAGATTTTTCAGTGG - Intergenic
1006462627 6:34171663-34171685 CCTGGCAGCAGACTTTTCAGTGG - Intergenic
1007229046 6:40335444-40335466 CCCAGCTGCAGAAATTTCAGTGG + Intergenic
1008100859 6:47389986-47390008 TCTGGCAGCAGAGTTCTCAGTGG - Intergenic
1008177417 6:48286427-48286449 TCTAGCAGCAGACTTTTCAGTGG - Intergenic
1008227103 6:48934701-48934723 TTTGGCAGCAGACTTTTCAGTGG - Intergenic
1008250177 6:49230427-49230449 TCTGGCAGTAGATTTTTCAGTGG - Intergenic
1008312394 6:49991830-49991852 TCTGGTAGCAGACTTTGCAGTGG + Intergenic
1008707411 6:54180166-54180188 TCTGGCAGCAGACTTTTCAGTGG - Intronic
1008727403 6:54439630-54439652 TCTGGCAGGAGACTTTTCAGTGG - Intergenic
1008731592 6:54489866-54489888 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1008820776 6:55628612-55628634 TCTGGTATCAGACTTTTCAGTGG - Intergenic
1008858214 6:56116315-56116337 TCTGGTAGCAGACTTTTCAGTGG + Intronic
1008882031 6:56389726-56389748 TCTCACAGCAGACTTTTCAGTGG + Intronic
1009245631 6:61233355-61233377 TCTGGCAGCAGAATTTTCAGTGG + Intergenic
1009301848 6:62033505-62033527 TCCGGCAGCAGACTTTTCAGTGG + Intronic
1009329539 6:62399799-62399821 TCTGGTAGCAGACTTCTCAGTGG - Intergenic
1009352952 6:62705876-62705898 TTTGGCAGCAGACTTTTCAGTGG - Intergenic
1009387932 6:63109841-63109863 TTTGGCAGCAGACTTCTCAGTGG - Intergenic
1009390922 6:63142334-63142356 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1009687616 6:66984834-66984856 TCTGGCAGCAGACTTTTTAGTGG - Intergenic
1009738567 6:67712742-67712764 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1009745062 6:67801023-67801045 TATGGTAGCAGACTTTTCAGTGG + Intergenic
1009771051 6:68143429-68143451 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1009783366 6:68298543-68298565 TCTGACAGCAGGCTTTTCAGTGG + Intergenic
1009802012 6:68550283-68550305 TCTGGCAGCAGACTTTTCAATGG + Intergenic
1010182102 6:73098545-73098567 TCTGGCAGCAGACTTTTCAGTGG + Intronic
1010264175 6:73849789-73849811 CCTGGCAGAAGACTTTTCTGTGG - Intergenic
1010299314 6:74241953-74241975 TCTGGCAACAGACTTTTCAGTGG - Intergenic
1010324482 6:74549483-74549505 TCTGGAAGCAGAATTTTCAGTGG - Intergenic
1010343408 6:74783298-74783320 CCTGGCAGCAGCCTTTTCAGTGG + Intergenic
1010560107 6:77339075-77339097 TCTGGCAGCAGACTTTTAAGTGG - Intergenic
1010560320 6:77341089-77341111 TCTGGCAGCAGACTTTTAAGCGG + Intergenic
1010626460 6:78141384-78141406 TCTGGCAGCAGACTTTTCAATGG + Intergenic
1010644838 6:78374189-78374211 CCTGACAGAAGACTTTTCAGTGG + Intergenic
1010676838 6:78755292-78755314 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1010772674 6:79849405-79849427 TCTGGCTGGAGACTTTTCAGTGG + Intergenic
1010775536 6:79880579-79880601 TCTGGCAGCAGACTTTTTAGTGG + Intergenic
1010975676 6:82311016-82311038 TCTGACAGCAGACTTTTCAGTGG - Intergenic
1011033401 6:82946300-82946322 CCTAGCAGCAGACTTTTCAGTGG + Intronic
1011102734 6:83742488-83742510 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1011236214 6:85219944-85219966 TCTGGCAGCAGACTTCTCAGTGG + Intergenic
1011271290 6:85582139-85582161 TCTGGCACCAGATTTTTCAGTGG + Intronic
1011290986 6:85777122-85777144 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1011322654 6:86114291-86114313 TCCGGCAGCAGACTTTTCAGTGG - Intergenic
1011386095 6:86800232-86800254 TATGGCAGCAGACTTTTCAGTGG - Intergenic
1011404221 6:87000541-87000563 TCCAGCAGCAGACTTTTCAGTGG + Intronic
1011901538 6:92303949-92303971 TCTGGCAACAGACTTTACAGTGG + Intergenic
1011914441 6:92486582-92486604 GTTGGCAGCAGACTTTTCAGTGG - Intergenic
1012028804 6:94031664-94031686 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1012091639 6:94904575-94904597 ACCGGCAGCAGACTTTTCAGTGG + Intergenic
1012125267 6:95420693-95420715 CCCTGCAGCAGACTTTTGCCTGG + Intergenic
1012224763 6:96690937-96690959 TCTGGCAGCAGACGTTCCAGTGG + Intergenic
1012512416 6:100018428-100018450 TCTGGCAGCAGGCTTTTCAGTGG + Intergenic
1012679127 6:102155790-102155812 CCTGACAGCAGACTTTTCAGTGG + Intergenic
1012712577 6:102627284-102627306 TCTGGCAGCAAACTTTTCAGTGG - Intergenic
1012761809 6:103311595-103311617 TCTGGCAGTAGACTTTCCAGTGG + Intergenic
1012823988 6:104124689-104124711 CCTGGCAGCAAACTTCTCAGTGG - Intergenic
1013184092 6:107742587-107742609 TCTGGCAACAGACTTCTCAGTGG + Intronic
1013925434 6:115466644-115466666 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1014234872 6:118942411-118942433 TCTGGCAGCAGATGTTTCAGTGG + Intergenic
1014542229 6:122691033-122691055 TCTGGCAGCAGGGTTTTCAGTGG - Intronic
1014865062 6:126519599-126519621 CTTGGCAGCAGACTTTTCAGTGG - Intergenic
1014903714 6:127001426-127001448 CTAGGAAGCAGACTTCTCAGTGG - Intergenic
1015030498 6:128588428-128588450 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1015052666 6:128861763-128861785 TCTGGCAGAAGACTTTTCAGTGG - Intergenic
1015257466 6:131195791-131195813 TCTGGCAGCAGACTTTTCAGAGG - Intronic
1015323256 6:131899558-131899580 CCAGGCAGCAGACTTTCCACAGG - Intergenic
1015460920 6:133489545-133489567 CATGGCAGCAGACTTTTCAGTGG + Intronic
1015578581 6:134699749-134699771 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1015959650 6:138633476-138633498 TCTGGCAGTGGACTTTTCAGTGG + Intronic
1016061357 6:139634569-139634591 TCTGGCAGCAGACTTCTCAGTGG - Intergenic
1016127717 6:140426693-140426715 TCTTCCAGCAGACTTTTCAGTGG - Intergenic
1016136693 6:140553274-140553296 TCTGGCAGCAGACTTTTTTGTGG - Intergenic
1016185552 6:141194243-141194265 TCTGTCAGCAGACTTTTTAGTGG - Intergenic
1016228296 6:141770320-141770342 TCTGGCAGCAGACATTTCTGTGG - Intergenic
1016229991 6:141790912-141790934 CCTGGCAGAAGACTTTTTGGTGG + Intergenic
1016457182 6:144243554-144243576 TCTGGCAGCAGACTTCTTAGTGG - Intergenic
1016538337 6:145134511-145134533 TTTGGCAGCAGACTTTTCAGTGG - Intergenic
1016541684 6:145172446-145172468 ACTGGCAGCAAACTTCTCAGTGG + Intergenic
1016567600 6:145473705-145473727 TCAGGCAGTAGACTTTTCAGTGG + Intergenic
1016612146 6:146002082-146002104 CCTGGCAGCAGACTTTTCAGTGG + Intergenic
1016623627 6:146141228-146141250 TCTGGCAGCAGACTTTTCAGTGG - Intronic
1016643318 6:146376627-146376649 TCAGGCAGCAGACTCCTCAGTGG - Intronic
1017243195 6:152194352-152194374 TCTGGCAGCAGACTCTTCAGTGG - Intronic
1017318800 6:153063884-153063906 TCTGGTAGCAGACTTTTCAGTGG + Intronic
1017387552 6:153903300-153903322 CCTGCCAGCAGGCTTTTCAGAGG + Intergenic
1017613885 6:156223127-156223149 TCTGGCAACAGACTTTTTAGTGG + Intergenic
1017924572 6:158899783-158899805 TCTGGCAGCAGACTTTTCAGTGG - Intronic
1017933998 6:158988235-158988257 TCTGGCAGCAGACTTCTCAGTGG - Intronic
1017939839 6:159042167-159042189 CCCTGCATCAGATTTTTCTGGGG - Exonic
1018316843 6:162564645-162564667 TCTGGCAGCAGACTTTTCAGTGG + Intronic
1018536029 6:164819892-164819914 GGCAGCAGCAGAATTTTCAGTGG + Intergenic
1018917431 6:168144867-168144889 TCTGGCAGCAGACTTTTTAGTGG - Intergenic
1019044583 6:169133611-169133633 TCTGGCAGAAGACTTTTCAGTGG + Intergenic
1019090017 6:169521179-169521201 TCTGGCAACAGACTTCTCAGTGG + Intronic
1019133848 6:169896322-169896344 CCCAGAAGCTGACATTTCAGTGG - Intergenic
1020515196 7:9108691-9108713 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1020519801 7:9171730-9171752 TCTAGCAGCAGAGTTTTCAGTGG - Intergenic
1020557659 7:9690891-9690913 ACCGGCAGGAGTTTTTTCAGTGG + Intergenic
1020573203 7:9891992-9892014 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1020613076 7:10425577-10425599 TCTGGCAGCAGACTTCTCAGTGG - Intergenic
1020624421 7:10559767-10559789 TCTGGCAGCAGACTATTCAGTGG + Intergenic
1020864866 7:13546470-13546492 TCTGGCAACAGACTTTTCAGTGG + Intergenic
1021130814 7:16911544-16911566 TCTGGCAGCAGATTTTTCAATGG - Intergenic
1021353908 7:19629877-19629899 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1021641181 7:22737514-22737536 TCTAGCAGCAGACTATTCAGTGG + Intergenic
1021728123 7:23569626-23569648 TCTAGTAGCAGACTTTTCAGTGG - Intergenic
1021884680 7:25127031-25127053 TCTGGCAGCAAACTTATCAGTGG - Intergenic
1022061293 7:26798227-26798249 TCTGGCAGCAGACTTTTCAGTGG + Intronic
1022080414 7:27014376-27014398 TCTGGCATCAGACTTTTCAGTGG + Intergenic
1022223396 7:28338467-28338489 TCTGGCAGCAGACTTTTCAGTGG - Intronic
1022749694 7:33211919-33211941 TGTGGCAACAGACTTTTCAGTGG - Intronic
1022875745 7:34527474-34527496 TCTGGAAGCAGACTTTTCAGTGG - Intergenic
1023208770 7:37780746-37780768 CCTGGCAGCAGATTTCTCATTGG - Intronic
1023241115 7:38148354-38148376 TCTGGCAGCAGACTTCTCAGTGG + Intergenic
1023347371 7:39285258-39285280 CATGGCATCAGAGTTTTCAGTGG - Intronic
1023786897 7:43717039-43717061 CCCCGCAGCAGACTTTTGCCTGG - Intronic
1023882714 7:44329630-44329652 CCTGGCAGCAGACTTAGCAGGGG - Intronic
1024411007 7:49040808-49040830 TGTGGCAGCAGACTTTTCTGTGG + Intergenic
1024498510 7:50073695-50073717 TCTGGCAGCAGACTTTTCAGTGG + Intronic
1024621730 7:51164410-51164432 TCTGGCAGCAGACTTTTCAAGGG + Intronic
1024705703 7:51957612-51957634 TCTGACAGCAGACTTTTCAGCGG - Intergenic
1025138216 7:56438540-56438562 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1025235945 7:57234937-57234959 CCCGGCAGCACCCTTGACAGTGG + Intergenic
1027405154 7:77852928-77852950 TCTGGCAGCAGACTTCTCAGTGG - Intronic
1027605090 7:80289761-80289783 CCTGACAGCAGACTTCTCAGTGG + Intergenic
1027808449 7:82860351-82860373 TCTGGTAGCAGACTTTTCAGTGG + Intronic
1027826317 7:83120635-83120657 TCTGGCAGCAGACTTTTTAGTGG + Intronic
1027996290 7:85428847-85428869 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1028001558 7:85503773-85503795 TCTGGTAGCACACTTTTCAGTGG + Intergenic
1028009737 7:85626393-85626415 TCTAGCAGCAGACTTTTCAATGG - Intergenic
1028037046 7:85997931-85997953 TCTGACAGCAGACTTCTCAGTGG - Intergenic
1028169580 7:87580398-87580420 TCTGGAAGCAGACTTCTCAGTGG - Intronic
1028186438 7:87791128-87791150 TCTGGCAGCAGACTTCTCAGTGG + Intronic
1028206991 7:88029823-88029845 CCTGGCAGCAGATTTTTCCATGG - Intronic
1028339219 7:89696872-89696894 TCTAGCAGCAGATTTTTCAGTGG + Intergenic
1028521795 7:91740490-91740512 TCTGGCACCAGACTTTTCAGTGG - Intronic
1028645489 7:93092062-93092084 TCTGGCAGCAGACTTCTCAGTGG - Intergenic
1028780474 7:94729568-94729590 TCTGGCTGTAGACTTTTCAGTGG + Intergenic
1028929294 7:96395645-96395667 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1029674508 7:102058996-102059018 GCCTGCAGCAGGCTCTTCAGAGG - Intronic
1029797767 7:102912967-102912989 GACCGCAGCACACTTTTCAGAGG - Intronic
1029825494 7:103188415-103188437 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1030370287 7:108692495-108692517 TCTGGCAGCAAACTTTTCAGTGG - Intergenic
1030431418 7:109453878-109453900 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1030488481 7:110202429-110202451 TCTGGCAGCAGACTTTGCAGTGG - Intergenic
1030599252 7:111573743-111573765 TCTGGCAGCAGACTTTTCAATGG + Intergenic
1030629516 7:111880224-111880246 TCTGGCAGCAGACTATTCGGTGG + Intronic
1030706588 7:112699079-112699101 CCTGGCAACAAACTTTTCAGTGG - Intergenic
1030723704 7:112899716-112899738 TCTGGCAGCACACTTCTCAGTGG + Intronic
1030881088 7:114881105-114881127 TCTGGCAGCACACTTGTCAGTGG - Intergenic
1030990507 7:116293311-116293333 TCTAGCAGCATACTTTTCAGTGG + Intronic
1031098679 7:117450673-117450695 TTTGGCAGCAGACTTTTCAGTGG + Intergenic
1031231436 7:119112847-119112869 TCTGGCAGCAGGCTATTCAGTGG - Intergenic
1031306470 7:120132807-120132829 TCTGGCAGCAGACTTCTCAGTGG + Intergenic
1031360668 7:120844942-120844964 CCCTGCAGCAGACTTTTGCCTGG + Intronic
1031472589 7:122184120-122184142 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1031638925 7:124138616-124138638 TCTGGAAGCAGACTTTTCAGTGG - Intergenic
1031746346 7:125503925-125503947 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1032928200 7:136634126-136634148 TCTGGCAACAGACTTTTCAGTGG - Intergenic
1032939370 7:136770617-136770639 TCTGTCAGCAGACTTTTCAGTGG + Intergenic
1033489032 7:141823466-141823488 CCTGGCAGCAGACTTTTCAGTGG - Intergenic
1033819857 7:145122274-145122296 TCTGGCATCAGACTTTTCAGTGG - Intergenic
1033867593 7:145711995-145712017 TCTGGCTGCAAACTTTTCAGTGG - Intergenic
1033882279 7:145900910-145900932 CCTGGAAGCAGACTTTTCACTGG - Intergenic
1033887426 7:145965545-145965567 CCTGGCAGAAGACTCTTCAGTGG + Intergenic
1034329307 7:150269114-150269136 GCCGACAGCAGAAGTTTCAGGGG + Intronic
1034398272 7:150844172-150844194 TTTGGCAGCAGACTTTTTAGTGG + Intronic
1034581562 7:152048245-152048267 TCTGGCAGCAGATTTCTCAGTGG - Intronic
1034668747 7:152840746-152840768 GCCGACAGCAGAAGTTTCAGGGG - Intronic
1034752078 7:153578241-153578263 TCTGGCAGCAGACTTCTCAGTGG + Intergenic
1035084328 7:156245289-156245311 TCTGACAGCAGACTTTTCAGTGG - Intergenic
1035139278 7:156740538-156740560 CCTGGCAGCAGACTTTTCAGTGG + Intronic
1035347127 7:158208448-158208470 TCTGGCAGCAGACTTTTCAGTGG + Intronic
1035551001 8:525109-525131 TCTGGCAGCAGGCTTTTCAGTGG + Intronic
1035587285 8:785883-785905 CCCGGCAGGAGCCTGTACAGCGG - Intergenic
1035753853 8:2016268-2016290 TCTCGAAGCAGACTTTTCAGTGG - Intergenic
1036814775 8:11893738-11893760 TCTGGCAACAGACTTTTCAGTGG - Intergenic
1038871729 8:31502558-31502580 CCTAGCAGCAGACTTTTCAGTGG - Intergenic
1038883907 8:31641516-31641538 CCGGGAAGAATACTTTTCAGTGG - Intronic
1039125744 8:34199664-34199686 CACTGCAGCAGACTGTTCTGTGG + Intergenic
1039281704 8:35993056-35993078 TCTGGCAACAGACTTTTCAGTGG - Intergenic
1039420982 8:37440159-37440181 TCTGGCAGCAGAGTTTTCAGTGG - Intergenic
1040511264 8:48098244-48098266 TCTGAGAGCAGACTTTTCAGTGG - Intergenic
1040720893 8:50322379-50322401 GCTGGCAGCAGACTTCCCAGTGG - Intronic
1040742925 8:50602852-50602874 TCTGGCAGCTGACTTTTCAGTGG - Intronic
1041416209 8:57611253-57611275 TCTGGCAGCAGAATTTTCCGTGG + Intergenic
1041823472 8:62065176-62065198 TCTGGCAGCAGACTTTTGAGTGG + Intergenic
1041883166 8:62777047-62777069 CCTGGCAGCAGACTTGTCAGTGG - Intronic
1042161852 8:65904816-65904838 CCCTGCAGCAGACTTCTCTCTGG - Intergenic
1042298227 8:67245017-67245039 TCTGGCAGCAGACTATTCAGTGG + Intronic
1042310000 8:67370278-67370300 CCAGGCAGGAGACTTTTTAAAGG - Intergenic
1042428387 8:68674947-68674969 CCTGGCAGTAGACTTTTCAGTGG + Intronic
1042450379 8:68938156-68938178 CCCAGCTGGAGACTCTTCAGGGG + Intergenic
1042898589 8:73697220-73697242 ATTGGCAGCAGACTTTTCAGTGG + Intronic
1042980431 8:74520503-74520525 TCTTGTAGCAGACTTTTCAGTGG + Intergenic
1043015772 8:74939079-74939101 TCTGGCAGTAGACTTTTCAGAGG - Intergenic
1043134026 8:76499144-76499166 TCTGGCAGCAAACTTTTCAGTGG - Intergenic
1043323138 8:79016193-79016215 TCTGGCAGCAAACTTTTCAGTGG - Intergenic
1043340090 8:79227951-79227973 TTTGGCAGCAGACTTTTCAGTGG - Intergenic
1043370337 8:79583892-79583914 CCCGGCAGCAAACTTTTGCCTGG - Intergenic
1043567533 8:81564082-81564104 TCTGGCAGAAGACTTCTCAGTGG + Intergenic
1043600417 8:81930116-81930138 TCTGGCAGCAGACTTTTTAGTGG + Intergenic
1043627173 8:82275522-82275544 TCTGGTAGTAGACTTTTCAGTGG + Intergenic
1043739985 8:83799615-83799637 TCTGACAGCAGACTTTTTAGTGG - Intergenic
1043760377 8:84061322-84061344 TCTGGCAGCTGCCTTTTCAGTGG - Intergenic
1043945782 8:86251034-86251056 TCTGGGAGCAGACTTTTCAGTGG - Intronic
1043998245 8:86845166-86845188 TCTGGCAGCAGAATTTTCAGTGG + Intergenic
1044026001 8:87173617-87173639 TCTGGCAGCAGACATTTCAGTGG - Intronic
1044066791 8:87708013-87708035 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1044241683 8:89895039-89895061 TCTGGCAGCAAACTTTTCAGTGG + Intergenic
1044326919 8:90869211-90869233 CCCTGCAGCAGACTTCTGAGTGG - Intronic
1044395029 8:91701441-91701463 TTTGGCAGCAGACTTTTCAGTGG - Intergenic
1044635291 8:94318070-94318092 GGCAGCAGCAGACTTCTCAGTGG - Intergenic
1045041094 8:98225544-98225566 TCTGGCAGCAGATTTTTCAGAGG - Intronic
1045147795 8:99367345-99367367 TCTGGCAGCAGACTTTTCAGTGG - Intronic
1045159720 8:99524832-99524854 TCTGGCAGCAGACTTTTCAGTGG + Intronic
1045189196 8:99866425-99866447 CTCAGCAGCAGACCTTTGAGGGG - Intronic
1045589557 8:103578609-103578631 TCTGGCAACAGACTTTTCAGTGG + Intronic
1045590151 8:103584132-103584154 TCTGGCAGCAGACTTTTCAGTGG + Intronic
1045598836 8:103691037-103691059 TCTGGCAGCAGACTTCTTAGAGG - Intronic
1045602248 8:103731302-103731324 TCTGGCAGCAGACTTCTCAGTGG - Intronic
1045733167 8:105264928-105264950 TTTGACAGCAGACTTTTCAGTGG - Intronic
1045784286 8:105902662-105902684 CCCAGCAGCAGACTTTTGCATGG + Intergenic
1045800870 8:106098850-106098872 TCTGGCAGCAGGCTTCTCAGTGG + Intergenic
1046169588 8:110487366-110487388 TCTGGCAGCAGATTTTTCCGTGG + Intergenic
1046267851 8:111854786-111854808 TTTGGCAGCAGACTTTTCAGTGG + Intergenic
1046335623 8:112782738-112782760 CCTGGAATCAGATTTTTCAGTGG + Intronic
1046607613 8:116388853-116388875 CCCTGCAGCAGACTTTTGCGTGG - Intergenic
1046607624 8:116388934-116388956 CCCTGCAGCAGACTTTTGCGTGG - Intergenic
1046811382 8:118537126-118537148 TCTGGAAACAGACTTTTCAGTGG - Intronic
1047352222 8:124086935-124086957 TCTGGCAGCAGACTTCTCAGTGG - Intronic
1047712307 8:127564638-127564660 CACGGCAGCAGCATTTTGAGAGG + Intergenic
1047757564 8:127930452-127930474 CCTGGCAGTAATCTTTTCAGTGG + Intergenic
1047933820 8:129755259-129755281 TCTGGCAGCAGACTTTTCACTGG + Intronic
1047937143 8:129793422-129793444 TCTGGCAGCAGACTTTTCACTGG - Intergenic
1048003684 8:130400953-130400975 CCCGGAAGCAGAGGTTGCAGTGG - Intronic
1048118954 8:131557208-131557230 TCTGGCAGCAGACTTTTTAGTGG + Intergenic
1049024448 8:139979198-139979220 CCCAGCAGGAGATTTTTCAGAGG - Intronic
1049513414 8:143041256-143041278 CCCCAAAGCAGACATTTCAGAGG + Intronic
1050121744 9:2315275-2315297 TCTTGCAGCAGAATTTTCAGTGG - Intergenic
1050145400 9:2561802-2561824 GCTGGCAGCAGACTTTTCAGTGG + Intergenic
1050316202 9:4403112-4403134 TCTGGCAGCAAACTTTTCAGTGG + Intergenic
1050356162 9:4784441-4784463 TCTGGCAACAGACTTTTCAGTGG + Intergenic
1050906680 9:11014154-11014176 TCTGGCAGCAGACTTCCCAGTGG - Intergenic
1050914138 9:11109709-11109731 TCTTGCAGCAGACTTTTCAAGGG + Intergenic
1050949048 9:11565123-11565145 TTTGGCAGCAGACATTTCAGTGG - Intergenic
1051029889 9:12660372-12660394 TCTGGCAACAGACTTTTCAGTGG + Intergenic
1051047376 9:12890611-12890633 TCTGGGATCAGACTTTTCAGTGG + Intergenic
1051465375 9:17370347-17370369 GCTGGCAGCAGACTTTTCAGTGG + Intronic
1051568991 9:18534653-18534675 CCCTGCAGCAGACTTTTGCCTGG + Intronic
1051704525 9:19862236-19862258 TCTGGCAGCAGACTATTCAGTGG + Intergenic
1051990899 9:23151843-23151865 TCTGGCATCAGACTTTTCAGTGG - Intergenic
1051992258 9:23165221-23165243 TACGGCAGCAGACATTTCAGTGG + Intergenic
1052063507 9:23988779-23988801 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1052204698 9:25825893-25825915 TCTGGCAGCACACTTTTCAGTGG - Intergenic
1052420426 9:28236126-28236148 TCTGGCAGCTGACGTTTCAGTGG + Intronic
1052614531 9:30821305-30821327 CCCTGCAGCAAACTTTTGACTGG - Intergenic
1052733084 9:32312259-32312281 TTCAGCAGCAGACTTTTCAGTGG + Intergenic
1053028260 9:34749876-34749898 CAGGGCAGCAGACTTTTCAGTGG + Intergenic
1053040274 9:34864440-34864462 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1053110462 9:35455375-35455397 TCAGGCAGCTGACTTTTGAGTGG + Intergenic
1053204860 9:36177420-36177442 TCTGGCAGCAGATTTTTCAGTGG + Intergenic
1053283115 9:36834284-36834306 CCCGGCAGCAGCCTGTCCCGGGG - Exonic
1053616382 9:39770529-39770551 CCCTGCAGCAGACTTCTCCCTGG + Intergenic
1053749636 9:41238928-41238950 TCTGGCAGCAGACTTTACAGTGG - Intergenic
1053750874 9:41253274-41253296 TCTGACAGCAGACTTTTCAAGGG + Intergenic
1053898066 9:42764751-42764773 CCCTGCAGCAGACTTCTCCCTGG - Intergenic
1054237135 9:62571860-62571882 CCCTGCAGCAGACTTCTCCCTGG - Intergenic
1054255140 9:62803265-62803287 TCTGGCAGCAGACTTTACAGTGG - Intergenic
1054256393 9:62817616-62817638 TCTGACAGCAGACTTTTCAGGGG + Intergenic
1054334918 9:63797997-63798019 TCTGACAGCAGACTTTTCAGGGG - Intergenic
1054336171 9:63812341-63812363 TCTGGCAGCAGACTTTACAGTGG + Intergenic
1054551274 9:66606371-66606393 CCCTGCAGCAGACTTCTCCCTGG - Intergenic
1054831931 9:69634767-69634789 TCTGGCAGCAGACTTTTCAGTGG + Intronic
1054982779 9:71225271-71225293 TCTCTCAGCAGACTTTTCAGTGG + Intronic
1055227547 9:74017025-74017047 TCTGGCAGCTGACTTTTCAGTGG + Intergenic
1055302274 9:74894134-74894156 TCGGGCAGTAGACTTTTCAGTGG + Intergenic
1055910999 9:81351180-81351202 TCTAGCAGCAGACTTTTTAGTGG + Intergenic
1056087969 9:83173093-83173115 CCTGGCAGCAGACTTCTCAGTGG - Intergenic
1056230367 9:84537255-84537277 TCTGGCAGCAGACTTTTTAGTGG - Intergenic
1056312143 9:85351691-85351713 CCGGGCAGGAGACTTAACAGAGG + Intergenic
1056957552 9:91094527-91094549 CCTGGCAGCAGACTTTTCAGTGG + Intergenic
1057074612 9:92131238-92131260 CTTGGCAGCAGACTTCTCAGTGG - Intergenic
1057084689 9:92198362-92198384 CTTGGCAGCAGACTTCTCAGTGG + Intergenic
1057288878 9:93787166-93787188 TCTGGCAACAGACTTTTCAGTGG - Intergenic
1057970364 9:99550779-99550801 TTTGGCAGCAGACTTTTCAGTGG - Intergenic
1058004146 9:99897451-99897473 TCTGGCAGCAGACTTCTCAGTGG + Intergenic
1058016496 9:100037879-100037901 TCTGGCAGCAGACTTTTCAGTGG + Intronic
1058218845 9:102270597-102270619 TCTGACAGCAGACTTTTCAGTGG - Intergenic
1058248913 9:102667742-102667764 TCTGGGTGCAGACTTTTCAGTGG - Intergenic
1058522631 9:105827427-105827449 ACTGGCAGCAGACCTCTCAGTGG - Intergenic
1058767993 9:108200496-108200518 TCTGGCAGCAGACTTTTCAGGGG + Intergenic
1058821160 9:108730709-108730731 TCTGGCAGCAGAGTTCTCAGTGG + Intergenic
1059041977 9:110824472-110824494 TCTGGCAGCAAACTTCTCAGTGG + Intergenic
1059555265 9:115274527-115274549 TCTGGCAGCAGATTTTTCAGTGG - Intronic
1059900407 9:118919539-118919561 TCTGGCAGCAGACTTATCAGTGG - Intergenic
1060166498 9:121421367-121421389 TGTAGCAGCAGACTTTTCAGTGG - Intergenic
1060328876 9:122645575-122645597 ACTGGCAGAAGACTTTTCAGTGG + Intergenic
1061638439 9:131930407-131930429 TCTGGCAGCAGACCTCTCAGTGG + Intronic
1062739577 9:138161436-138161458 TCTGACAGCAGACTTTTCAGGGG + Intergenic
1203371197 Un_KI270442v1:306973-306995 TCTGACAGCAGACTTTTCAGGGG - Intergenic
1203376102 Un_KI270442v1:379763-379785 TCTGGCAGCAGACTTTACAGTGG + Intergenic
1203632635 Un_KI270750v1:83086-83108 CCGGGCAGGAGCCTTTGCAGGGG + Intergenic
1186100868 X:6155216-6155238 CCTGGCAGCAGACATCTCAGTGG - Intronic
1186459837 X:9739543-9739565 CCCGGAAGCAGGGTTTTCATGGG + Exonic
1186911441 X:14172227-14172249 TCTGACAGCAAACTTTTCAGTGG - Intergenic
1187133033 X:16520433-16520455 TCTGGAAGCAGACTTCTCAGTGG + Intergenic
1187315116 X:18185765-18185787 ACGGGCAGCAGACTTTTCAGTGG + Intronic
1187594296 X:20754889-20754911 TCTGGCAGCAGACTCTTCAGTGG - Intergenic
1187601778 X:20839343-20839365 CCAGGCAGGAGCCTTTGCAGGGG + Intergenic
1187618514 X:21025400-21025422 TATGGCAGCAGACCTTTCAGTGG - Intergenic
1187623769 X:21087581-21087603 TCTGCCAGCAGACTTCTCAGTGG + Intergenic
1187637037 X:21240217-21240239 CCTGGCAGCAGACTTCCCAGTGG + Intergenic
1187639822 X:21275517-21275539 CCTGGCAACAGACTTCTCAGTGG - Intergenic
1187846366 X:23541761-23541783 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1187889290 X:23918919-23918941 TCTGGCAGCAGACTTCTCATTGG - Intronic
1188062483 X:25618168-25618190 CCCTGCAGCAGACTTCTGACTGG + Intergenic
1188068606 X:25693081-25693103 TCTGGCAGCAGACTTCTCAGTGG - Intergenic
1188071573 X:25724882-25724904 CCTGGCAGCAGACTTCTCATTGG - Intergenic
1188100637 X:26079245-26079267 AATGGCAGAAGACTTTTCAGTGG - Intergenic
1188210817 X:27421104-27421126 CCTCGTAGCAGAATTTTCAGTGG + Intergenic
1188426903 X:30059118-30059140 TCTGGCAGTAGACTTTTCAGCGG - Intergenic
1188579068 X:31687733-31687755 TCTGGCAGCAGATTTTTCGGTGG - Intronic
1188650810 X:32630277-32630299 TCTGGCAGCACAATTTTCAGTGG - Intronic
1188716155 X:33462267-33462289 TCTGGCAGCAGACTTGTCAGTGG - Intergenic
1188742749 X:33806926-33806948 TCTGGCAGCAGACTTTTTAATGG - Intergenic
1188774215 X:34192924-34192946 TCTGCCAGCAGACTTTTCAGTGG - Intergenic
1188814321 X:34692796-34692818 TCTGGTAGCAGACTTTTCAGTGG - Intergenic
1188815129 X:34704029-34704051 TCTAGCAGCAGACTTTTCAGTGG - Intergenic
1188854076 X:35170671-35170693 TCTGGCTGCAGACTTTTCAATGG - Intergenic
1188974456 X:36656675-36656697 TCTGGCAGCAGACTTTTAAATGG - Intergenic
1189019773 X:37322129-37322151 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1189641005 X:43070048-43070070 TCTGGCAGCAAACTTTTTAGTGG + Intergenic
1189769879 X:44415063-44415085 TCTGGCAGCTGACTTTTCATTGG - Intergenic
1189854208 X:45207578-45207600 TCTGGAAGCAGACTTTTCAGTGG - Intergenic
1189868614 X:45358852-45358874 TCTGGCAGCAGGCTTTTCAGTGG - Intergenic
1189870220 X:45373370-45373392 TCTGGCAGCAGCCTGTTCAGTGG + Intergenic
1189875479 X:45432104-45432126 TCTGGCAGCAGATTTCTCAGTGG - Intergenic
1189881303 X:45496391-45496413 TTTGGCAGGAGACTTTTCAGTGG - Intergenic
1190015337 X:46821604-46821626 TCTGGAAGCAGACTTTTCAGTGG + Intergenic
1190038060 X:47044323-47044345 TCTAGCAGCAGACTTTTCATTGG + Intronic
1190046566 X:47115901-47115923 TCTGGCAGCAGACTTCTCAGTGG + Intergenic
1190374134 X:49773011-49773033 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1190523269 X:51301269-51301291 TCTGGCAGCAGACTATTCAGTGG + Intergenic
1190530578 X:51370444-51370466 TCTGACAGCAGACTTTTCAGTGG + Intergenic
1190587964 X:51966173-51966195 TCTGGCAGCAGACTACTCAGTGG - Intergenic
1190594518 X:52039214-52039236 CCTGGCAGCAGACATTTAAGTGG + Intergenic
1190893683 X:54595388-54595410 TCTAGCAGTAGACTTTTCAGTGG - Intergenic
1190899240 X:54652764-54652786 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1190907706 X:54744730-54744752 TCTGACAACAGACTTTTCAGTGG - Intergenic
1190911879 X:54778925-54778947 TCTGTCAGCAGACTTTTCAGTGG + Intronic
1190919373 X:54837624-54837646 TCTGTCAGCAGACTTTTCAGTGG - Intergenic
1190943360 X:55066631-55066653 TCTGGCAGCAGACCTTTCAGAGG - Intergenic
1190960247 X:55240075-55240097 TCTGGCAGCAGACTTTTCAGTGG + Intronic
1191049017 X:56170976-56170998 TCTGGCAGCAGACTTTTCAGCGG + Intergenic
1191052557 X:56210385-56210407 TCTGGCAGAAGACTTTTCAGTGG - Intergenic
1191130989 X:57010644-57010666 TCTGGCAACAGACTTTTCAGTGG - Intergenic
1191206602 X:57841332-57841354 TCTGACAGCAGAGTTTTCAGTGG - Intergenic
1191646800 X:63490198-63490220 TCTGGCAGTAGACTTTTCAGTGG + Intergenic
1191650458 X:63531254-63531276 TCAGGCAGCAGACCTTTCAGTGG + Intergenic
1191746319 X:64492037-64492059 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1191801118 X:65080523-65080545 TCTGGCAGCAGACATTTCAGTGG + Intergenic
1191827105 X:65377562-65377584 CCTGGCAGCAGACTTTTCAGTGG + Intronic
1191829754 X:65403614-65403636 TCTGACAGCAGACTTTTCAGTGG + Intronic
1191909993 X:66140051-66140073 TTTGGCAGCAGACTTTTCTGTGG - Intergenic
1191924415 X:66294447-66294469 CTGAACAGCAGACTTTTCAGTGG - Intergenic
1191926667 X:66318994-66319016 TCTTGCAGTAGACTTTTCAGTGG + Intergenic
1191967404 X:66775236-66775258 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1191972723 X:66834710-66834732 TCTGGCAGCACACTTCTCAGTGG + Intergenic
1191994605 X:67079155-67079177 TCTGGAAGTAGACTTTTCAGTGG - Intergenic
1192001955 X:67160746-67160768 CTTGGCAGCAGACTTTTCAGTGG + Intergenic
1192002662 X:67171503-67171525 ACTGTCAGCAGACTTTTCAGTGG - Intergenic
1192027369 X:67468074-67468096 TCTGGCAGCAGACTTTTGAATGG + Intergenic
1192045819 X:67673110-67673132 TCTGGCAGCAGACTTTTCAGTGG - Intronic
1192073360 X:67964056-67964078 TCTGGCAGAAGACTTTTCAGTGG + Intergenic
1192088221 X:68123124-68123146 TCTGACAGCAGACTTTTCAGTGG + Intronic
1192135240 X:68590919-68590941 TCTGGCAGCAGCCTTTTCAGTGG + Intergenic
1192304225 X:69942541-69942563 TCTGGCAGCAGACTTCTCAGTGG - Intronic
1192406235 X:70888875-70888897 TCTGGCAGCAGACTTTTCAGTGG + Intronic
1192417574 X:70997154-70997176 TCCAGCAGCAGACTTTTCAGTGG - Intergenic
1192666514 X:73093843-73093865 TCTGGCAGCAGAAATTTCAGCGG - Intergenic
1192671561 X:73149029-73149051 TCTGGAAGCAGACTTTTCAGTGG - Intergenic
1192700652 X:73467676-73467698 TCTGGCAGTATACTTTTCAGGGG - Intergenic
1192836361 X:74803690-74803712 TGTGGCAGCAGACTTTTCAGTGG + Intronic
1192838993 X:74834649-74834671 TGTGGCAGCAGTCTTTTCAGTGG - Intronic
1192891114 X:75391504-75391526 TCTCACAGCAGACTTTTCAGAGG + Intronic
1192908372 X:75577425-75577447 CCTTGCAGCAGACTTTTCAGTGG - Intergenic
1192940536 X:75907554-75907576 TCTGGAAGCAGACTTTTCAATGG - Intergenic
1192959465 X:76112020-76112042 TCTGACAGCAGACTTTTCAGAGG + Intergenic
1192977792 X:76304239-76304261 TATGGCAGCAGACTTTTCAGTGG - Intergenic
1193013063 X:76698954-76698976 TCTGGCAGCAAACTTTTCAGTGG + Intergenic
1193016563 X:76740359-76740381 CCTGGCAGCAGACTTTTCAATGG + Intergenic
1193063908 X:77236656-77236678 TCTGGCAGCAGACATTTTAGTGG + Intergenic
1193078914 X:77384826-77384848 TCTGGCTGCAGACTTTTCAGTGG + Intergenic
1193098526 X:77580454-77580476 TCTGGCAGCAGACTTTTCAGTGG + Intronic
1193147304 X:78090924-78090946 TCAGGCAGCAGACTTTTCAGTGG - Intronic
1193172754 X:78356129-78356151 TCTGGCAGCAGACTATTAAGTGG - Intergenic
1193175348 X:78385915-78385937 TCTGGCAGAAGACTTTTCAGTGG + Intergenic
1193185240 X:78503713-78503735 CCTGGCAGCAAACTGCTCAGTGG + Intergenic
1193192669 X:78591139-78591161 TTAGGCAGCAAACTTTTCAGTGG - Intergenic
1193204668 X:78734718-78734740 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1193245994 X:79230760-79230782 CCTGGCAACAGACTTTTTAGTGG - Intergenic
1193246384 X:79235617-79235639 CCTGGTAGCAGACTTTTCAGTGG - Intergenic
1193260984 X:79405804-79405826 TCTGACAGCCGACTTTTCAGTGG + Intergenic
1193267555 X:79490085-79490107 TCTGGCAGCAGAATTTTCAGTGG + Intergenic
1193290309 X:79765476-79765498 TCTGGCAGCAGAATTCTCAGTGG - Intergenic
1193293295 X:79804279-79804301 TCTGACAGCAGACTTTTCAGTGG - Intergenic
1193370732 X:80694299-80694321 CCCGGCAGCAGACTTTTGCCTGG - Intronic
1193409214 X:81142515-81142537 TCTTGCAGCAGATTTTTCAGTGG + Intronic
1193413144 X:81189193-81189215 TCGGGCAGCAGACTTTTTGGTGG - Intronic
1193417261 X:81239812-81239834 TCTGGCAGCAGACTATTCAGTGG + Intronic
1193447684 X:81624539-81624561 TGTGGCAGCAGACTTTTCAGTGG - Intergenic
1193504801 X:82329042-82329064 CCTGGCAGCAGACATTTCAGTGG - Intergenic
1193524325 X:82571063-82571085 TTTTGCAGCAGACTTTTCAGTGG - Intergenic
1193619995 X:83739948-83739970 TCTGGCAGAAGACTTTTCAGTGG + Intergenic
1193631639 X:83896463-83896485 TCTAGCAGAAGACTTTTCAGTGG - Intergenic
1193650500 X:84124948-84124970 CCTGGCAGCATACTTTTCAGTGG + Intronic
1193664778 X:84301889-84301911 TCCAGCAGCAGACTTTTCAGTGG + Intergenic
1193665602 X:84311769-84311791 CCTGGCAGCAGACTTTTCAATGG + Intergenic
1193670466 X:84378048-84378070 TCTGGCAGCAGACTTTTCAGTGG + Intronic
1193673735 X:84420785-84420807 TCTGTCAGCAGACTTTTCAGTGG + Intronic
1193676260 X:84455866-84455888 TCTGGCAGAAGCCTTTTCAGTGG + Intronic
1193683475 X:84550615-84550637 TCTGGCAGCAGACTCTTCAGTGG - Intergenic
1193691797 X:84655207-84655229 TCTGGCAGCAGAGTTTTTAGTGG - Intergenic
1193693061 X:84670511-84670533 TCTTGCAACAGACTTTTCAGTGG + Intergenic
1193742531 X:85234087-85234109 TCTGTCAGAAGACTTTTCAGTGG + Intergenic
1193756593 X:85417094-85417116 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1193765648 X:85526451-85526473 TTTAGCAGCAGACTTTTCAGTGG - Intergenic
1193821321 X:86169247-86169269 TCAGGCAACAGACTATTCAGTGG - Intronic
1193830777 X:86287232-86287254 TCTGGCAGCAGACTTTTCAATGG - Intronic
1193887134 X:86996068-86996090 TCTGACAGCAGACTTTTTAGTGG + Intergenic
1193890977 X:87045848-87045870 CCCTGCAGCAGACTTTTGCCTGG - Intergenic
1193894978 X:87102122-87102144 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1193899464 X:87159760-87159782 TCTGGAAGCAGACTTCTCAGTGG - Intergenic
1193922094 X:87441616-87441638 TCTAGCAGCAGACTTTTTAGTGG - Intergenic
1193930772 X:87548151-87548173 TCTGGCAGCAGACTCCTCAGTGG + Intronic
1193933491 X:87585019-87585041 TCTGGCAGCACACTTTTCAGTGG + Intronic
1193981801 X:88189637-88189659 TCTGGCAGCAGACTTTCCAGTGG + Intergenic
1193986640 X:88250990-88251012 TCTGGCAGTAGACTTTTTAGTGG - Intergenic
1194006874 X:88505663-88505685 TCTATCAGCAGACTTTTCAGTGG + Intergenic
1194016787 X:88631501-88631523 TCTGGCAGCAGACTTTTCACTGG + Intergenic
1194033334 X:88842089-88842111 TCCGGCAGCAGACTTTTCAGTGG + Intergenic
1194096044 X:89639829-89639851 TCTGGTAGCAGACTTTTCAGTGG + Intergenic
1194136745 X:90152972-90152994 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1194148385 X:90290673-90290695 TCTGGTAGCAGACTTTTCAGTGG - Intergenic
1194157702 X:90413918-90413940 ACTGGCAGCAGACTTTTCAGTGG - Intergenic
1194196555 X:90901666-90901688 TCTGGCAGCAGACATTTCAGTGG - Intergenic
1194218613 X:91164863-91164885 GCTGGCAGGAGACTTTCCAGTGG - Intergenic
1194223818 X:91229184-91229206 TCTGGCAGAAGACTTTTCAGTGG + Intergenic
1194229434 X:91303291-91303313 TCTGGCAGCAGACCTTTCAATGG + Intergenic
1194236096 X:91384703-91384725 TCTGGCAGCAGACTTTTCGGTGG + Intergenic
1194247413 X:91533819-91533841 TCTGGAAGCAGACTTTTTAGTGG - Intergenic
1194264818 X:91741446-91741468 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1194285503 X:92005952-92005974 TCTGGCAGTTGACTTTTCAGTGG - Intronic
1194358221 X:92915458-92915480 ACTGTCAGCAGACATTTCAGTGG - Intergenic
1194457361 X:94121819-94121841 TCTGGCAGCAGACTTTTCAATGG - Intergenic
1194493474 X:94579797-94579819 TCAGGCAGCAGACATTTCAGTGG + Intergenic
1194495422 X:94611639-94611661 TTGGGCAGTAGACTTTTCAGTGG - Intergenic
1194500447 X:94675504-94675526 TCTCTCAGCAGACTTTTCAGTGG - Intergenic
1194535911 X:95105787-95105809 CCCTGAAGCAGCCATTTCAGAGG - Intergenic
1194591743 X:95807448-95807470 TCTGGCAGCAGACTTTTCCAAGG + Intergenic
1194692674 X:97007509-97007531 TCGGGCAGCACACTTCTCAGTGG - Intronic
1194780625 X:98021623-98021645 TCTGGTAGCAGACTTTTCAGTGG - Intergenic
1194783662 X:98056288-98056310 TCTGGCAACAGAATTTTCAGTGG - Intergenic
1194796083 X:98212406-98212428 TCTTGCAGCAGACTTTTCAATGG + Intergenic
1194800764 X:98269630-98269652 CCCTGAAGCAGCCATTTCAGAGG - Intergenic
1194823613 X:98533979-98534001 TTTGGCAACAGACTTTTCAGTGG + Intergenic
1194823626 X:98534175-98534197 TTTGGCAACAGACTTTTCAGTGG + Intergenic
1194841519 X:98750122-98750144 TCTGGCAACAGACTTCTCAGTGG - Intergenic
1194892103 X:99393233-99393255 TCTGGTAGCAGACTTCTCAGAGG - Intergenic
1194920963 X:99763089-99763111 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1194925488 X:99818856-99818878 TCTTGCAGCAGATTTTTCAGTGG + Intergenic
1194937448 X:99968642-99968664 TCTGGCAGCAGACTTCTCAGTGG - Intergenic
1194954626 X:100164780-100164802 TCTGGCTGCAGACTTTTTAGTGG - Intergenic
1195122754 X:101773388-101773410 TCTAGCAACAGACTTTTCAGTGG - Intergenic
1195136395 X:101911073-101911095 TCAGGCAGCAGACTTTTCAATGG + Intronic
1195172061 X:102279505-102279527 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1195186799 X:102407588-102407610 TCTGGCAGCAGACTTTTCAGTGG + Intronic
1195199542 X:102534453-102534475 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1195312476 X:103645024-103645046 TCTGGCACCAGACTTTTCAGTGG + Intergenic
1195455308 X:105062781-105062803 TCTGGCAGCAGACTTCTGAGTGG - Intronic
1195489207 X:105448087-105448109 TATGGCAGCAGACTTTTCAGTGG - Intronic
1195595653 X:106685142-106685164 CCTGGCAGCAAACTTTTCAGTGG + Intergenic
1195807500 X:108792303-108792325 TCTGGCAACAGACTTTTCAAAGG - Intergenic
1195820294 X:108937996-108938018 TCTGGCAGCAAACTTTTCAGTGG - Intergenic
1195823503 X:108971988-108972010 GCTGGCAGCAAACTTCTCAGTGG + Intergenic
1195824864 X:108988759-108988781 TCGGGCAGCAGATTTTTAAGTGG - Intergenic
1195828698 X:109032090-109032112 TCCGGCAGCAAAGTTTTCAGTGG - Intergenic
1195985305 X:110622952-110622974 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1196096534 X:111806916-111806938 CCTGGCAGCAGACTTGTCAGTGG - Intronic
1196154215 X:112408808-112408830 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1196214337 X:113033546-113033568 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1196233310 X:113251167-113251189 TCTGGTAGCAGACTTTTCAGTGG - Intergenic
1196233629 X:113254257-113254279 TCTGGCAGCAGACTTGTCAGTGG - Intergenic
1196242859 X:113364331-113364353 TCCAGCAGCCGACTTTTCAGTGG - Intergenic
1196247569 X:113417420-113417442 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1196253179 X:113485922-113485944 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1196461190 X:115933744-115933766 TCTGGCAGCAAACTTTTCGGTGG - Intergenic
1196485438 X:116201910-116201932 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1196511915 X:116522046-116522068 TCTGGCGGCAGACTATTCAGTGG - Intergenic
1196576407 X:117324095-117324117 TCTGGCAGCCGACTTTTCAGTGG - Intergenic
1196578937 X:117357265-117357287 TCTGGCAGCCAACTTTTCAGTGG - Intergenic
1196613946 X:117745525-117745547 TCTGGCAGCAGACTTCTCAGTGG + Intergenic
1196625537 X:117873124-117873146 TCTGGCAGAAGACTTTTCAGTGG + Intergenic
1196639435 X:118040853-118040875 TCTGTCAGCAGGCTTTTCAGTGG + Intronic
1196660721 X:118265960-118265982 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1196980402 X:121207645-121207667 TCTGGCAACAGACTTTTCAGTGG - Intergenic
1196984355 X:121252167-121252189 TTTGGCAGCAGACTTTTCAGTGG - Intergenic
1197003289 X:121465710-121465732 TCTGGCAACAGGCTTTTCAGTGG - Intergenic
1197011756 X:121572396-121572418 TCTTGCAGCAGAGTTTTCAGTGG + Intergenic
1197054091 X:122095931-122095953 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1197075991 X:122352898-122352920 TCTGGCAGCAGACTTTTCTGTGG + Intergenic
1197139438 X:123099833-123099855 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1197307847 X:124864905-124864927 TCTGGCAGCAGAGTTTTCAGTGG + Intronic
1197365384 X:125559317-125559339 TCTGGCAGCAGACTTCTTAGTGG + Intergenic
1197429612 X:126344188-126344210 TCTGGCAGAAGACTTTCCAGTGG + Intergenic
1197440206 X:126478017-126478039 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1197458156 X:126703289-126703311 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1197470173 X:126857416-126857438 CTTGGCAGCAGACTTTTCAGTGG + Intergenic
1197492178 X:127130800-127130822 TTGGGCAGCAGACTTTTCAATGG + Intergenic
1197502797 X:127262078-127262100 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1197524300 X:127543819-127543841 CCTGGCTTCAGAATTTTCAGTGG - Intergenic
1197527583 X:127581500-127581522 TTTGGCAGCAGACTTTTTAGTGG - Intergenic
1197535745 X:127687681-127687703 TCTGGCAGCAGACATTTCAGTGG - Intergenic
1197542825 X:127787626-127787648 TCTGAGAGCAGACTTTTCAGTGG - Intergenic
1197623352 X:128777429-128777451 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1197661343 X:129177280-129177302 TCTGGCAGCAAAGTTTTCAGTGG - Intergenic
1197670448 X:129271690-129271712 TCTGACAGCAGACTTCTCAGTGG - Intergenic
1197677231 X:129343208-129343230 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1197677835 X:129349095-129349117 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1198190667 X:134301244-134301266 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1198430607 X:136563047-136563069 TGTGGCAGCAGACTTTTCAGTGG - Intergenic
1198515012 X:137398623-137398645 TGTGGCAGCAGACTTTTCAGTGG - Intergenic
1198537845 X:137603594-137603616 TCTGGTAGCAGACTTTTCAGTGG + Intergenic
1198578701 X:138038818-138038840 TCTGGCAACAGACTTTTTAGTGG + Intergenic
1198612166 X:138413370-138413392 TCTGGCAGCAGACATTTCAGTGG + Intergenic
1198695067 X:139326752-139326774 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1198702387 X:139412246-139412268 TCTGGAAGCAGACTTTTCAGTGG - Intergenic
1198770338 X:140124174-140124196 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1198781621 X:140243382-140243404 TTTGGCAGCAGACCTTTCAGTGG - Intergenic
1198785277 X:140281696-140281718 CCTGGCAGGAGACTTTTCAGTGG - Intergenic
1198841211 X:140860218-140860240 TCTGTCAGCAGACTTTTCAGTGG + Intergenic
1198855953 X:141016785-141016807 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1198876178 X:141229326-141229348 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1198906740 X:141570582-141570604 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1198917034 X:141684254-141684276 TCTGGCAGCAGACTTTTCAGTGG + Intronic
1198938732 X:141929793-141929815 TCCAGCAGCAGACTTTTCAGTGG - Intergenic
1198982142 X:142410142-142410164 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1199005926 X:142695461-142695483 TCTAGCAGCAGACTTTTCAGTGG + Intergenic
1199032423 X:143015660-143015682 TCTGGCAGCGGACTTTTCAGTGG + Intergenic
1199050762 X:143234064-143234086 TATGGCAGCAGACTTTTCAGCGG + Intergenic
1199145748 X:144364187-144364209 GCTGGCAGCAGACTTTTCAGTGG + Intergenic
1199163668 X:144645730-144645752 TCTGGCAGTAGACTTTTCAGTGG - Intergenic
1199176100 X:144788759-144788781 CCTGGCAGAATATTTTTCAGTGG + Intergenic
1199192239 X:144983309-144983331 TCTGACAGCAGACATTTCAGTGG + Intergenic
1199304117 X:146246831-146246853 TCTGGCAGCGGACTTATCAGTGG + Intergenic
1199317047 X:146393252-146393274 TCTAGCAGCAGATTTTTCAGTGG - Intergenic
1199415276 X:147574759-147574781 CCTGGTAGCAAACTTTTTAGTGG + Intergenic
1199441200 X:147869270-147869292 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1199485280 X:148340064-148340086 TCTGGCAGCATACTTTTAAGTGG + Intergenic
1199908952 X:152263872-152263894 TCTGGCAGCAGACTTTTCAATGG + Intronic
1200332072 X:155308704-155308726 TCTGGAAGCAGACTTTTCAGTGG + Intronic
1200369824 X:155713548-155713570 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1200370735 X:155721595-155721617 CCTGGCAGCAGACTTTTCAGTGG + Intergenic
1200427108 Y:3033532-3033554 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1200449047 Y:3301208-3301230 TCTGGTAGCAGACTTTTCAGTGG + Intergenic
1200482491 Y:3722922-3722944 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1200494762 Y:3867441-3867463 TCTGGTAGCAGACTTTTCAGTGG - Intergenic
1200504034 Y:3990894-3990916 ACTGGCAGCAGACTTTTCAGTGG - Intergenic
1200542401 Y:4475866-4475888 TCTGGCAGCAGACATTTCAGTGG - Intergenic
1200555122 Y:4628615-4628637 GCTGGCAGGAGACTTTTCAGTGG - Intergenic
1200560283 Y:4692567-4692589 TCTGGCAGAAGACTTTTCAGTGG + Intergenic
1200566437 Y:4775352-4775374 TCTGGAAGCAGACTTTTTAGTGG - Intergenic
1200581965 Y:4961892-4961914 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1200603070 Y:5230491-5230513 TCTGGCAGTTGACTTTTCAGTGG - Intronic
1200666397 Y:6031115-6031137 ACTGTCAGCAGACATTTCAGTGG - Intergenic
1201065929 Y:10093815-10093837 TCTGGCAGCAGACTTTACGGTGG - Intergenic
1201067144 Y:10108101-10108123 TCTGACAGCAGACTTTTCAGGGG + Intergenic
1201497668 Y:14606298-14606320 CCTGACAGCAGACATCTCAGTGG + Intronic
1201760719 Y:17535226-17535248 TCTGACAGCAGACCTTTCAGGGG - Intergenic
1201762593 Y:17556635-17556657 TCAGGCAGCAGACTTTACAGAGG + Intergenic
1201838959 Y:18349353-18349375 TCAGGCAGCAGACTTTACAGAGG - Intergenic
1201840833 Y:18370764-18370786 TCTGACAGCAGACCTTTCAGGGG + Intergenic
1202023930 Y:20500349-20500371 TCTGGCAGCAGACTTGTTAGTGG - Intergenic