ID: 963154358

View in Genome Browser
Species Human (GRCh38)
Location 3:142079684-142079706
Sequence CCCGGCAGCAGACTTTTCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1584
Summary {0: 2, 1: 24, 2: 323, 3: 557, 4: 678}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963154353_963154358 22 Left 963154353 3:142079639-142079661 CCCAAGAGAAAAGAAACAAATAA 0: 1
1: 1
2: 32
3: 374
4: 3552
Right 963154358 3:142079684-142079706 CCCGGCAGCAGACTTTTCAGTGG 0: 2
1: 24
2: 323
3: 557
4: 678
963154354_963154358 21 Left 963154354 3:142079640-142079662 CCAAGAGAAAAGAAACAAATAAC 0: 5
1: 9
2: 22
3: 164
4: 1287
Right 963154358 3:142079684-142079706 CCCGGCAGCAGACTTTTCAGTGG 0: 2
1: 24
2: 323
3: 557
4: 678
963154352_963154358 23 Left 963154352 3:142079638-142079660 CCCCAAGAGAAAAGAAACAAATA 0: 4
1: 9
2: 19
3: 193
4: 1983
Right 963154358 3:142079684-142079706 CCCGGCAGCAGACTTTTCAGTGG 0: 2
1: 24
2: 323
3: 557
4: 678

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963154358 Original CRISPR CCCGGCAGCAGACTTTTCAG TGG Intronic