ID: 963155477

View in Genome Browser
Species Human (GRCh38)
Location 3:142091586-142091608
Sequence TAAGCTAGACATTTTTATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 267}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963155475_963155477 1 Left 963155475 3:142091562-142091584 CCACCAAAAAAAAAATAAATAAA 0: 1
1: 67
2: 1756
3: 13864
4: 51405
Right 963155477 3:142091586-142091608 TAAGCTAGACATTTTTATATTGG 0: 1
1: 0
2: 1
3: 15
4: 267
963155473_963155477 29 Left 963155473 3:142091534-142091556 CCAGCCTGGGCAACAGAGTGAGA 0: 21776
1: 73212
2: 167026
3: 221294
4: 302558
Right 963155477 3:142091586-142091608 TAAGCTAGACATTTTTATATTGG 0: 1
1: 0
2: 1
3: 15
4: 267
963155476_963155477 -2 Left 963155476 3:142091565-142091587 CCAAAAAAAAAATAAATAAAATA 0: 2
1: 71
2: 521
3: 18254
4: 31816
Right 963155477 3:142091586-142091608 TAAGCTAGACATTTTTATATTGG 0: 1
1: 0
2: 1
3: 15
4: 267
963155474_963155477 25 Left 963155474 3:142091538-142091560 CCTGGGCAACAGAGTGAGACTCT 0: 7153
1: 33807
2: 89412
3: 168027
4: 203499
Right 963155477 3:142091586-142091608 TAAGCTAGACATTTTTATATTGG 0: 1
1: 0
2: 1
3: 15
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963155477 Original CRISPR TAAGCTAGACATTTTTATAT TGG Intronic
907191214 1:52650416-52650438 TAAGCAAGTCATTTTTCTCTCGG + Intronic
907198945 1:52709568-52709590 CAAGCTAGACATTATTTTTTTGG - Intergenic
908301406 1:62764190-62764212 TAAACTAGACAATTTTTTCTTGG - Intergenic
909011515 1:70340357-70340379 TAAGCTAGACATTTTTAAAAAGG - Intronic
909155700 1:72072998-72073020 CAAGATAGAGATTTGTATATAGG + Intronic
909215438 1:72881715-72881737 TTAGCTATATATTTTTCTATAGG - Intergenic
909330471 1:74403661-74403683 TAAGCTAAATATTTGTATTTGGG + Intronic
909499252 1:76315212-76315234 AAAGAGATACATTTTTATATAGG - Intronic
909505680 1:76387120-76387142 TCAGCAATAAATTTTTATATTGG + Intronic
909897582 1:81092107-81092129 TAATCAAGACATTTTAGTATTGG + Intergenic
911592535 1:99764836-99764858 AAAGGAAGACAGTTTTATATGGG - Intronic
913475561 1:119233763-119233785 TAAGCTAGAATTTTTCATTTTGG + Intergenic
914689456 1:150012532-150012554 TTAGAAAGACATATTTATATGGG - Intergenic
915862790 1:159464996-159465018 TTTGCTAGACATTTTTAGCTAGG + Intergenic
916294480 1:163202457-163202479 TAATCTAGACAGTTTAATGTTGG + Intronic
917716755 1:177746025-177746047 TAAGGTATACATTTTTATTCTGG + Intergenic
919310262 1:195897518-195897540 TGAGCGATACATTTTTAAATGGG + Intergenic
919570800 1:199244486-199244508 TAAGTTAGGCATTTTTATTTGGG + Intergenic
920329858 1:205199069-205199091 TAACCTAGACATAATTATTTGGG + Intronic
923420102 1:233805058-233805080 TAAGTTAGATATTTTTGCATGGG - Intergenic
923947770 1:238908649-238908671 TAAGCTAAATATATTTATTTAGG + Intergenic
924699016 1:246431191-246431213 TAAGATACATATTTTTGTATTGG - Intronic
1064806663 10:19142236-19142258 TACACTAAATATTTTTATATTGG - Intronic
1065754033 10:28914255-28914277 TAAACTTGACATTATTATTTGGG - Intergenic
1065835042 10:29649188-29649210 TAAGCCAGAAATTTTTTCATGGG + Intronic
1067974163 10:51005482-51005504 TAAGCTGGACATTTGTAAATTGG + Intronic
1068595723 10:58900968-58900990 TAATTTGGACATTTTAATATTGG + Intergenic
1068772076 10:60833037-60833059 TGAGCTAGGTATTATTATATTGG - Intergenic
1069161563 10:65099797-65099819 TAATCTACACATGTTTTTATAGG + Intergenic
1069312215 10:67052055-67052077 TAACCTACAAATTTTTAAATGGG + Intronic
1071945746 10:90642682-90642704 TAGGCCAGACATTTTAACATTGG - Intergenic
1073221673 10:101879677-101879699 TGAGCTGCACACTTTTATATGGG - Intronic
1075507792 10:123040416-123040438 TAAGAAAGCTATTTTTATATGGG - Intronic
1079834683 11:25319230-25319252 TATGCCAGGCATTCTTATATGGG + Intergenic
1079939795 11:26665202-26665224 TAAAGTAGACATTTTTGCATGGG - Intergenic
1082864469 11:57886065-57886087 TAAATTAGACATTTAAATATGGG - Intergenic
1084293437 11:68192839-68192861 TAAGGTAGACATTTCCAGATGGG - Intronic
1086288798 11:85280891-85280913 TATGATAGAAATTTTTATTTAGG - Intronic
1087529910 11:99366975-99366997 TAAGCTGGGGATATTTATATTGG + Intronic
1089993267 11:122881769-122881791 TAAGCTGTACATTTATGTATGGG - Intergenic
1093256046 12:16869353-16869375 TAAGCTTGATATTTTTTAATTGG - Intergenic
1093307007 12:17532995-17533017 GTAGCAAGACAGTTTTATATTGG + Intergenic
1093319530 12:17696411-17696433 TAAACTAGATAATTTTTTATTGG - Intergenic
1093619544 12:21272710-21272732 AAAGATAGTAATTTTTATATTGG - Intronic
1095129784 12:38526687-38526709 AAAGATACACATTTATATATCGG - Intergenic
1095530320 12:43179525-43179547 TAAGCTAGTTATTTTTTTAAAGG - Intergenic
1095602268 12:44027487-44027509 TAACCTAGACATTTTAAAAGAGG + Intronic
1096718860 12:53506692-53506714 GAAGCCAGACAATTTTATTTGGG + Exonic
1097489244 12:60243838-60243860 TAAGGTAGAGATTGTCATATTGG - Intergenic
1099102129 12:78455660-78455682 CAAATTAGACATTTTTATAAGGG + Intergenic
1099439076 12:82679639-82679661 TAATCAAGACAGTTTGATATTGG + Intergenic
1105393825 13:20009142-20009164 TAGGTTCAACATTTTTATATAGG - Intronic
1106087137 13:26553430-26553452 TGATCCAGACATTTTTATTTTGG + Intergenic
1108481468 13:50876815-50876837 TAATCAAGACAGTTTGATATTGG - Intergenic
1108976429 13:56449629-56449651 TAATCTATACTTTTATATATTGG + Intergenic
1110378295 13:74819773-74819795 TAAGATAGACATATATATAAAGG - Intergenic
1111107048 13:83659989-83660011 TAAGTTATACATTTGTTTATGGG + Intergenic
1111187190 13:84753549-84753571 CAATGTAGACATTTTGATATTGG - Intergenic
1111360119 13:87164945-87164967 TAAGTTCAACATTATTATATGGG + Intergenic
1114745961 14:25147380-25147402 TAAAATAAACATATTTATATAGG + Intergenic
1115009414 14:28526337-28526359 TAATATACAGATTTTTATATGGG + Intergenic
1116000114 14:39233805-39233827 TAAGTGAGACAGTTTTACATGGG + Intronic
1118475555 14:66113215-66113237 TAAACTAAACAATTTTATAAAGG - Intergenic
1119292243 14:73504694-73504716 TAACCCTGACATTTTGATATGGG - Intronic
1124242812 15:28044984-28045006 AAAGGTAGACATTGTCATATTGG - Intronic
1125247566 15:37659327-37659349 TATGGTAGTCATATTTATATTGG - Intergenic
1125305960 15:38314445-38314467 TAAACTTGACATTATAATATTGG - Intronic
1125905684 15:43390274-43390296 TAAGCTAGATATTTTTAGGAGGG + Intronic
1129039735 15:72675728-72675750 TGAGCTAGGCATATTTGTATGGG - Intergenic
1131645775 15:94341542-94341564 TAGGCTTTATATTTTTATATTGG - Intronic
1131908860 15:97173753-97173775 TAACCTGGACATTTTACTATAGG - Intergenic
1135003464 16:18798092-18798114 TAAGTTAGACATGTTTAGTTAGG - Intronic
1138160759 16:54751538-54751560 TGCGGTAGACATTTTTAAATAGG + Intergenic
1139021574 16:62756332-62756354 TAAGTTAGAGATTTTGAGATAGG - Intergenic
1139197300 16:64934466-64934488 AAAGCTTGAAATTTTTAGATTGG + Intergenic
1140701309 16:77584031-77584053 TTGGATAGACATTTTAATATTGG - Intergenic
1140976325 16:80063225-80063247 TAAGCTGGACATGGTTATGTGGG - Intergenic
1144286463 17:13779398-13779420 TCAGCTAGACATTTATTTCTGGG - Intergenic
1149150314 17:53554198-53554220 TAAGGTTGACATTTTCCTATAGG + Intergenic
1149781664 17:59402371-59402393 TAAGCTAAACAGTTTTGTCTCGG + Intergenic
1150999310 17:70355377-70355399 TATGCTTGATATTTTGATATGGG - Intergenic
1151978521 17:77495859-77495881 AAAACTAGACATTTTTAACTTGG + Intronic
1153298455 18:3570966-3570988 TAACCTAGAGATTTTTGTTTTGG - Intronic
1153449147 18:5207374-5207396 TGAGCTAGCTATTTGTATATAGG - Intergenic
1153763075 18:8350359-8350381 AAAGCTATACATATTTATAAGGG - Intronic
1155878342 18:31113911-31113933 TAAGTTAAAAATTTTTATAGGGG - Intergenic
1156712392 18:39962892-39962914 TAATGAAGACATTTTTATAGAGG + Intergenic
1156824238 18:41411047-41411069 TAAGCTAGACAATTTTTAACAGG + Intergenic
1157190056 18:45574062-45574084 TAAACTAGATCTTTTTAAATGGG + Intronic
1157290278 18:46405208-46405230 TGAGCTACACATTTTACTATGGG - Intronic
1157930028 18:51811647-51811669 TAAGCTAGACAGTTTGTTCTTGG + Intergenic
1158134645 18:54193246-54193268 AAAGCCAGACACTTTTTTATGGG + Intronic
1159396703 18:67867079-67867101 GCAGCTAGAAATATTTATATTGG + Intergenic
1159434836 18:68402667-68402689 TAAGCAAGACATTTTTGTAATGG + Intergenic
1160116118 18:76081249-76081271 TAGGCTAGACCTTTTTATGATGG + Intergenic
1160476848 18:79198903-79198925 TAAGAAAAACATTTTTAAATAGG - Intronic
1162601947 19:11676227-11676249 TGAGCTAGGCATATTTGTATGGG + Intergenic
1164125088 19:22307101-22307123 AAAGCTATATATTTATATATGGG + Intronic
1165492603 19:36133386-36133408 TAAGCAAGAAATTTTTTTCTTGG - Intergenic
925747774 2:7058688-7058710 TATGTCAGAGATTTTTATATTGG + Intronic
927474658 2:23403378-23403400 TATGAGGGACATTTTTATATGGG - Intronic
928349924 2:30540987-30541009 GAGGCTGGACATTTTTCTATTGG + Intronic
928369283 2:30728990-30729012 AAAGATACACATTTTTAAATGGG + Intronic
928588188 2:32784561-32784583 GAATATAGACATTTTTACATGGG - Intronic
928725281 2:34165486-34165508 TAATCCAGACTTTTTTCTATAGG + Intergenic
929974413 2:46617564-46617586 TTAACTGCACATTTTTATATGGG - Intronic
930042298 2:47135859-47135881 TAATCTAGAGAGTATTATATTGG - Intronic
930426538 2:51219852-51219874 TAAGCTAAACATTTATTTCTGGG - Intergenic
931526042 2:63155430-63155452 TCAGCTGGGCATATTTATATGGG + Intronic
931683855 2:64775892-64775914 TAATGTAGACATTTTTATCAAGG + Intergenic
931755603 2:65371466-65371488 TAACATAGACATTTCTCTATTGG - Intronic
931856823 2:66310877-66310899 TAATCAAGACAGTGTTATATTGG + Intergenic
933142816 2:78815019-78815041 AAAACCAGACATTTTTCTATAGG - Intergenic
937385746 2:121430633-121430655 GAAGGTAGACTTTTTTATTTTGG - Intronic
939632323 2:144539716-144539738 ACAGCTAGACATGTTTATGTAGG - Intergenic
940455709 2:153896825-153896847 TAATCTAGACATTTATATTTAGG - Intronic
940716795 2:157235339-157235361 TAATTTAGAGATCTTTATATTGG - Intergenic
940806393 2:158192239-158192261 TAAGCTAGAGATGTCCATATGGG + Intronic
942578308 2:177389846-177389868 TTAGCTAGGCATTTTCACATGGG + Intronic
942719421 2:178934020-178934042 TAAGATTGACATTTTTTTTTAGG + Intronic
942920568 2:181368393-181368415 TATAGTAGACATTTTTTTATAGG - Intergenic
942994567 2:182245610-182245632 AAGGCTAGACTTTTTAATATTGG + Intronic
943244287 2:185425792-185425814 GAAGCTTTACATTTTTATTTTGG + Intergenic
944006660 2:194917000-194917022 TAAGGTATACAACTTTATATGGG + Intergenic
947243559 2:228021651-228021673 TCACCAAGACATTTTTATACGGG + Intronic
1169717998 20:8642633-8642655 TAAACAAGATATTTTAATATTGG - Intronic
1170834372 20:19871035-19871057 TCAGCTAGGAATTTTTATGTTGG - Intergenic
1173140034 20:40473858-40473880 GAAGCCAGACATGTTTACATGGG + Intergenic
1176418728 21:6497388-6497410 TAAGCTAAACATTTTTTAATTGG + Intergenic
1177277418 21:18930926-18930948 TGGGCTACACATGTTTATATAGG - Intergenic
1177442180 21:21140310-21140332 GAAGCTAAACATTTCTATTTTGG + Intronic
1177444643 21:21176960-21176982 CAGGCTAGACATTTATATTTAGG - Intronic
1179694222 21:43105710-43105732 TAAGCTAAACATTTTTTAATTGG + Intronic
1180746100 22:18090093-18090115 AAATCTATACTTTTTTATATGGG + Exonic
1181515257 22:23407105-23407127 TTAACTAGACATTTTTCTAAAGG + Intergenic
949989342 3:9565471-9565493 TAAGACAGAGACTTTTATATTGG - Intergenic
950728398 3:14934865-14934887 TAACCCAGACATTTTTATTAGGG - Intergenic
950754191 3:15159055-15159077 TTAGCTAGACACTTTAATAAGGG - Intergenic
951193637 3:19799972-19799994 TAATCTAGTAATTTTTTTATTGG - Intergenic
952351070 3:32539009-32539031 TAAGCTTAACATTTTTCTTTTGG + Intronic
955384011 3:58464420-58464442 TAAACTAGTCATTTATCTATTGG - Intergenic
955951255 3:64244516-64244538 TATGCTAGACATTCTGATGTTGG + Intronic
956990184 3:74753074-74753096 TAACATAGACATTTTTATCAAGG - Intergenic
957533018 3:81464768-81464790 TTACTTAGATATTTTTATATGGG + Intergenic
959387289 3:105726460-105726482 AAAGATATACATTTTTATTTTGG + Intronic
959545642 3:107593142-107593164 TCAGATAAACACTTTTATATTGG - Intronic
959984177 3:112554754-112554776 TAAACTAGAGTATTTTATATAGG - Intronic
960243614 3:115374767-115374789 TAACAGAGACAATTTTATATAGG - Intergenic
963155477 3:142091586-142091608 TAAGCTAGACATTTTTATATTGG + Intronic
963817770 3:149852025-149852047 TAAGCTGAACATTTTTATCCAGG - Intronic
964417166 3:156459509-156459531 CAAGCTGGACATTTATATATGGG + Intronic
965728947 3:171749492-171749514 AAAGCTAGACATTGTGATCTTGG - Intronic
966421348 3:179737663-179737685 TAAGCTGGTCATTTATATACAGG + Intronic
969853464 4:9980282-9980304 TAAACTATATATGTTTATATAGG + Intronic
970563891 4:17312194-17312216 AAAACTAGCCATTTTTCTATGGG + Intergenic
971165585 4:24179603-24179625 TTAGCTAGGCAGTTTTGTATTGG - Intergenic
974246590 4:59328097-59328119 TAAACCTGACATTTTTATAATGG + Intergenic
974713152 4:65629892-65629914 TGAGCTAGTCACTTTAATATAGG + Intronic
976335809 4:83884808-83884830 TAAGCTACATATTTTTTTAAGGG - Intergenic
976776099 4:88707565-88707587 AAAGCAAGATATGTTTATATAGG - Exonic
976961787 4:90985518-90985540 TAAGGGAGGCATTATTATATTGG - Intronic
978482074 4:109204298-109204320 GAAATTTGACATTTTTATATAGG + Intronic
979296834 4:119042504-119042526 TAATCTAAACATTCTTATTTTGG + Intronic
979957607 4:126973839-126973861 TAAACTAGACTTGTTCATATTGG - Intergenic
980222381 4:129935769-129935791 TATGCTAGGCATTTCTATATGGG + Intergenic
980274292 4:130629024-130629046 TAAGCCAGACATTTTGATACAGG + Intergenic
980289021 4:130821288-130821310 TAATCAAGACAATGTTATATTGG + Intergenic
980525033 4:133978588-133978610 TAACCTAGAATATTTTATATTGG - Intergenic
980535055 4:134108845-134108867 TAAGGAGGACATTTTTATATAGG + Intergenic
980620814 4:135301059-135301081 TAAGCTACACATTTGTTTCTAGG + Intergenic
980817100 4:137962235-137962257 TAATATAAACATTTTTATACGGG + Intergenic
981755802 4:148140797-148140819 TAAGCTATATATTACTATATTGG - Intronic
982675785 4:158374311-158374333 TAAGCTTGAATTTTTTTTATTGG - Intronic
984080772 4:175246765-175246787 TAAATTAGACAATTTTACATAGG + Intergenic
984236614 4:177166500-177166522 TAAGCTGGATATTATTAAATGGG + Intergenic
984520429 4:180795627-180795649 TATATTAGACATTTATATATTGG + Intergenic
984963980 4:185125527-185125549 AAAGCTATACATGTTTATAAGGG + Intergenic
985251166 4:188025910-188025932 TAAGCTAGATAATTATACATAGG + Intergenic
985380333 4:189388250-189388272 TAATTCAGACATTTTTATAGTGG + Intergenic
986070051 5:4273787-4273809 TAAGTTAGACATTGATAGATGGG - Intergenic
986843034 5:11720210-11720232 TAAGGTAGACTTTTTTTTAATGG - Intronic
987607798 5:20160500-20160522 TCAGGTAGACTATTTTATATAGG - Intronic
987917737 5:24237605-24237627 TATGCTAGATATTTGTTTATAGG - Intergenic
988417817 5:30968463-30968485 TAATGTAGACATTTTTGTTTGGG - Intergenic
988420196 5:30996319-30996341 AACTCTAGACAGTTTTATATTGG - Intergenic
988691297 5:33575545-33575567 GAAGCTAAAAATTTATATATAGG - Intronic
989747715 5:44850248-44850270 TTAGCTTTCCATTTTTATATAGG + Intergenic
990840849 5:60077647-60077669 TAAGCTAGACTTGTTTCCATAGG - Intronic
991260702 5:64664571-64664593 TGAGCATGACTTTTTTATATTGG + Intergenic
991440036 5:66637585-66637607 AAAGTTAGAAATTGTTATATTGG + Intronic
991455393 5:66798050-66798072 TAAGCTAGTCTTTTTAATTTAGG + Intronic
992577982 5:78139246-78139268 TAAGCTAGATATATTTAGAGTGG + Intronic
993237301 5:85329122-85329144 TATGCCACACATTTTTACATGGG + Intergenic
993396844 5:87400012-87400034 TAAAGTGGACATTTTTGTATAGG - Intronic
994404989 5:99334287-99334309 TGAGCAAGACAATTTTTTATTGG + Intergenic
994846808 5:105000187-105000209 TAAGATATACTTGTTTATATGGG - Intergenic
995341865 5:111069972-111069994 GCAGCTGGACATTATTATATAGG - Intergenic
997457352 5:134027128-134027150 TGGGCTAGACATTTCTTTATAGG - Intergenic
998844212 5:146290561-146290583 TAAGATAGGCAATTTGATATGGG + Intronic
999152622 5:149436420-149436442 TCATCAAGACAATTTTATATTGG + Intergenic
999465602 5:151801501-151801523 TAAGCTATACTTTTTTATTGAGG + Intronic
999956169 5:156704362-156704384 TTAGCTAGGCATTTTTATTTAGG - Intronic
1001675538 5:173511099-173511121 TAAGCAATATATTTTTAAATGGG - Intergenic
1002972915 6:2042587-2042609 TAAGCTACAACTTTTTAAATTGG - Intronic
1003597125 6:7483458-7483480 TAATCAAGACAATTTTGTATTGG - Intergenic
1003822357 6:9913105-9913127 TAAGCTAGAGATACTTGTATTGG - Intronic
1004206787 6:13598869-13598891 TAAGCAAGGCAAGTTTATATAGG + Intronic
1006383103 6:33712212-33712234 TAAGCCAGACATTTTTCTCTGGG + Intergenic
1006723382 6:36175804-36175826 TCAGTTAGACATTTTTGTGTAGG - Intergenic
1007020057 6:38510991-38511013 TATGCTATACTTTTATATATAGG + Intronic
1007981671 6:46165856-46165878 GAACCTAGCCATTTTTATTTGGG - Intronic
1008818834 6:55606584-55606606 TTAGGCAGATATTTTTATATGGG + Intergenic
1009797075 6:68483406-68483428 AAAGTTAGACATGTTTATATGGG - Intergenic
1009860196 6:69319862-69319884 AAAGCTAGAAACTTTCATATTGG - Intronic
1010941547 6:81924669-81924691 GAAGCTAGAAATATTTGTATAGG - Intergenic
1012645019 6:101667776-101667798 TAATCAAGAGATTTTAATATGGG + Intronic
1013042612 6:106450921-106450943 TAAGCAAGACAGTTACATATGGG + Intergenic
1013376225 6:109517595-109517617 TATGCCAGACATTTTTCTAACGG - Intronic
1013879565 6:114879537-114879559 TAAGCAAGACTTTTTAATAAGGG - Intergenic
1014343352 6:120235434-120235456 AAATTTAGACATTTCTATATAGG + Intergenic
1014382829 6:120765020-120765042 TATGCTAGGTATTATTATATTGG + Intergenic
1014698111 6:124650020-124650042 TTAGCTATAGATTTTTTTATAGG - Intronic
1016083622 6:139885386-139885408 TAAGACATACATTTTTATTTAGG - Intergenic
1016413744 6:143811614-143811636 TAAGCAAGGCATATTTATTTTGG - Intronic
1016634751 6:146275270-146275292 TAAGCTAGACCTTTTAAGGTGGG + Intronic
1016689390 6:146918913-146918935 AAAGGTAGATATTGTTATATAGG - Intergenic
1017360395 6:153562863-153562885 AAAAATAGACAATTTTATATAGG + Intergenic
1023039752 7:36161652-36161674 TAAGCTTGGCATTTGTATACCGG - Intronic
1023235840 7:38085749-38085771 TAAGCCAGACATTAATATATGGG + Intergenic
1024178823 7:46868166-46868188 TAACCTAGACAGTGTGATATTGG - Intergenic
1024757602 7:52553801-52553823 TAAGCTAGGCTTTTCTTTATTGG + Intergenic
1025060401 7:55800918-55800940 TACGATAGATATTTTGATATAGG - Intronic
1025264550 7:57444597-57444619 TAGGCTATATATTTATATATAGG - Intergenic
1025839430 7:65130990-65131012 AAAGATAGAAATGTTTATATGGG - Intergenic
1025883638 7:65564975-65564997 AAAGATAGAAATGTTTATATGGG + Intergenic
1025889808 7:65637631-65637653 AAAGATAGAAATGTTTATATGGG - Intergenic
1027830682 7:83173376-83173398 AAAGCTAGATATTAATATATTGG + Intergenic
1028785480 7:94787751-94787773 TAAACTAGATATTTTTTTCTGGG + Intergenic
1028831346 7:95329634-95329656 CAAGCAAGGCATTTTTATACAGG - Intergenic
1030169800 7:106589643-106589665 TGAGCTAGACTTTTTTGTAAGGG - Intergenic
1031059143 7:117029607-117029629 TAAGCAAAATATTTTTACATAGG - Intronic
1031852660 7:126884345-126884367 AAAGATAGAAATGTTTATATGGG + Intronic
1032177131 7:129639913-129639935 TTAGCTAAACAATTTAATATAGG + Intronic
1032227366 7:130043359-130043381 AAAGTTATACATTTTTATAAAGG + Intronic
1033983217 7:147191614-147191636 TATGGAAGACATTTATATATAGG + Intronic
1035786746 8:2267133-2267155 TACGTTAAACATTTTTAAATAGG - Intergenic
1035806061 8:2454583-2454605 TACGTTAAACATTTTTAAATAGG + Intergenic
1035831916 8:2704585-2704607 TAAGCAAAACATTTATATGTTGG + Intergenic
1036015883 8:4783820-4783842 TAAGGAAAACATTCTTATATTGG + Intronic
1037206652 8:16329716-16329738 TATGCTATACATTTATATATAGG - Intronic
1039354391 8:36799273-36799295 TACGCTATACCTTTCTATATTGG - Intronic
1039360883 8:36875605-36875627 GAAACTGGACATTTTTATTTTGG - Intronic
1039662760 8:39484713-39484735 TAGGCTGGACATTATGATATTGG - Intergenic
1041105351 8:54437668-54437690 GAAGTTAGTCATTTTTATTTGGG - Intergenic
1042509435 8:69596154-69596176 AAAGCTAAACTTTTATATATGGG + Intronic
1043009203 8:74860640-74860662 CTAGATAGACATTTTTATGTTGG + Intergenic
1043121007 8:76324186-76324208 GAAGCTAGACAATTTGAGATGGG - Intergenic
1043248720 8:78040594-78040616 TAAGCAAGATAGTTTTATAGTGG - Intergenic
1043324177 8:79029292-79029314 GAATGTAGACATTTTTATACGGG + Intergenic
1043968186 8:86503049-86503071 TAACTTAGTTATTTTTATATAGG - Intronic
1045837239 8:106536673-106536695 TTAGCCAGCCATTTTTAAATAGG + Intronic
1046441844 8:114266058-114266080 TGATGTAGACATTTTTATAAGGG - Intergenic
1046447219 8:114338712-114338734 TAAGCTATCAATTTATATATTGG + Intergenic
1050798008 9:9569652-9569674 TAACATACACATTTTTATAGAGG + Intronic
1051271819 9:15363117-15363139 TAGTCTAGATATTTTGATATTGG - Intergenic
1051840062 9:21385854-21385876 TAAGTGAAATATTTTTATATAGG + Intergenic
1052332282 9:27282041-27282063 TTAGCTATATATTTTTAAATGGG - Intergenic
1052600560 9:30623476-30623498 TAATTTATACATTTTTCTATTGG - Intergenic
1053917238 9:42952625-42952647 TAAGACACACATTTTTATTTTGG + Intergenic
1057223923 9:93276213-93276235 TAATCTAGACAGTATAATATTGG + Intronic
1058244611 9:102607289-102607311 TAAGCTAGATATATATATAGGGG + Intergenic
1058467416 9:105243917-105243939 TAAGCTAAACTTTCTTATACAGG - Intergenic
1059962552 9:119579714-119579736 TAGGCTAGAAATTTTTTTAAAGG + Intergenic
1062703995 9:137924478-137924500 TCAGCTGGACATATTTATGTGGG + Intronic
1186222923 X:7368223-7368245 TAAGGTAGTCATTTTTATGCAGG - Intergenic
1187762193 X:22599773-22599795 TAATCAAGACAGTTTGATATTGG - Intergenic
1187935618 X:24332943-24332965 TATGATAGATATTTTTATCTAGG - Intergenic
1188501545 X:30832491-30832513 TAAGCAACACCTTTTTAAATAGG + Intronic
1189450654 X:41125839-41125861 TAATATATACAGTTTTATATTGG + Intronic
1192686026 X:73305990-73306012 ATAACTAGACATTTTGATATTGG - Intergenic
1194042901 X:88963536-88963558 TAAGCTATACATTTTTTTCAGGG + Intergenic
1197813367 X:130470674-130470696 GAAGCTAGTCATTTTAATTTGGG - Intergenic
1199507217 X:148577614-148577636 TAAGAAAGACAATTTTAAATAGG - Intronic
1200282815 X:154792549-154792571 TAAAATAGACATGTTTATCTAGG + Intronic