ID: 963157855

View in Genome Browser
Species Human (GRCh38)
Location 3:142118199-142118221
Sequence TTCTGAATTTGTAGTGATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 970
Summary {0: 1, 1: 1, 2: 13, 3: 26, 4: 929}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963157855_963157858 30 Left 963157855 3:142118199-142118221 CCATCATCACTACAAATTCAGAA 0: 1
1: 1
2: 13
3: 26
4: 929
Right 963157858 3:142118252-142118274 AGAAGAAGCACTCTCAAATTAGG 0: 1
1: 0
2: 0
3: 22
4: 241
963157855_963157857 6 Left 963157855 3:142118199-142118221 CCATCATCACTACAAATTCAGAA 0: 1
1: 1
2: 13
3: 26
4: 929
Right 963157857 3:142118228-142118250 CTTCACAAAAGAGAGCACACTGG 0: 1
1: 0
2: 0
3: 25
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963157855 Original CRISPR TTCTGAATTTGTAGTGATGA TGG (reversed) Intronic
900007105 1:66860-66882 TCCTGAATTTGTGCTGCTGAGGG - Intergenic
901036833 1:6341310-6341332 TTCTGTATTTTTAGTAAAGACGG + Intronic
901376315 1:8842196-8842218 TTCTGTATTTTTAGTGGAGATGG + Intergenic
902105037 1:14027972-14027994 TTCTGTCTTTGTAGAGATGGTGG + Intergenic
902855598 1:19202020-19202042 TTTTGTATTTTTAGTGGTGACGG - Intronic
903050956 1:20600583-20600605 TTTTTAATTTTTAGTGAAGATGG - Intronic
904126471 1:28243593-28243615 TTTTGTATTTTTAGTGAAGATGG + Intronic
904506427 1:30959337-30959359 TTTTGAATCTGTATTAATGAAGG - Intronic
904739656 1:32663746-32663768 TTCTGTATTTTTAGTAGTGACGG + Intronic
904788075 1:32997482-32997504 TTCTGACCTTGTTGTGATCACGG + Intergenic
905687263 1:39917539-39917561 TTTTGTATTTTTAGTAATGATGG + Intergenic
905755317 1:40504480-40504502 TTCTGTATTTGTAGTAGAGATGG + Intergenic
905777369 1:40677524-40677546 TTTTGTATTTTTAGTGAAGACGG - Intergenic
906300129 1:44675482-44675504 TTTTAATTTTGTAGAGATGAAGG - Intronic
906331255 1:44886837-44886859 TTCTGAATTTGCTGTGATTCTGG + Intronic
906467043 1:46091309-46091331 TTTTGTATTTGTAGTAAAGACGG + Intronic
906619601 1:47265063-47265085 TTTTGTATTTTTAGTGAAGACGG - Intronic
906897108 1:49787328-49787350 TTCTGTATTTTTAGTGGAGACGG - Intronic
907013452 1:50987473-50987495 TTTTGAATTTTTAGTGGAGACGG + Intergenic
908226526 1:62061350-62061372 TTTTGTATTTTTAGTGAAGACGG + Intronic
908786443 1:67739006-67739028 TTTTGTATTTTTAGTCATGATGG - Intronic
909077168 1:71063149-71063171 TTCTGAGGTTGCAGTGATAATGG + Intergenic
909872645 1:80762762-80762784 TTCTTTATTTGTATTGTTGAAGG + Intergenic
909962281 1:81861189-81861211 TTCTGTATTTTTAGTAAAGACGG + Intronic
910092831 1:83485913-83485935 TGCTGAATTTGCAGTGCTTATGG - Intergenic
910369800 1:86503596-86503618 TTCTGGGTTTGTGGTGATGGAGG + Intergenic
910551132 1:88476539-88476561 TTCTGTATTTTTAGTGGAGATGG - Intergenic
911028371 1:93459102-93459124 TTCTGTATTTTTAGTGGAGACGG - Intronic
911138666 1:94472110-94472132 TTTGGAAGTTGTAGTGATTAGGG + Intronic
911573257 1:99543314-99543336 TTCTGTATTTTTAGTAAAGAGGG + Intergenic
911587046 1:99703585-99703607 TTTTGTATTTTTAGTGAAGACGG - Intergenic
911625287 1:100117121-100117143 TTTTGTATTTTTAGTGAAGACGG - Intronic
911639836 1:100276197-100276219 TTCTGAATTTTTTCTGAGGATGG + Intronic
911743572 1:101414457-101414479 TTCTGCATTTATTGAGATGAAGG - Intergenic
912377140 1:109219092-109219114 TTTTGAATTTTTAGTGGAGATGG - Intronic
912602099 1:110946404-110946426 TTCTAAAATTATAGTGTTGATGG + Intergenic
912837586 1:113009936-113009958 TTTTGTATTTGTAGTGGAGAGGG - Intergenic
912911521 1:113764276-113764298 TTATGAATTGGAAGTGATGTTGG - Exonic
913307994 1:117452134-117452156 TTCTGTATTTTTAGTAAAGATGG - Intronic
913355509 1:117916861-117916883 TTTTGTATTTTTAGTGAAGATGG - Intronic
913604204 1:120450054-120450076 TTTTGTATTTTTAGTGAAGATGG - Intergenic
913646391 1:120859550-120859572 CTCTGAATTCTTAGTGTTGAGGG - Intergenic
914233331 1:145785259-145785281 TTCTGAATTTATATTAATGAAGG - Intronic
914461505 1:147889989-147890011 TTCTGGATTTGTGGTGCTGTGGG + Intergenic
914754525 1:150555158-150555180 TTTTGTATTTGTAGTGGAGATGG + Intronic
915010407 1:152679984-152680006 TTCTGAATTAGGTGTGAAGATGG - Intergenic
915171292 1:153979376-153979398 TTCTGTATTTTTAGTGGAGACGG - Intergenic
915385497 1:155488055-155488077 TTTTGAATTTTTAGTAAAGACGG + Intronic
915411876 1:155707239-155707261 TTTTGTATTTTTAGTAATGACGG - Intronic
915606110 1:156952195-156952217 GTCTGATTCTGTAGTGATGAAGG - Intronic
915798290 1:158760891-158760913 TTCTATATTTTTAGTGAAGACGG - Intergenic
916184871 1:162121296-162121318 TTCTGTATTTTTAGTGGAGACGG + Intronic
916303521 1:163302781-163302803 TTCTGAATTTGGTGTGAGGAAGG - Intronic
916774384 1:167945337-167945359 TTCTGAATATCCAGTGATCATGG + Intronic
917024316 1:170625538-170625560 TTTTGTATTTTTAGTAATGATGG - Intergenic
917588735 1:176455428-176455450 TTGTGAGTTTGGAGTGAGGAAGG + Intergenic
918500155 1:185185875-185185897 TTATGAATTTTGAGTGAAGATGG + Intronic
918652286 1:186980118-186980140 TTTTGTGTTTGTAGTGAAGACGG + Intronic
919031369 1:192247370-192247392 TTCTGAAATTATGGTGATGCTGG - Intergenic
919823426 1:201487240-201487262 TTTTGTATTTTTAGTGAAGATGG - Intronic
919965484 1:202519440-202519462 TTCTGTATTTTTAGTAAAGATGG + Intronic
920448790 1:206041202-206041224 TTTTGAATTTGTAGTAGAGACGG + Intronic
921087013 1:211803927-211803949 TTCTGTATTTTTAGTGGAGATGG + Intronic
921179907 1:212624240-212624262 TTTTGAATTTGGGGTGAGGAAGG + Intergenic
921676942 1:217986898-217986920 TTCAGAATTTGTAATCTTGAAGG - Intergenic
922247047 1:223809994-223810016 TTCTGTATTTTTAGTGGAGATGG + Intronic
922383276 1:225055384-225055406 TTCTTTATTTGCAGTGATGGGGG + Intronic
922690606 1:227686385-227686407 TTTTGTATTTTTAGTGAAGATGG + Intergenic
923396802 1:233573597-233573619 TGCAGAAATTGTAGTGATGTGGG - Intergenic
923413384 1:233731550-233731572 TTTTGTATTTTTAGTAATGACGG - Intergenic
924304609 1:242674348-242674370 TTTTGTATTTTTAGTGAAGACGG + Intergenic
924521407 1:244809421-244809443 TTCTGTATTTTTAGTAAAGACGG + Intergenic
924705039 1:246493980-246494002 TTCTAGATGTGAAGTGATGAAGG - Intronic
1063365534 10:5488194-5488216 TTTTGTATTTTTAGTGAAGATGG + Intergenic
1063501690 10:6560865-6560887 TTTTGTATTTTTAGTGAAGATGG - Intronic
1063524227 10:6769510-6769532 TTTTGTATTTTTAGTGAAGACGG - Intergenic
1063625961 10:7690379-7690401 GTCTGAATTTGTAGTGTTGCAGG - Intergenic
1063700593 10:8380850-8380872 TTTTGTATTTGTAGTGGAGACGG - Intergenic
1064082824 10:12322321-12322343 TTTTGTATTTGTAGTAAAGATGG - Intergenic
1064196272 10:13246326-13246348 TTTTGTATTTTTAGTGAAGATGG - Intergenic
1064205767 10:13322314-13322336 TTTTGTATTTTTAGTGAAGATGG + Intronic
1064263559 10:13806026-13806048 TTCTGTATTTTTAGTGGAGACGG + Intronic
1064267388 10:13836166-13836188 TTCTGTATTTGTAGTAGAGACGG + Intronic
1064428282 10:15249264-15249286 TTTTGTATTTTTAGTGAAGATGG + Intronic
1064618454 10:17189281-17189303 TTTTGAATTTACAGTCATGAAGG + Intronic
1064730986 10:18330837-18330859 TTTTGTATTTTTAGTGGTGATGG + Intronic
1065534649 10:26705642-26705664 TTTTGTATTTTTAGTGAAGACGG + Intronic
1066366659 10:34783430-34783452 TTTTGTATTTTTAGTGAAGACGG - Intronic
1066574012 10:36805806-36805828 TTTTGAATTTTTAGTAAAGATGG + Intergenic
1066637188 10:37515835-37515857 TTTTGTATTTTTAGTGAAGACGG - Intergenic
1066976309 10:42371055-42371077 TTTTGTATTTTTAGTGAAGAAGG - Intergenic
1067003950 10:42643604-42643626 TTCTGTATTTGTAGTAGAGATGG + Intergenic
1067117635 10:43447410-43447432 TTCTGTATTTTTAGTAAAGACGG + Intronic
1067384953 10:45810512-45810534 TTCTGTATTTTTAGTGGAGACGG + Intergenic
1067399558 10:45958474-45958496 TTCTAAATTTGTAGCTATGTTGG - Intergenic
1067674222 10:48356669-48356691 TTTTGTATTTTTAGTGAAGACGG - Intronic
1067867889 10:49927782-49927804 TTCTAAATTTGTAGCTATGTTGG - Intronic
1068372398 10:56134173-56134195 TTTTGTATTTTTAGTGGTGACGG + Intergenic
1068646836 10:59477382-59477404 TCCTTAATTTGTAATTATGAGGG + Intergenic
1069044495 10:63728322-63728344 TTGAGAATTTGTAATCATGAAGG - Intergenic
1069521661 10:69126289-69126311 TTTTGTATTTTTAGTGAAGACGG - Intronic
1069596393 10:69674431-69674453 TTTTGAATTTTTAGTGGAGATGG + Intergenic
1069850035 10:71398272-71398294 TTCTGAATTACTAGGGAGGATGG - Intronic
1070615419 10:77966146-77966168 TTTTGTATTTTTAGTGAAGACGG - Intergenic
1070732144 10:78837649-78837671 TTTTAAATTTTTACTGATGATGG - Intergenic
1071539836 10:86470843-86470865 TGCTAAATTTGTAGTGCTTATGG - Intronic
1071716194 10:88098165-88098187 TTCTGAATTAGTAGATATGTTGG + Intergenic
1071812473 10:89198536-89198558 TTCTGTATTTTTAGTAAAGATGG - Intergenic
1071913215 10:90259241-90259263 TTCTGGATTTGTAAAGATAAAGG + Intergenic
1072330357 10:94342912-94342934 TTCTGTATTTTTAGTAAAGATGG - Intronic
1072664324 10:97382930-97382952 TTTTGTATTTTTAGTGAAGATGG + Intronic
1072982879 10:100114531-100114553 TGCTGAATTTGTAGAGATAATGG - Intergenic
1073172187 10:101519823-101519845 TTCTGTATTTTTAGTAAAGACGG - Intronic
1073711317 10:106046025-106046047 TTCTGTATTTTTAGTAGTGATGG + Intergenic
1073895551 10:108152254-108152276 TTTTGTATTTTTAGTAATGATGG - Intergenic
1074052121 10:109889371-109889393 TTCTGTATTTTTAGTAAAGACGG + Intronic
1074288174 10:112118177-112118199 TTTTGTATTTTTAGTGAAGATGG - Intergenic
1074495357 10:113975585-113975607 TTCTGTATTTTTAGTAAAGATGG + Intergenic
1074733793 10:116406659-116406681 TTCTGGAGATGTAGTGGTGATGG - Intergenic
1074810263 10:117097903-117097925 ATCTGAATCTGTTGGGATGATGG - Intronic
1074822285 10:117189513-117189535 TTTTGAATTTTTAGTGGAGATGG - Intergenic
1074838319 10:117322583-117322605 TTCAGAATTTGCAGTTATGTTGG + Intronic
1075187010 10:120271494-120271516 TGCTGGATTTGTAGGAATGATGG + Intergenic
1075873047 10:125784857-125784879 TTCTGAATTTTTAGTAGAGATGG + Intergenic
1075953893 10:126505782-126505804 TTCTGTATTTTTAGTGGAGACGG - Intronic
1076519362 10:131071119-131071141 TTCTCAATGGGGAGTGATGAGGG + Intergenic
1076574065 10:131452176-131452198 TTCTGAATTTATGGTGGTGGGGG - Intergenic
1076762869 10:132614293-132614315 TTTTGTATTTGTAGTAAAGACGG - Intronic
1077572264 11:3349788-3349810 TTCTGTATTTTTAGTAAAGATGG + Intronic
1078278941 11:9879911-9879933 TTTTGTATTTTTAGTGAAGACGG - Intronic
1079194581 11:18314356-18314378 TTTTGAATTTTTAGTGGAGACGG - Intronic
1079221983 11:18571173-18571195 TTTTGAATTTTTAGTGGAGATGG - Intronic
1079231842 11:18655850-18655872 TTTTGGATTTTTAGTGAAGATGG - Intergenic
1079546549 11:21639934-21639956 TTCTAAATTGATTGTGATGATGG + Intergenic
1079571277 11:21946290-21946312 TTTTGTATTTGTAGTAGTGACGG + Intergenic
1079724392 11:23862719-23862741 TTATGCATTTGTAATTATGATGG - Intergenic
1080121884 11:28687199-28687221 TTCTGTATTTTTAGTGGAGATGG + Intergenic
1080631365 11:34080093-34080115 TTTTGAATTTTTAGTAAAGACGG + Intronic
1081034790 11:38130019-38130041 TACAGAATTTATAGTGATCAAGG - Intergenic
1081257028 11:40910534-40910556 TTCTGAATTTTTAATGAATATGG - Intronic
1081285427 11:41263280-41263302 ATGTGATTTTATAGTGATGAGGG - Intronic
1081640252 11:44748235-44748257 TTCTGTATTTTTAGTAAAGATGG - Intronic
1081890124 11:46534320-46534342 TTCTGTATTTTTAGTAAAGACGG - Intronic
1081896596 11:46592585-46592607 TTTTGTATTTGTAGTAAAGACGG - Intronic
1082022885 11:47549985-47550007 TTCTGTATTTTTAGTGGAGATGG + Intronic
1082061720 11:47866787-47866809 TTCTGTATTTGTAGTAGAGACGG - Intergenic
1082079778 11:48003664-48003686 TTTTGTATTTGTAGTAAAGATGG + Intronic
1082152620 11:48761471-48761493 TTCTGAATTCAAAGTGATTACGG + Intergenic
1082601740 11:55167046-55167068 TTCTGAATTCAAAGTGATTATGG + Intergenic
1083043852 11:59714270-59714292 TTTTGAATTTTTAGTAAAGATGG + Intronic
1083453871 11:62765027-62765049 TTTTGTATTTTTAGTAATGACGG + Intronic
1083455597 11:62776678-62776700 TTCTGTATTTTTAGTAAAGAAGG - Intronic
1083456173 11:62780146-62780168 TTTTGTATTTTTAGTGAAGATGG - Intronic
1083883967 11:65561905-65561927 TTTTGTATTTTTAGTGAAGATGG + Intergenic
1084074566 11:66763030-66763052 TTCTTTATTTGTAGAGATGGGGG - Intronic
1084201129 11:67559207-67559229 TTTTGAATTTTTAGTGGAGACGG + Intergenic
1085214080 11:74812476-74812498 TTTTTATTTTGTAGAGATGAGGG + Intronic
1085404912 11:76256046-76256068 TTTTGTATTTGTAGTAAAGACGG - Intergenic
1085940942 11:81206159-81206181 TTTTGTATTTTTAGTGAAGATGG - Intergenic
1086333601 11:85777987-85778009 TTTTGTATTTTTAGTGAAGATGG + Intronic
1086396146 11:86417071-86417093 TTTTGTATTTTTAGTAATGACGG - Intronic
1086466033 11:87054262-87054284 TTTTGTATTTTTAGTGAAGATGG - Intronic
1087408916 11:97765971-97765993 TTCTGTATTTTTAGTAAAGACGG + Intergenic
1087778766 11:102281658-102281680 TTCTGTATTTTTAGTGGAGACGG - Intergenic
1088133421 11:106524082-106524104 TTCTGAGTCAGTAGTAATGAGGG + Intergenic
1088201147 11:107336315-107336337 TTTTGTATTTTTAGTGAAGATGG + Intronic
1088427849 11:109724390-109724412 TTCTGAATTTTGAATTATGATGG + Intergenic
1088769778 11:113022385-113022407 TTCTGAAATTGCATAGATGATGG + Intronic
1089249458 11:117147096-117147118 TTTTGTATTTTTAGTGAAGACGG - Intronic
1089293910 11:117456843-117456865 TTTTGTATTTTTAGTAATGACGG + Intronic
1089453970 11:118615022-118615044 TTTTGTATTTGTAGTGGAGATGG - Intronic
1089902950 11:122007316-122007338 TTCTGAGTATGAAGTGGTGAAGG + Intergenic
1091241939 11:134058854-134058876 TTCTGTATTTTTAGTGGAGACGG + Intergenic
1092180914 12:6446124-6446146 TTCTGAAATTGTAGCGAAGATGG - Intronic
1092758162 12:11784257-11784279 TTTTGTATTTTTAGTGAAGACGG - Intronic
1092823566 12:12375973-12375995 TTCTGTATTTTTAGTGGAGATGG + Intronic
1092876434 12:12852426-12852448 TCCTGTGTTTGTAGTGATGCTGG + Intergenic
1092888050 12:12942562-12942584 TTTTGTATTTTTAGTGAAGACGG - Intronic
1093240589 12:16666452-16666474 TTTTGAATTTTTAGTAAAGATGG - Intergenic
1093827647 12:23713919-23713941 TTTTGAATTTTTAGTAAAGAAGG - Intronic
1094225351 12:28039441-28039463 TTCTGAATTTTTAGTAGAGACGG - Intergenic
1094774334 12:33706311-33706333 TTCTGAGTAGGTACTGATGAAGG - Intergenic
1095181253 12:39148966-39148988 TTTTGTATTTTTAGTGAAGATGG + Intergenic
1095434913 12:42176789-42176811 TTTTGTATTTTTAGTGGTGACGG - Intronic
1096675991 12:53226295-53226317 TTTTGTATTTTTAGTAATGATGG + Intronic
1096828498 12:54297182-54297204 TTCTGCATTTTTAGTGGAGATGG - Intronic
1097599023 12:61669277-61669299 TTCTGAACTTCAAGTGGTGAGGG - Intergenic
1097952350 12:65445814-65445836 TTCTGTATTTTTAGTAAAGATGG + Intronic
1098018613 12:66132402-66132424 TGCTGAATTTGCAAAGATGAAGG + Intronic
1098221732 12:68277054-68277076 TTTTGTATTTTTAGTAATGACGG - Intronic
1099096667 12:78382827-78382849 TTCTGAATTTTTATTGTTAAGGG + Intergenic
1099849444 12:88074052-88074074 TTTTGAATTTTTAGTAAAGATGG - Intronic
1100102872 12:91130619-91130641 TCCTTAATTTGGAGTGATGGTGG - Intergenic
1100178121 12:92053671-92053693 TGCTGAGTTTGAAGTGATTATGG - Intronic
1100479065 12:94960469-94960491 TTTTGAATTTTTAGTAAAGACGG + Intronic
1100631475 12:96393906-96393928 GTCTAAATTTGGAGTGATAAGGG + Intronic
1100643629 12:96506398-96506420 TTCTGAATTTCTTGTGACTAAGG + Intronic
1100821912 12:98439587-98439609 GCCAGAATTTGTAGTGGTGAGGG - Intergenic
1100851156 12:98712988-98713010 TTCTGTTTTTGTAGAGATGGAGG + Intronic
1100882807 12:99037342-99037364 TTCTGTATTTTTAGTCAAGATGG - Intronic
1101010521 12:100444655-100444677 TTTTGTATTTTTAGTGTTGACGG + Intergenic
1101236700 12:102796943-102796965 TTCTGAATCTCCAGTGCTGAGGG + Intergenic
1102104860 12:110312677-110312699 TTTTGTATTTTTAGTGAAGATGG - Intronic
1102109257 12:110351957-110351979 TTTTGAATTTTTAGTGGAGACGG - Intergenic
1102146822 12:110660653-110660675 TTCTGGAATTATAGTGGTGATGG - Intronic
1102277669 12:111596025-111596047 TTTTGTATTTTTAGTGAGGACGG - Intronic
1103112400 12:118291983-118292005 TTTTGTATTTTTAGTGAAGACGG + Intronic
1103603818 12:122071961-122071983 TTCTGTATTTTTAGTGGAGACGG - Intergenic
1103630538 12:122256401-122256423 TTTTGTATTTGTAGTGGAGATGG - Intronic
1104117127 12:125760413-125760435 TTTTGTATTTGTAGTAAAGACGG - Intergenic
1104453782 12:128893072-128893094 TTTTGTATTTTTAGTGAAGACGG - Intronic
1104453838 12:128893754-128893776 TTTTGTATTTTTAGTGAAGATGG + Intronic
1105010433 12:132752539-132752561 TTCTGTATTTTTAGTAAAGACGG + Intronic
1105058788 12:133129329-133129351 TTCTGTATTTTTAGTGGAGATGG - Intronic
1106313271 13:28572265-28572287 TTTTGTATTTTTAGTAATGACGG - Intergenic
1106381827 13:29246633-29246655 TTCTGAATGTGTATAGCTGAGGG + Intronic
1106557521 13:30822929-30822951 GTCTGAATATGTGGTGAGGAAGG - Intergenic
1106608039 13:31250342-31250364 TTTTGAATTTTTAGTAAAGATGG + Intronic
1106789009 13:33135949-33135971 TTCTGTATTTTTAGTAGTGATGG - Intronic
1107210017 13:37842097-37842119 TTTTGTATTTTTAGTGGTGATGG - Intronic
1107480916 13:40785694-40785716 TTTTGAATTTTTAGTGGAGACGG + Intergenic
1107728819 13:43327569-43327591 TTCTAAATTTTTAGTTAAGAAGG + Intronic
1107789823 13:43990390-43990412 TTCTGAACATTTTGTGATGACGG + Intergenic
1108122195 13:47201360-47201382 TTTTGTATTTTTAGTGAAGATGG + Intergenic
1109830779 13:67784574-67784596 TTCTGTATTTTTAGTGGAGATGG - Intergenic
1110256489 13:73439283-73439305 TTCTGAGTTTTTAATCATGATGG - Intergenic
1110693470 13:78459466-78459488 TTCTGAATTCAAAGTGATTACGG + Intergenic
1110944705 13:81397616-81397638 TTCTGTATTTTTAGTAAAGATGG - Intergenic
1111024675 13:82503842-82503864 TTATGAATTTGTAATTATTATGG + Intergenic
1111760103 13:92452737-92452759 TTTTGTATTTTTAGTGGTGACGG + Intronic
1111885320 13:94013518-94013540 TTTTGTATTTGTAGTGGAGACGG + Intronic
1111947423 13:94680434-94680456 TTTTGTATTTCTAGTGAAGACGG - Intergenic
1112531681 13:100210148-100210170 TTTTTATTTTGTAGAGATGAGGG + Intronic
1112731736 13:102370355-102370377 TTTTAAATTTTTAGTGATTATGG + Intronic
1112867114 13:103917941-103917963 TTCAGAGTTTGTACTAATGAGGG - Intergenic
1113837851 13:113340607-113340629 TTTTGTATTTGTAGTAAGGACGG - Intronic
1114448333 14:22807069-22807091 TTCTGTATTTTTAGTAAAGACGG + Intronic
1114506692 14:23220651-23220673 TTCTGTATTTTTAGTAAAGATGG - Intronic
1115160914 14:30392827-30392849 TTCTGAATTTTTAGTAGAGACGG + Intergenic
1115582759 14:34777818-34777840 TTTTGTATTTTTAGTAATGATGG - Intronic
1115669046 14:35588075-35588097 TTTTGAATTTTTAGTAAAGACGG + Intronic
1115783706 14:36800643-36800665 TTCTGAAGATGCAGTGTTGATGG + Intronic
1116149806 14:41126602-41126624 TTCTGTATTTTTAGTAAAGAAGG + Intergenic
1116811655 14:49545403-49545425 TTTTGTATTTTTAGTGGTGATGG - Intergenic
1116837799 14:49788106-49788128 TTTTGTATTTTTAGTGGTGATGG - Intronic
1117731781 14:58729852-58729874 TTTTGTATTTTTAGTGAAGACGG - Intergenic
1117732031 14:58732740-58732762 TTCTGAATTTTTAGTTGTTATGG - Intergenic
1118028153 14:61791676-61791698 TTCTGTATTTGTAGTAGAGATGG - Intronic
1118264910 14:64285655-64285677 TTTTGTATTTTTAGTGAAGATGG - Intronic
1118552170 14:66965246-66965268 TTCTGAAGGAGTAGTGCTGAGGG - Exonic
1118634495 14:67735250-67735272 TTCTGAAGGAGTAGTGCTGAGGG - Intronic
1119073331 14:71609635-71609657 TTTTGAATTTTTAGTGGAGAAGG + Intronic
1119686557 14:76637286-76637308 TTTTGTATTTTTAGTGGTGACGG - Intergenic
1119691733 14:76678303-76678325 TTTTGTATTTTTAGTGGTGATGG - Intergenic
1119847066 14:77838566-77838588 TTTTGTATTTGTAGTAAAGATGG + Intronic
1120416059 14:84219746-84219768 TTTTGTATTTTTAGTGAAGATGG + Intergenic
1120472908 14:84949400-84949422 TTCTGTATTTTTAGTAAAGATGG + Intergenic
1120752658 14:88212268-88212290 TTCTGTATTTTTAGTAGTGATGG - Intronic
1121248183 14:92479260-92479282 TTCTGATTTTGCAGTGAGGTGGG + Intronic
1121506754 14:94483554-94483576 TTCTGTATTTTTAGTAAAGACGG + Intergenic
1121650585 14:95554956-95554978 TTTTGTATTTTTAGTGAAGATGG - Intergenic
1121805048 14:96811099-96811121 TTTTGAATTTTTAGTGGAGATGG + Intronic
1121883036 14:97517312-97517334 TTCTTAATTTGTAAAGAAGAGGG - Intergenic
1122241553 14:100371562-100371584 TTTTGTATTTTTAGTGAAGATGG - Intronic
1124403004 15:29366626-29366648 TTCTGAAATTCTAGTGATGGAGG - Intronic
1125303887 15:38288343-38288365 TTCGGAGTTTGTAGTGAGCAAGG + Intronic
1125308544 15:38351272-38351294 TTCTTAATTTTTAATGAGGAAGG - Exonic
1125431482 15:39599093-39599115 TTCTGTATTTTTAGTAAAGACGG + Exonic
1126149157 15:45506917-45506939 TCTGGAATTAGTAGTGATGATGG - Intronic
1126838001 15:52687231-52687253 TTTTGTATTTGTAGTGGAGATGG - Intronic
1127272606 15:57414886-57414908 TTCCGAAGTTGTAGTGGTTAAGG + Intronic
1127506862 15:59606287-59606309 TTTTGAATTTTTAGTGGAGACGG - Intronic
1127549516 15:60023184-60023206 TTTTGTATTTTTAGTAATGACGG - Intronic
1127776039 15:62265009-62265031 TTTTGTATTTTTAGTGGTGACGG - Intergenic
1127963879 15:63909629-63909651 TTATGTATTTTTAGTGGTGATGG - Intronic
1128106331 15:65048006-65048028 TTTTGTATTTTTAGTAATGATGG - Intronic
1128404671 15:67323412-67323434 TTTTGTATTTTTAGTGAAGACGG + Intronic
1128505402 15:68267368-68267390 TTCTGTATTTGTAGTAGAGATGG + Intergenic
1128903145 15:71443495-71443517 TTCTGAATTTAGAGTAAGGAGGG + Intronic
1129349635 15:74947806-74947828 TTTTGTATTTTTAGTAATGATGG + Intergenic
1129406210 15:75320258-75320280 TTCTGAATTTTTAGTAGAGATGG - Intergenic
1129575552 15:76739992-76740014 TTTTAAATTTGTAGAGATGGAGG - Intronic
1130221743 15:82025304-82025326 TTCTGACTTTGTAGTAATTGTGG - Intergenic
1130525422 15:84701894-84701916 TTGTGTATTTTTAGTGAAGATGG - Intronic
1131374077 15:91909219-91909241 TGCTGAATTTATAGAGATCAGGG + Intronic
1131462365 15:92626878-92626900 TTTTGTATTTTTAGTGGTGACGG - Intronic
1132103029 15:99040802-99040824 TTTTGTATTTTTAGTGAAGATGG - Intergenic
1132446419 15:101924832-101924854 TCCTGAATTTGTGCTGCTGAGGG + Intergenic
1132910146 16:2305746-2305768 TTTTAATTTTGTAGTGATGGGGG + Intronic
1133478965 16:6151003-6151025 TTCTGAATCTGTAAGGAAGAAGG - Intronic
1133553508 16:6882422-6882444 TTTTGTATTTTTAGTGAAGATGG - Intronic
1133614236 16:7461336-7461358 TTTTGTATTTTTAGTGAAGATGG + Intronic
1133941322 16:10311541-10311563 TTTTGTATTTTTAGTGAAGATGG - Intergenic
1133942834 16:10324702-10324724 TTCTGTATTTTTAGTGGAGATGG - Intergenic
1134276131 16:12778078-12778100 TTCTGTATTTTTAGTAGTGATGG + Intronic
1135029869 16:19029883-19029905 TTTTGTATTTTTAGTGAAGACGG + Intronic
1135031666 16:19043740-19043762 TTTTGTATTTGTAGTGGAGACGG + Intronic
1135450335 16:22551884-22551906 TTCTGTATTTTTAGTGGAGATGG + Intergenic
1135712293 16:24728275-24728297 TTTTGTATTTTTAGTAATGACGG - Intergenic
1135771860 16:25223995-25224017 TTTTGTATTTGTAGTGGAGATGG + Intronic
1136146293 16:28318481-28318503 TTGTGAATGTGCAGTGCTGAAGG + Intronic
1136423433 16:30152208-30152230 TTTTGTATTTGTAGTAAAGACGG + Intergenic
1136503196 16:30684943-30684965 TTTTGTATTTTTAGTGAAGACGG - Intergenic
1137700323 16:50493266-50493288 TTTTGAATTTTTAGTAAAGACGG + Intergenic
1137714091 16:50587226-50587248 TTCTGATTTTGTAGGGTAGATGG + Intronic
1138009841 16:53368127-53368149 TTTTAAATTTGTAGTGGAGACGG + Intergenic
1138059645 16:53876754-53876776 TTTTGAATTTTTAGTAAAGACGG - Intronic
1138313633 16:56049660-56049682 TTTTGTATTTTTAGTGAAGATGG - Intergenic
1138587456 16:57979895-57979917 TTTTGTATTTTTAGTGAAGATGG - Intronic
1138704263 16:58898316-58898338 TTCTGAATTTTTAGTGGAGATGG + Intergenic
1139158468 16:64474095-64474117 TACTGAAATTCTAGTGAGGAAGG + Intergenic
1139207912 16:65046935-65046957 TTCTGTATTTTTAGTAAAGATGG - Intronic
1139500459 16:67359950-67359972 TTTTGTATTTTTAGTGAAGATGG - Intronic
1139538735 16:67597507-67597529 TTCTGTATTTTTAGTGGAGACGG + Intronic
1139951612 16:70674940-70674962 TTTTGCATTTTTAGTGGTGATGG - Intronic
1140191351 16:72819810-72819832 TTCTGAATTTCTGGTTTTGAAGG - Intronic
1140641311 16:76976679-76976701 TTCTGTATTTTTAGTAAAGATGG - Intergenic
1141013370 16:80424330-80424352 TTTTGTATTTTTAGTGAAGATGG + Intergenic
1141045145 16:80709209-80709231 TTTTGTATTTGTAGTGGAGACGG - Intronic
1141180190 16:81747362-81747384 TTCTGTATTTTTAGTAAAGATGG - Intronic
1141250453 16:82352036-82352058 TTCTGTATTTTTAGTGGAGATGG + Intergenic
1141352328 16:83309545-83309567 TTTTGTATTTTTAGTGAAGATGG + Intronic
1141440445 16:84026395-84026417 TTTTGTATTTTTAGTGAAGATGG + Intronic
1141487553 16:84350938-84350960 TTCTGTATTTTTAGTAAAGATGG - Intergenic
1141650451 16:85390105-85390127 TTATTTATTTGTAGTTATGATGG + Intergenic
1143062184 17:4211231-4211253 TTTTGTATTTGTAGTAAAGACGG - Intronic
1143220565 17:5257907-5257929 TTCTGTATTTTTAGTGGAGACGG - Intergenic
1143262160 17:5607489-5607511 TTTTGTATTTTTAGTGAAGATGG + Intronic
1143831241 17:9653415-9653437 TTTTGAATTTTTAGTAAAGATGG - Intronic
1143947746 17:10608991-10609013 TTTTGTATTTTTAGTGAAGATGG - Intergenic
1144249039 17:13397066-13397088 TTTTGTATTTGTAGTAAAGATGG + Intergenic
1144886361 17:18465393-18465415 TTTTGAATTTTTAGTGGAGATGG + Intergenic
1145145845 17:20478918-20478940 TTTTGAATTTTTAGTGGAGATGG - Intergenic
1145184106 17:20779597-20779619 TTTTGCATTTTTAGTAATGACGG - Intergenic
1145740014 17:27265937-27265959 TTTTGTATTTGTAGTAAAGATGG + Intergenic
1145741774 17:27280843-27280865 TTCTGGATTTGCAGCGATGAGGG - Intergenic
1146009507 17:29181880-29181902 TTTTGTATTTGTAGTAGTGATGG - Intergenic
1146115083 17:30128928-30128950 TTTTTAATTTGTAGAGATGGGGG + Intronic
1146227760 17:31081805-31081827 TTCTGTATTTTTAGTAAAGAAGG + Intergenic
1146441751 17:32902666-32902688 TTTTGAATTTTTAGTAAAGATGG - Intergenic
1146467117 17:33095149-33095171 TACTGAATTCATGGTGATGATGG - Intronic
1147451222 17:40505867-40505889 TCCTGAATCAGTTGTGATGATGG + Intergenic
1147954668 17:44125720-44125742 TTTTGAATTTTTAGTAAAGACGG - Intergenic
1148032985 17:44635109-44635131 TTTTGAATTTTTAGTAGTGACGG + Intergenic
1148390748 17:47270672-47270694 TTCTGAAGTTGTAGTCAAGTCGG + Intronic
1148530954 17:48390902-48390924 TTTTGTATTTTTAGTGAAGACGG - Intronic
1148667475 17:49385515-49385537 TTCGTAATTTGTAGTTATCAAGG - Intronic
1148812049 17:50299554-50299576 TTTTTATTTTGTAGAGATGAGGG + Intergenic
1148929041 17:51113181-51113203 TTTTGTATTTGTAGTAAAGATGG - Intronic
1149757761 17:59201798-59201820 TTCTGTATTTTTAGTGGGGAAGG - Exonic
1150076916 17:62200424-62200446 TTTTGTATTTTTAGTGAAGACGG - Intergenic
1150426595 17:65082139-65082161 TTTTTAATTTTTAGAGATGAGGG - Intergenic
1150747669 17:67828696-67828718 TTTTGTATTTTTAGTAATGACGG + Intronic
1151059119 17:71070548-71070570 TCATGTATTTGTAGTGATGCTGG - Intergenic
1151282391 17:73086647-73086669 TTTTGTATTTGTAGTGGAGATGG - Intronic
1151332382 17:73418176-73418198 TTTTGTATTTTTAGTGAAGATGG + Intronic
1151367670 17:73627875-73627897 TTTTGTATTTGTAGTGGAGACGG - Intronic
1151507032 17:74535294-74535316 TTTTGTATTTTTAGTGAAGACGG - Intergenic
1151617340 17:75222213-75222235 TTTTGTATTTGTAGTGGAGACGG + Intronic
1151621571 17:75248614-75248636 TTCTGTATTTTTAGTAGTGATGG - Intronic
1151640763 17:75391634-75391656 TTTTGAATTTTTAGTGGAGATGG - Intronic
1151931229 17:77232972-77232994 TTCTGTATTTTTAGTAAAGATGG - Intergenic
1152259033 17:79256745-79256767 TTTTGAATTTTTAGTGGAGATGG - Intronic
1153039443 18:798011-798033 TGCAGAATTTGTAGTAGTGAGGG - Intronic
1153203083 18:2666338-2666360 TTGTTAATTTGTTGGGATGAGGG + Intronic
1153555031 18:6303289-6303311 TTTTGTATTTTTAGTAATGATGG + Intronic
1154215989 18:12416486-12416508 TTCTGTTTTTGTAGAGATGAGGG + Intronic
1154238889 18:12633404-12633426 TTTTGTATTTTTAGTGAAGACGG - Intronic
1155285623 18:24285984-24286006 TTTTGTATTTGTAGTGGAGATGG - Intronic
1155550645 18:26961598-26961620 TTTTTAATGTGTAGAGATGAAGG + Intronic
1155668516 18:28340632-28340654 TTCAGAATTCGTAGTTTTGATGG + Intergenic
1155844131 18:30684377-30684399 AACTGAATTTCTGGTGATGATGG + Intergenic
1156117708 18:33806257-33806279 TTTTGTATTTTTAGTAATGATGG + Intergenic
1156151038 18:34243243-34243265 TTTTGTATTTTTAGTGAAGATGG + Intergenic
1156835040 18:41542591-41542613 TTTTTACTTTGTAGAGATGAGGG - Intergenic
1157210038 18:45734514-45734536 CTCTGAATGTATAGTGGTGATGG + Intronic
1157549312 18:48570370-48570392 TTCTTAATAAGTACTGATGATGG - Intronic
1158096084 18:53773012-53773034 TTCTAAATTGGTTGTGGTGATGG - Intergenic
1158253950 18:55524615-55524637 TTTTTATTTTGTAATGATGAAGG - Intronic
1159203387 18:65218529-65218551 TACTGAATGTGTATGGATGATGG + Intergenic
1159252306 18:65895527-65895549 TTCTGTATTTTTAGTGGAGATGG - Intergenic
1159420891 18:68218140-68218162 TTTTGAATTTTTAGTGGAGACGG - Intergenic
1160526463 18:79541381-79541403 TTCTGACTTTCTAGTGAGAAGGG + Intergenic
1160638859 19:108448-108470 TCCTGAATTTGTGCTGCTGAGGG - Intronic
1160655147 19:262709-262731 TTTTGTATTTTTAGTAATGATGG + Intergenic
1161312329 19:3601754-3601776 TTTTGTATTTTTAGTGAAGATGG - Intronic
1161499584 19:4606602-4606624 TTCTGAATTTTTAGTAGAGACGG - Intergenic
1161845402 19:6709275-6709297 TTTTGTATTTTTAGTGAAGACGG - Intronic
1162196602 19:8989665-8989687 TTTTGTATTTGTAGTGAAGACGG - Intergenic
1162212793 19:9106245-9106267 TTTTGTATTTGTAGTAAAGACGG - Intergenic
1162256760 19:9496763-9496785 TTTTGTATTTGTAGTGGAGATGG - Intronic
1162585931 19:11558568-11558590 TTGTAATTTTGTAGAGATGAAGG - Intronic
1162700211 19:12509371-12509393 TTCTGTATTTTTAGTAAAGACGG + Intronic
1162817616 19:13205883-13205905 TTTTGTATTTGTAGTAAAGACGG + Intergenic
1162894285 19:13755783-13755805 TTTTGTATTTGTAGTAAAGACGG - Intronic
1163071868 19:14849626-14849648 TTTTGTATTTTTAGTGAAGATGG + Intergenic
1163334865 19:16664243-16664265 TTTTGCATTTGTAGTGGAGACGG - Intronic
1163604771 19:18267966-18267988 TTCTGTATTTTTAGTAAAGACGG + Intronic
1163744804 19:19039474-19039496 TTCTTGAATTATAGTGATGATGG - Intronic
1163780517 19:19244880-19244902 TTTTGTATTTTTAGTGGTGATGG + Intronic
1163816792 19:19471083-19471105 TTCTGTATTTTTAGTGGAGACGG - Intronic
1163869151 19:19803650-19803672 CTCTGAATTTGTAGTGAAGAGGG - Intronic
1163873560 19:19846240-19846262 CTCTGAATTGGTAGTGGAGAGGG - Intergenic
1163877212 19:19882354-19882376 CTGTGAATTTTTAGTGAAGAGGG + Intronic
1163882249 19:19935347-19935369 CTCTGAATTTGTAGTGATGAGGG - Exonic
1163901640 19:20106820-20106842 CTCTGAATTGATAGTGAAGAGGG + Intronic
1163903511 19:20129610-20129632 CTCTGAATTTGTAGTGAAGAGGG - Intergenic
1163905062 19:20145025-20145047 TTTTGTATTTTTAGTGAAGACGG + Intergenic
1163910598 19:20187872-20187894 CTCTGAATTTGTAGTGGAGAGGG + Intronic
1163911999 19:20203876-20203898 CTCTGAATTTGTAGTGAAGAGGG - Intergenic
1163917311 19:20252462-20252484 CTCTGAATTTGTAGTGAAGAGGG + Intergenic
1163925095 19:20333427-20333449 CTCTGAATTTGTAGTGAAGAGGG + Intergenic
1163931087 19:20392841-20392863 CTCTGAATTTGTAGTGAAGAGGG + Intergenic
1163932310 19:20407750-20407772 CTCTGAATTTGTAGTGAAGAGGG - Intergenic
1163936755 19:20453357-20453379 ATCTGAATTTGTAGTGAAGAGGG + Intergenic
1163941404 19:20498372-20498394 CTCTGAATTTGTAGTGAAGAAGG + Intergenic
1163956296 19:20644471-20644493 CTCTGAATTTGTAGTGAAGAGGG - Intronic
1163959915 19:20679945-20679967 CTCTGAATTTGTAGTGAAGAGGG + Intronic
1163974518 19:20837247-20837269 CTCTGAATTTGTAGTGAAGAGGG - Intronic
1164001230 19:21101311-21101333 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164003544 19:21129263-21129285 TTCTTAATTTGTACTGTTGTGGG - Intergenic
1164007994 19:21169514-21169536 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164212030 19:23107231-23107253 TTTTGTATTTTTAGTAATGATGG + Intronic
1164239620 19:23373072-23373094 ATCTGGGTTTGTAGTGAAGAAGG - Intronic
1164253284 19:23503658-23503680 CTCTGGGTTTGTAGTGAAGAGGG - Intergenic
1164297140 19:23922048-23922070 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164317628 19:24107842-24107864 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164552556 19:29223805-29223827 TTTTGTATTTTTAGTAATGACGG + Intergenic
1165162707 19:33827193-33827215 TTCTGTATTTTTAGTAAAGATGG + Intergenic
1165391377 19:35540955-35540977 TTTTGTATTTTTAGTGGTGACGG - Intronic
1165717709 19:38057098-38057120 TTTTGTATTTGTAGTAAAGACGG - Intronic
1166013494 19:39961476-39961498 TTCTGAATTTTTAGTAGAGATGG + Intergenic
1166591936 19:44007401-44007423 AACTGTATTTGTATTGATGATGG + Intronic
1166600301 19:44088081-44088103 TTTTGTATTTTTAGTGAAGATGG + Exonic
1167047914 19:47061991-47062013 TTCTGTATTTTTAGTAAAGATGG + Intergenic
1167088597 19:47327862-47327884 TTCTGTATTTTTAGTGGAGACGG + Intergenic
1167205719 19:48100344-48100366 TTCTGTATTTTTAGTGGAGACGG - Intronic
1167280707 19:48566525-48566547 TTTTGTATTTTTAGTAATGATGG - Intronic
1167551656 19:50165456-50165478 TTCTGAATTTTTAGTAGAGATGG + Intergenic
1167910223 19:52695813-52695835 TTCTGTATTTTTAGTAAAGATGG + Intergenic
1167918015 19:52757954-52757976 TTCTGTATTTTTAGTAAAGATGG + Intergenic
1168040582 19:53755529-53755551 TTTTGTATTTTTAGTGAAGACGG + Intergenic
1168341961 19:55629618-55629640 TTTTGTATTTGTAGTGGAGACGG - Intergenic
925311321 2:2885536-2885558 TTCTGTATTTTTAGTAAAGACGG - Intergenic
925707361 2:6699228-6699250 TTTTGTATTTGTAGTAAAGATGG - Intergenic
925990775 2:9252408-9252430 TTCTGTATTTTTAGTAAAGATGG - Intronic
926445831 2:12941983-12942005 TTCTGTATTTTTAGTGGAGATGG - Intergenic
926597185 2:14803818-14803840 TTTTGTATTTTTAGTGGTGATGG + Intergenic
927553903 2:24019550-24019572 TTTTGTATTTTTAGTAATGATGG - Intronic
928019061 2:27686801-27686823 TAGTAAATTTGCAGTGATGAGGG + Intronic
928045619 2:27928318-27928340 TTTTGAATTTTTAGTAAAGATGG + Intronic
928504134 2:31931318-31931340 GTCTGAATTAGTAGAGATGTAGG - Intronic
928516535 2:32049808-32049830 TTCTGTATTTTTAGTGGAGACGG + Intergenic
928520933 2:32088056-32088078 TTTTGTATTTTTAGTGAAGATGG + Intronic
928677907 2:33667933-33667955 TTTTAATTTTGTAGAGATGAGGG + Intergenic
929183596 2:39069716-39069738 TTCTGTATTTTTAGTGGAGACGG + Intronic
929205233 2:39284329-39284351 TTCTGTATTTGTAGTAGAGATGG + Intronic
929235665 2:39603103-39603125 TTCTGAACCTTTAGAGATGAAGG + Intergenic
929509386 2:42554978-42555000 TTTTGTATTTTTAGTGAAGACGG - Intronic
929744117 2:44637892-44637914 TTTTGTATTTGTAGTGGAGATGG - Intronic
929870347 2:45753905-45753927 TGCTGGATTTGTTGTGATCATGG - Intronic
930252270 2:49048054-49048076 TTCTGAATTTTTAGTAGAGATGG + Intronic
930282998 2:49393769-49393791 ACATGAATTTGGAGTGATGAAGG - Intergenic
930952727 2:57162978-57163000 TTCTGTATTTTTAGTAAAGACGG - Intergenic
931209689 2:60180676-60180698 TTTTGTATTTTTAGTAATGACGG + Intergenic
931403453 2:61953178-61953200 TTTTGTATTTTTAGTGGTGACGG + Intronic
931435473 2:62242053-62242075 TTTTGTATTTGTAGTGGAGACGG - Intergenic
931611579 2:64107097-64107119 TTTTGTATTTTTAGTGAAGATGG + Intronic
931623753 2:64236548-64236570 TTCTGTATTTTTAGTGGAGATGG - Intergenic
931717577 2:65041291-65041313 TTCTGAATTTTTAGTAGAGACGG - Intergenic
931859629 2:66341311-66341333 TTCTGTATTTTTAGTAAAGATGG + Intergenic
932004627 2:67915984-67916006 TTCTGAATTTTCAGTGAAAAGGG - Intergenic
932037912 2:68266613-68266635 TTCTTAATTTATAATGATAAGGG + Intergenic
932183917 2:69675092-69675114 TTCTGTATTTGTAGTAGAGACGG + Intronic
933731685 2:85461073-85461095 TTTTGGATTTTTAGTGGTGATGG - Intergenic
933832491 2:86222170-86222192 TCCTGAGATTATAGTGATGATGG - Intronic
933949693 2:87317965-87317987 TTCTGAAAAGGTAGTGATCAGGG - Intergenic
934159052 2:89230823-89230845 TTCTGATTCTCTAGTGAGGAAGG - Intergenic
934208222 2:89951602-89951624 TTCTGATTCTCTAGTGAGGAAGG + Intergenic
934715523 2:96540913-96540935 TTTTGTATTTGTAGTGGAGATGG + Intronic
935065412 2:99643228-99643250 TTTTGAATTTTTAGTAAAGATGG + Intronic
935118794 2:100161579-100161601 TTCTGTATTTTTAGTGGAGATGG - Intergenic
935209750 2:100929073-100929095 TTTTGTATTTTTAGTGAAGACGG + Intronic
935343222 2:102077239-102077261 TTTTGTATTTTTAGAGATGATGG + Intronic
935753366 2:106258487-106258509 TTTTGTATTTTTAGTAATGACGG - Intergenic
935790762 2:106587934-106587956 TTTTGTATTTTTAGTGAAGACGG - Intergenic
935953515 2:108352323-108352345 TTGTCAATTTGTAGTGAAAATGG - Intergenic
936330499 2:111543632-111543654 TTCTGAAAAGGTAGTGATCAGGG + Intergenic
936395396 2:112124019-112124041 TTTTGTATTTGTAGTGGCGACGG - Intergenic
937105607 2:119309588-119309610 TTTTGTATTTTTAGTGAAGATGG + Intronic
937645492 2:124261804-124261826 TGCTGTATTTGTAGTGAAAAGGG + Intronic
937678935 2:124623451-124623473 TTCAGAAGGTGTAGTGATTATGG - Intronic
937824968 2:126358579-126358601 TTCTGTCTTTGTATTAATGATGG + Intergenic
937860608 2:126705662-126705684 TTCTGACTGTGTAGGGATGGGGG + Intergenic
938006411 2:127790364-127790386 TTCTGAATCTATATTCATGAGGG + Intronic
938075950 2:128336976-128336998 TTCTGTATTTATTGAGATGATGG - Intergenic
938132775 2:128731799-128731821 TTTTGTATTTTTAGTAATGATGG + Intergenic
938887837 2:135671537-135671559 TTTTGTATTTGTAGTGGAGATGG + Intronic
940843839 2:158618010-158618032 TTCTGTATTTTTAGTAAAGATGG - Intronic
940957591 2:159745482-159745504 TTTTGTATTTTTAGTGAAGATGG - Intronic
941124915 2:161573010-161573032 TTTTGTATTTTTAGTGGTGACGG + Intronic
941676008 2:168344209-168344231 TTCTGTATTTTTAGTAAAGATGG - Intergenic
941775094 2:169384846-169384868 TTCTGATTTTTCAGTGATGAAGG + Intergenic
941797390 2:169615217-169615239 TTCTGTATTTTTAGTGGAGATGG + Intronic
941948066 2:171122115-171122137 TTTTGTATTTTTAGTGAAGACGG + Intronic
942082962 2:172418650-172418672 TTCTCAATTTGCAGTCATCATGG + Intergenic
942495086 2:176531763-176531785 TTCTGAATTTATAGTTGTCAGGG - Intergenic
942586452 2:177484514-177484536 TTTTGTATTTTTAGTGAAGATGG + Intronic
942639541 2:178047289-178047311 TTTTGAATTTTTAGTAAAGACGG - Intronic
942757338 2:179357360-179357382 TTGTGAATTTGGTGTGGTGAGGG + Intergenic
943014114 2:182490543-182490565 TTTTGTATTTTTAGTGAAGACGG + Intronic
943221689 2:185117552-185117574 TTCAGCATTTGTATTGATGGTGG + Intergenic
943433845 2:187838354-187838376 TTTAAAATTTGTAGTGATGCAGG + Intergenic
943722606 2:191220741-191220763 TTCTACATTAGTAGAGATGAGGG + Intergenic
943830716 2:192458278-192458300 TTCTGAATATGGTGAGATGATGG - Intergenic
944115790 2:196184789-196184811 TTTTGTATTTTTAGTGAAGACGG - Intergenic
944605754 2:201350212-201350234 TTTTGTATTTGTAGTAACGACGG - Intronic
944713623 2:202358031-202358053 TTTTGTATTTTTAGTGAAGATGG + Intergenic
945416121 2:209575347-209575369 TTCTGAATTTTTAGTAGAGACGG - Intronic
945560586 2:211334839-211334861 TTCTGAAATTTTAGTGCTGTTGG - Intergenic
946250462 2:218408241-218408263 TTTTGAATTTGTAGTAGAGATGG - Intergenic
946798671 2:223385391-223385413 TTCTGAACATGGAGAGATGATGG - Intergenic
946872942 2:224101202-224101224 TTCTGTATTTTTAGTAGTGATGG + Intergenic
947039835 2:225904413-225904435 TTCTGAAGTTGTTATGCTGAAGG + Intergenic
947588142 2:231369762-231369784 TTTTGAATTTTTAGTAGTGACGG + Intronic
948108205 2:235432420-235432442 TTTTGTATTTTTAGTGGTGATGG - Intergenic
949051483 2:241899893-241899915 TTTTGTATTTTTAGTGAAGACGG - Intronic
1168792874 20:591809-591831 TTTTGTATTTGTAGTAACGATGG + Intergenic
1169172522 20:3476686-3476708 TTTTGAATTTTTAGTGGAGACGG - Intronic
1169340351 20:4792078-4792100 TTTTGTATTTCTAGTGCTGATGG - Intronic
1169452554 20:5724494-5724516 TTTTGTATTTGTAGTAAAGACGG + Intergenic
1169561245 20:6803040-6803062 TTTTGAATTTTTAGTGGAGATGG + Intergenic
1170334958 20:15259491-15259513 TGCTGCATTTGTTGTGGTGATGG + Intronic
1170460434 20:16572843-16572865 TTCTGAGTTGGTAGAAATGAGGG + Intronic
1170747145 20:19110285-19110307 TTTTAAAATAGTAGTGATGATGG + Intergenic
1172246657 20:33450116-33450138 TTTTGAATTTTTAGTGGAGACGG + Intergenic
1172323231 20:34013620-34013642 TTCTGCTTCTGTAGTGATCAGGG - Intronic
1172365154 20:34343470-34343492 TTTTGTATTTTTAGTGAAGACGG + Intergenic
1172524120 20:35587316-35587338 TTCTGTATTTTTAGTAAAGATGG - Intergenic
1172712279 20:36934826-36934848 TTTTGTATTTGTAGTAAAGATGG + Intronic
1172733614 20:37109362-37109384 TTTTGTATTTTTAGTAATGATGG - Intronic
1173033757 20:39389000-39389022 TTTTGTATTTTTAGTAATGATGG + Intergenic
1173393896 20:42660220-42660242 TTCTGAACTTGTAGACATAATGG - Intronic
1173395825 20:42678469-42678491 TTTTGTATTTGTAGTGCAGATGG + Intronic
1173420450 20:42896463-42896485 TTTTGTATTTTTAGTGAAGACGG - Intronic
1173462627 20:43255766-43255788 TTCTGAAATTAGAGTGGTGATGG + Intergenic
1173513149 20:43646034-43646056 TTTTGTATTTGTAGTGGAGACGG - Intronic
1173644777 20:44626547-44626569 CTATGAGTTTGTAGAGATGAAGG - Exonic
1173912362 20:46679735-46679757 TTTTGAATTTTTAGTGAAGACGG - Intronic
1174000009 20:47367697-47367719 TTTTGTATTTTTAGTAATGATGG - Intergenic
1174211875 20:48886152-48886174 TTGTGAATATGTAGGGATGGGGG + Intergenic
1174406779 20:50307992-50308014 TTTTGTATTTGTAGTGGAGACGG + Intergenic
1174423214 20:50414159-50414181 TTTTAATTTTGTAGAGATGAAGG + Intergenic
1174865322 20:54130280-54130302 TCCTGAATCTTTAGTGATGTTGG - Intergenic
1175116542 20:56686705-56686727 TTCCGAATTTGTTTTAATGATGG + Intergenic
1175242192 20:57557803-57557825 TTCTACATTTGAAGGGATGATGG - Intergenic
1176383433 21:6125350-6125372 TTCTGTATTTTTAGTGGAGATGG + Intergenic
1177073944 21:16548659-16548681 TTCTGTATTTTTAGTGGAGATGG + Intergenic
1177302168 21:19261835-19261857 TTCTGTATTTTTAGTAGTGATGG + Intergenic
1177697915 21:24597473-24597495 TTTTGAATTTTTAGTAAAGATGG + Intergenic
1177705200 21:24695254-24695276 TTTTGTATTTTTAGTGAAGATGG + Intergenic
1177819531 21:26016201-26016223 TTTTGTATTTTTAGTGAAGACGG + Intronic
1177920551 21:27147009-27147031 TTTTGTATTTGTAGTGGAGACGG + Intergenic
1177972533 21:27808361-27808383 TTCTGCATTTGTAGTAGAGACGG - Intergenic
1178023790 21:28441365-28441387 TTCTAAAATTCTAGTGAAGATGG + Intergenic
1178319633 21:31595620-31595642 TTTTGTATTTTTAGTGAAGATGG + Intergenic
1178813743 21:35908163-35908185 TTTTGTATTTTTAGTGAAGATGG + Intronic
1179559458 21:42204658-42204680 TTCTGTATTTATATTCATGAGGG + Intronic
1180414566 22:12697202-12697224 TTCTGAATTTTAATTGCTGATGG - Intergenic
1180540337 22:16440560-16440582 TTCTTATTTTGTTGTGAAGATGG - Intergenic
1180854953 22:19039880-19039902 TTCTGAATTTTTTGTGGAGAAGG + Intronic
1181739129 22:24905985-24906007 TTCTGCATTTGTATTATTGAAGG - Intronic
1182034947 22:27190598-27190620 TTTTGTATTTTTAGTGAAGATGG - Intergenic
1182309131 22:29392248-29392270 TTTTGTATTTGTAGTGGAGATGG + Intronic
1182366615 22:29783458-29783480 TTCTGAATATGAAATGATGACGG - Intergenic
1182512879 22:30831658-30831680 TTCTGAATTGGGGGTGATGCTGG + Intronic
1182636780 22:31734141-31734163 TTCTGCATTTTTAGTAAAGATGG + Intronic
1183207260 22:36428025-36428047 TTTTGTATTTTTAGTGAAGACGG - Intergenic
1183597404 22:38821062-38821084 TTTTGTATTTTTAGTGAAGATGG + Exonic
1183835077 22:40445718-40445740 TTCTGTATTTTTAGTAAAGACGG + Intronic
1183938084 22:41275606-41275628 TTTTGTATTTTTAGTGAAGATGG - Intronic
1184073934 22:42164133-42164155 TTCTGAATCTATACTGATTAAGG + Intronic
1184083277 22:42241024-42241046 TTCTGTATTTTTAGTAAGGAGGG + Intronic
1184222063 22:43107297-43107319 TTCTGTATTTTTAGTGGAGACGG - Intergenic
949314199 3:2733704-2733726 TTTTGAATTTTTAGTAGTGATGG + Intronic
950869404 3:16215737-16215759 TTCTGTATTTTTAGTGGAGACGG - Intronic
951235792 3:20235152-20235174 TTTTGTATTTTTAGTAATGATGG + Intergenic
952320347 3:32271293-32271315 TTTTGTATTTGTAGTGGAGATGG + Intronic
952654734 3:35771497-35771519 TTTTGTATTTTTAGTAATGACGG + Intronic
952715746 3:36478791-36478813 TTTTGAATTTGTAGTAGAGATGG + Intronic
952785394 3:37149828-37149850 TTTTGAATTTTTAGTGGAGATGG - Intronic
952839183 3:37630019-37630041 TTCTGAATCTGTGGTGATCTTGG - Intronic
953415082 3:42711073-42711095 TTATGTATTTTTAGTAATGATGG - Intronic
953750788 3:45606962-45606984 TTCTGTATTTTTAGTGGAGACGG + Intronic
953908368 3:46879866-46879888 TTTTGCATTTGTAGTGGAGATGG - Intronic
954029251 3:47806615-47806637 TTTTGTATTTTTAGTGAAGATGG + Intronic
954063117 3:48085749-48085771 TTTTGAATTTTTAGTAAAGATGG - Intronic
954257071 3:49414361-49414383 TTTTGTATTTTTAGTGAAGACGG - Intronic
954530367 3:51313651-51313673 TTCTGAAGCTGTAGGAATGATGG + Intronic
954813535 3:53262879-53262901 TTCTGTATTTTTAGTAAAGATGG + Intergenic
955216455 3:56988317-56988339 TTTTGTATTTGTAGTGGAGACGG + Intronic
955668477 3:61376141-61376163 TTCTGTATTTTTAGTAAAGATGG - Intergenic
955681931 3:61511183-61511205 CTCTGATTTTATAGTGATGATGG - Intergenic
956175932 3:66473025-66473047 TTCTGGACGTGTAGTGATTAGGG + Intronic
957643830 3:82893256-82893278 TTCTGCATTTGTAGTGCTCCAGG + Intergenic
957996921 3:87702595-87702617 TTCATAATTTCTAGTGATGGGGG + Intergenic
958263206 3:91406770-91406792 TTCTTATTATGTAGTAATGAGGG - Intergenic
958774738 3:98468415-98468437 TTCTGGATGAGTAGTGGTGATGG - Intergenic
958806452 3:98816951-98816973 TTCTGTATTTTTAGTGGAGATGG + Intronic
958965233 3:100551183-100551205 TTCTGTATTTTTAGTGGAGACGG + Intronic
960377380 3:116920027-116920049 TTTTGAATTTGAAGGGATTATGG + Intronic
961656380 3:128444571-128444593 TTCAGACTTGGTAGTGGTGATGG + Intergenic
962160028 3:132989341-132989363 TTTTGTATTTTTAGTGAAGATGG - Intergenic
962307018 3:134297390-134297412 TTTTGTATTTGTAGTAAAGACGG + Intergenic
962521791 3:136203931-136203953 TTTTGTATTTTTAGTGAAGACGG + Intergenic
962561839 3:136614287-136614309 TTGTCAATTGGTAGTGATGAAGG + Intronic
962609125 3:137058317-137058339 TTTTGTATTTTTAGTGAGGATGG + Intergenic
962715992 3:138126653-138126675 TTTTGTATTTGTAGTGGAGACGG - Intronic
963157855 3:142118199-142118221 TTCTGAATTTGTAGTGATGATGG - Intronic
963162999 3:142171056-142171078 TTTTGTATTTTTAGTAATGATGG - Intronic
964158063 3:153610916-153610938 TTTTGTATTTTTAGTAATGACGG - Intergenic
964224095 3:154377535-154377557 TTTTGTATTTGTAGTGGAGACGG + Intronic
964357827 3:155866517-155866539 TTTTGTATTTTTAGTGAAGATGG - Intergenic
964466391 3:156997798-156997820 TTCTGAATTTGGAGAAATAAGGG + Intronic
964634604 3:158845318-158845340 TTTTGTATTTCTAGTAATGATGG - Intergenic
965431383 3:168593384-168593406 TTTTGAATTTTTAGTAAAGACGG - Intergenic
965516510 3:169627617-169627639 TTTTGAATTTCTAGTAATAATGG + Intronic
966046109 3:175551724-175551746 TTTTGAATTTTTAGTGTAGACGG - Intronic
966062880 3:175781404-175781426 TCATGTGTTTGTAGTGATGATGG + Intronic
966072630 3:175897256-175897278 CTCTTAGTTTGCAGTGATGAAGG + Intergenic
966241738 3:177761755-177761777 TTTTGTATTTGTAGTGGAGACGG - Intergenic
966548480 3:181178694-181178716 TTCTGCATTTGAAGACATGATGG - Intergenic
966817205 3:183899082-183899104 TTTTTAATTTGTAGTAAAGACGG - Intergenic
968126010 3:196160937-196160959 TTATGATTTTTTAGTGATCATGG - Intergenic
969385043 4:6838956-6838978 TTCTGTATTTTTAGTGGAGATGG - Intronic
969429163 4:7143951-7143973 TTTTGTATTTTTAGTGGTGACGG - Intergenic
969944514 4:10769665-10769687 TTCTGCTTTTTTAGTGAGGATGG + Intergenic
970405723 4:15761214-15761236 TTCTGTATTTTTAGTGGAGATGG + Intergenic
970638730 4:18039548-18039570 TTCTGAAATCTTTGTGATGAAGG - Intergenic
970936183 4:21572795-21572817 TTTTGTATTTTTAGTGAAGATGG + Intronic
971132848 4:23832780-23832802 TTTTGTATTTTTAGTGAAGATGG + Intronic
971340217 4:25761723-25761745 TACTTAATTACTAGTGATGATGG - Intronic
971342210 4:25780994-25781016 TTCTGTATTTTTAGTGATGAGGG + Intronic
971965218 4:33545615-33545637 TTCTGTATTTGTGGTGATGCTGG + Intergenic
972065859 4:34942650-34942672 TTTTGAATTTTTAGTAAAGACGG - Intergenic
972620034 4:40738445-40738467 TTCTGTATTTTTAGTAAAGATGG + Intergenic
972916547 4:43887865-43887887 TTTTGAATTTTTAGTAAAGACGG + Intergenic
972961477 4:44458320-44458342 TCCTGTGTTTGTAGTGATGCTGG - Intergenic
973192261 4:47398960-47398982 TTCTGTATTTTTAGTGGAGACGG + Intronic
974268223 4:59614573-59614595 TTTGGAATTTGTAGTGAAAAGGG - Intergenic
974408193 4:61503975-61503997 TGGAGAATTTGAAGTGATGAGGG - Intronic
974422288 4:61692612-61692634 TTTTGTATTTGTAGTAAAGATGG + Intronic
974656906 4:64836937-64836959 TTTTGTATTTGTAGTGGAGACGG + Intergenic
974682756 4:65184488-65184510 TTCTCAATTTGTAGTTACAAGGG - Intergenic
974701718 4:65457900-65457922 TTTTGAATTTTTAGTGGAGACGG - Intronic
974714793 4:65654096-65654118 TTCTGAATTGGTTGTGATACTGG + Intronic
975652013 4:76603005-76603027 TTCTGTATTTGTACTAAAGATGG + Intronic
976216823 4:82722895-82722917 TTTTGTATTTGTAGTGGAGACGG - Intronic
976673631 4:87680911-87680933 TTCTGAATTTTTAGTAGAGACGG + Intergenic
976674321 4:87687450-87687472 TTTTGAATTTTTAGTAAAGATGG + Intergenic
977565722 4:98578588-98578610 TTTTGTATTTGTAGTAAAGATGG + Intronic
977594801 4:98866856-98866878 TTTTGTATTTTTAGTAATGATGG - Intergenic
977716982 4:100193640-100193662 TTCTGAAATTGTAGTTATCTGGG + Intergenic
977879352 4:102186503-102186525 TTGCCAATTTGTAATGATGATGG - Intergenic
978401134 4:108332312-108332334 TCTTGCATTTGTATTGATGACGG + Intergenic
978812039 4:112860395-112860417 TTTTGTATTTTTAGTGAAGACGG + Intronic
979892217 4:126112546-126112568 TTCTGTATTTTTAGTAAAGATGG + Intergenic
979894334 4:126139505-126139527 TTCTGTATTTTTAGTAGTGACGG + Intergenic
980622238 4:135322877-135322899 TTATGAATGTGTAGTGTTTATGG - Intergenic
980721695 4:136705694-136705716 TTTAAAATTTGAAGTGATGATGG + Intergenic
980952576 4:139396211-139396233 TTTTGTATTTTTAGTGGTGACGG + Intronic
981455044 4:144943867-144943889 TTCTGTATTTTTAGTAGTGATGG + Intergenic
981469847 4:145120122-145120144 TTCTGAAATTATGGTGATGCTGG + Exonic
982565493 4:156980667-156980689 TTATCAGTTTGTAGTGATGGTGG - Intergenic
982698252 4:158629219-158629241 TTTTGTATTTGTAGTAAAGATGG + Intronic
983341090 4:166462186-166462208 TTCTGAAATTGTAGTAATTTGGG - Intergenic
983365857 4:166788009-166788031 TTTTGTATTTTTAGTGAAGACGG - Intronic
983367429 4:166811486-166811508 TTCTTAATGTGTAATGATGTGGG + Intronic
984104248 4:175524850-175524872 TTGTGAATATGTATTGGTGAAGG + Intergenic
984636954 4:182121166-182121188 TTCTGTATTTTTAGTGGAGACGG + Intergenic
986195079 5:5530964-5530986 TTTTAATTTTGTAGAGATGAGGG + Intergenic
986686200 5:10277260-10277282 TTTTGAATTTTTAGTGGAGATGG + Intronic
986724894 5:10587269-10587291 TTTTGTATTTTTAGTAATGACGG + Intronic
987239510 5:15980512-15980534 TTCTGAAAATGTAGTGGAGATGG - Intergenic
987348505 5:16999845-16999867 TTCTGTATTTGTAGTAGAGATGG - Intergenic
987549859 5:19365480-19365502 TGCTGTGTTTGTAGTGATGATGG - Intergenic
988329825 5:29821362-29821384 TTTTGTATTTTTAGTGAAGATGG + Intergenic
988432006 5:31129952-31129974 TTCTGTATTTTTAGTGGAGATGG + Intergenic
988489375 5:31693410-31693432 TTCTGTATTTTTAGTAAAGACGG + Intronic
989104692 5:37851212-37851234 TTCTGTATTTGTAAAAATGATGG + Intergenic
989150541 5:38294995-38295017 TTTTGTATTTTTAGTGAAGACGG + Intronic
989527955 5:42475052-42475074 TTTTGTATTTGTAGTAGTGACGG + Intronic
990402358 5:55451731-55451753 TTCTGTATTTGTAGTAGAGACGG + Intronic
990683678 5:58275767-58275789 TTCTGAATTTGCTGTGATTCTGG + Intergenic
991282408 5:64930293-64930315 TTCTGGAATTATAGTGGTGACGG + Intronic
991365098 5:65859968-65859990 TTCTGTATTTTTAGTAAAGACGG - Intronic
991673175 5:69067789-69067811 TTCTGTATTTTTAGTAAAGACGG + Intergenic
991730027 5:69576847-69576869 TTTTGTATTTTTAGTGAGGACGG - Intronic
991806461 5:70431990-70432012 TTTTGTATTTTTAGTGAGGACGG - Intergenic
991864925 5:71051015-71051037 TTTTGTATTTTTAGTGAGGACGG + Intronic
991909762 5:71550213-71550235 TTTTGTATTTGTAGTAGTGATGG - Intronic
992254103 5:74904560-74904582 TTCTGTATTTTTAGTAAAGACGG + Intergenic
992533483 5:77674026-77674048 TTCTGAATTAGGAAAGATGAAGG + Intergenic
992779415 5:80114481-80114503 TTTTGTATTTTTAGTGGTGATGG - Intronic
993178303 5:84517115-84517137 TTCTGTATTTGTAGTAGAGATGG - Intergenic
993360881 5:86974885-86974907 CTGTGAATTTGTAGTGAATAAGG - Intergenic
993511524 5:88776991-88777013 GCCTGATTTTGTAGTCATGATGG + Intronic
993989288 5:94636888-94636910 TTTTGTATTTTTAGTGAAGATGG + Intronic
994096087 5:95849377-95849399 TTCTGCATTTCTAGTGGAGATGG + Intergenic
994205039 5:97025111-97025133 TTTTTAATATGTAGTGATGAAGG + Intronic
994868158 5:105305821-105305843 TTCTGCATCTGTTGAGATGATGG - Intergenic
995303830 5:110620070-110620092 TTCTGAATTTTCTCTGATGATGG - Intronic
995963782 5:117878837-117878859 TTCTGAATTATTAGTGAAAATGG + Intergenic
995972150 5:117985513-117985535 TTCTGTATTTTTAGTAAAGATGG + Intergenic
995979452 5:118083611-118083633 TTCTAAAATTGTAGTGGTAAAGG + Intergenic
996254113 5:121376959-121376981 TTTTAAATTTTTAGTGAAGACGG - Intergenic
996314044 5:122141477-122141499 TTTTGTATTTTTAGTAATGACGG + Intronic
996572808 5:124950706-124950728 TTCTGACTCTGAAGTGCTGAAGG - Intergenic
996652234 5:125892961-125892983 TTTTGTATTTTTAGTGAAGATGG - Intergenic
997125207 5:131219764-131219786 TTTTAAATTTGTAGTAAAGATGG - Intergenic
997533727 5:134599411-134599433 TTTTGAATTTGTAGTAGAGACGG + Intergenic
997550229 5:134745966-134745988 TTTTGAATTTGTAGTAGAGACGG - Intronic
997929122 5:138057891-138057913 TTCTGTATTTTTAGTGGAGATGG - Intergenic
997954662 5:138269669-138269691 TTTTGTATTTGTAGTGGAGATGG - Intronic
997977873 5:138450814-138450836 TTTTGTATTTTTAGTGAAGACGG + Intergenic
998665187 5:144288797-144288819 TTCTGTATTTTTAGTAAAGACGG - Intronic
999023501 5:148197758-148197780 TTCTGTATTTTTAGTAAAGATGG + Intergenic
999341033 5:150772713-150772735 TTATGTGTTTGTAGTGATGCTGG - Intergenic
1000044932 5:157514495-157514517 TTTTGTATTTTTAGTAATGATGG + Intronic
1000299454 5:159942636-159942658 TTGTGTGTTTGTAGAGATGAGGG - Intronic
1000620897 5:163485415-163485437 TTCTTAATTGGTAATGATGTTGG + Intronic
1001341783 5:170853510-170853532 TTCTGTATTTTTAGTAAAGATGG - Intergenic
1001632812 5:173188886-173188908 TTTTGAATTTGTAGTAGAGATGG + Intergenic
1002028152 5:176409583-176409605 TTCTGTATTTTTAGTAAAGACGG + Intronic
1002112328 5:176926459-176926481 TTTTAATTTTGTAGTGATGGGGG - Intronic
1002436902 5:179237079-179237101 TTTAGTTTTTGTAGTGATGAGGG - Intronic
1002502297 5:179654932-179654954 TTCTGCATTTTTAGTAAAGACGG + Intergenic
1002506052 5:179679827-179679849 TTTTGTATTTTTAGTGAAGACGG + Intronic
1002574489 5:180165497-180165519 TTTTGTATTTGTAGTAAGGATGG - Intronic
1002627561 5:180541622-180541644 TTTTGTATTTTTAGTGAAGACGG + Intronic
1002882292 6:1263556-1263578 TTATGAATTTATGGTGCTGAAGG + Intergenic
1003038836 6:2668895-2668917 TTTTAAATTTGTAGAGATGGGGG - Intronic
1003363284 6:5449176-5449198 TTTTGCATTTGTAGTAAAGATGG - Intronic
1003582185 6:7349760-7349782 TTTTGTATTTGTAGTAAAGATGG - Intronic
1004209276 6:13621875-13621897 GTTTGAATTTATAGTGTTGATGG - Exonic
1004212771 6:13668439-13668461 TTTTGCATTTGTATTAATGAAGG - Intronic
1004320011 6:14625024-14625046 TTTTGTATTTGTAGTAAAGATGG + Intergenic
1004367421 6:15023752-15023774 TTCTGTATTTTTAGTAAAGACGG - Intergenic
1004466635 6:15891564-15891586 TTTTGTATTTTTAGTGAAGACGG - Intergenic
1004506030 6:16247543-16247565 TTTTGTATTTTTAGTGAAGATGG + Intronic
1004552606 6:16663517-16663539 TTCTAAATTTGTATTGAGGCAGG - Intronic
1004940913 6:20555489-20555511 TTTTGAATTTTTAGTGGAGACGG + Intronic
1004967816 6:20874671-20874693 TTCTGTATTTTTAGTGGAGATGG + Intronic
1005148522 6:22721129-22721151 TTCTGTATTTTTAGTGGAGACGG - Intergenic
1005184019 6:23143129-23143151 TTCTGTATTTGTAGTTTTCATGG - Intergenic
1005200475 6:23338999-23339021 GTTTGAATTTCTGGTGATGAGGG + Intergenic
1005467972 6:26133784-26133806 CTTTGGATTTGTAGAGATGAAGG - Intronic
1005917287 6:30364355-30364377 TTCTGAATGTTGAGTGAGGATGG - Intergenic
1006121262 6:31807411-31807433 TTTTGTATTTTTAGTGAAGATGG - Intergenic
1006177719 6:32132761-32132783 TTTTGTATTTTTAGTGAAGATGG + Intergenic
1006494056 6:34408676-34408698 TTCTGTATTTTTAGTAAAGACGG + Intronic
1006721226 6:36153054-36153076 TTCTGTATTTTTAGTGCAGAGGG + Intergenic
1006759555 6:36447456-36447478 TTCTGAATTTTTAGTAGAGACGG - Intronic
1007359689 6:41346087-41346109 TACAGAATCTGCAGTGATGATGG - Intronic
1007549030 6:42715036-42715058 TTTTGTATTTTTAGTGAAGATGG - Intronic
1007741836 6:44015615-44015637 TTATGTCTTTGTAGTGATGCTGG + Intergenic
1007819051 6:44547052-44547074 TTCTGTATTTATAGAGATAAGGG - Intergenic
1008066042 6:47049734-47049756 TTTTGTATTTGTAGTAAAGATGG - Intergenic
1008102644 6:47408786-47408808 TCCTAAATTTGTTGTGGTGAGGG - Intergenic
1008106168 6:47443057-47443079 TTCTGGATTTGTGGTGTTCATGG - Intergenic
1008738551 6:54577056-54577078 TTCTGTATTTTTAGTAAAGACGG + Intergenic
1008992201 6:57616118-57616140 TTCTTATTATGTAGTAATGAGGG + Intronic
1009185935 6:60574525-60574547 TTTTGTATTTGTAGTGGAGATGG + Intergenic
1010440701 6:75890513-75890535 TTTTGTATTTGTAGTGGAGACGG + Intronic
1010981989 6:82378870-82378892 TTTTGTATTTTTAGTGGTGATGG - Intergenic
1011411920 6:87074987-87075009 TTTTGTATTTTTAGTGAAGACGG - Intergenic
1011420706 6:87169209-87169231 TTTTGTATTTTTAGTGAAGACGG + Intronic
1011421420 6:87177155-87177177 TTCTGTATTTTTAGTAAAGACGG - Intronic
1012095972 6:94961436-94961458 TTTGGAATTTCTAGTGATGTAGG + Intergenic
1012168438 6:95988488-95988510 GTCTTAATTTGAAGGGATGAAGG - Intergenic
1012264888 6:97129709-97129731 TTTTGTATTTTTAGTGAAGACGG - Intronic
1014365460 6:120535568-120535590 TTTTTTATTTGTAGTGGTGAAGG + Intergenic
1014403462 6:121019664-121019686 TTCTCAATTTGCAGTGGAGATGG - Intergenic
1014735307 6:125087715-125087737 TTCTGAAATTGTAGTAATCTTGG + Exonic
1014783753 6:125594189-125594211 TTATAAAATTATAGTGATGAGGG + Intergenic
1015380807 6:132565765-132565787 TTTTGAATGTGTTGTGAGGAAGG - Intergenic
1015520758 6:134129028-134129050 TTCTGTATTTTTAGTAAAGACGG + Intergenic
1016514713 6:144881145-144881167 TTTTGAATTTTTAGTAAAGATGG - Intergenic
1016835585 6:148473422-148473444 TTCTGTATTTTTAGTGGAGATGG + Intronic
1017066825 6:150536773-150536795 TTCTTTATTTGTAGTTATTATGG - Intergenic
1017257109 6:152346335-152346357 TTTTGTATTTTTAGTGAAGACGG + Intronic
1017478887 6:154829734-154829756 TTCTGTATTTTTAGTGGAGACGG - Intronic
1017689151 6:156945835-156945857 TTTTGTATTTTTAGTGAAGATGG - Intronic
1017794895 6:157835181-157835203 TTCTGTATTTTTAGTGGAGATGG + Intronic
1018516687 6:164588176-164588198 TTCTTATTTTGAACTGATGATGG - Intergenic
1018629341 6:165808822-165808844 TTCTCAATTTAAAATGATGAAGG + Intronic
1019554481 7:1621934-1621956 TTTTGAATTTTTAGTAAAGACGG - Intergenic
1019904042 7:4047415-4047437 TTTTGAATTTGTGTTCATGATGG + Intronic
1019974286 7:4568161-4568183 TTATTTATTTGTAGAGATGAGGG - Intergenic
1020902835 7:14026980-14027002 TTTTGTATTTGTAGTAAAGACGG - Intergenic
1021103203 7:16607393-16607415 TTCTGCATTTTTAGTAAAGACGG - Intronic
1021127921 7:16875182-16875204 TTCTAAAATTGATGTGATGATGG - Intronic
1021328989 7:19311241-19311263 TTTTGAATTTTTAGTGGAGACGG - Intergenic
1021710688 7:23413028-23413050 TTCTGTATTTTTAGTTAAGATGG + Intronic
1021896383 7:25239851-25239873 TTTTGTATTTTTAGTGAAGATGG + Intergenic
1022036325 7:26537985-26538007 TTCTTTATTTGTAATGAAGATGG + Intronic
1022059601 7:26779330-26779352 TTCAGAATTTGTGGTAATAAGGG - Intronic
1023408727 7:39864625-39864647 TTTTGTATTTTTAGTAATGATGG + Intergenic
1024140399 7:46457287-46457309 TTTTGCATTTCTAATGATGATGG - Intergenic
1025044224 7:55679389-55679411 TTTTGTATTTTTAGTAATGATGG - Intergenic
1025137145 7:56427924-56427946 TTTTGTATTTTTAGTAATGATGG - Intergenic
1025216200 7:57058843-57058865 TTTTGTATTTTTAGTGAAGATGG - Intergenic
1025612913 7:63094013-63094035 TTCTGTATTTTTAGTGGAGACGG - Intergenic
1025655182 7:63511887-63511909 TTTTGTATTTTTAGTGAAGATGG + Intergenic
1025877586 7:65499254-65499276 TTCTGTATTTTTAGTAGTGACGG + Intergenic
1026208268 7:68278769-68278791 TTTTGTATTTTTAGTGAAGACGG + Intergenic
1026316372 7:69231201-69231223 TTTTGAATTTTTAGTAAAGACGG - Intergenic
1026891882 7:73987129-73987151 TTTTGTATTTTTAGTGAAGACGG + Intergenic
1027309690 7:76942407-76942429 TGCTGAATTTGCAGTGCTTATGG - Intergenic
1027824755 7:83097348-83097370 TTTTGTATTTGTAGTGGAGATGG - Intronic
1027883315 7:83871372-83871394 TTTTGAATTTTTAGTAAAGACGG + Intergenic
1029229656 7:99055792-99055814 TTTTGTATTTGTAGTGGAGACGG - Intronic
1029250867 7:99235350-99235372 TTTTGAATTTTTAGTAAAGATGG + Intergenic
1029293561 7:99520827-99520849 TTTTGTATTTGTAGTAGTGATGG - Intronic
1029557667 7:101281561-101281583 TTTTGTATTTTTAGTGAAGACGG - Intergenic
1029839421 7:103346301-103346323 TTCTGTATTTGTAGTAGAGACGG + Intronic
1030040077 7:105441555-105441577 TTTTGTATTTTTAGTGAAGACGG + Intronic
1030617210 7:111750560-111750582 TTCTGAATTATTACTGATGTGGG + Intronic
1030845277 7:114401446-114401468 TTATTAAGTGGTAGTGATGAGGG - Intronic
1032336173 7:131027105-131027127 TTCTGAATTTGCTGTGAGTAGGG - Intergenic
1032438705 7:131924215-131924237 TTCTGTATTTTTAGTGGAGACGG + Intergenic
1032623883 7:133567574-133567596 TTGTGCATTTGTAGTTTTGATGG + Intronic
1032694700 7:134324963-134324985 TTCTGTATTTTTAGTGGAGACGG - Intergenic
1033063042 7:138126243-138126265 TTCTTAATTTTCAGTGCTGATGG - Intergenic
1033139487 7:138812659-138812681 TTTTGTATTTTTAGTGAAGACGG + Intronic
1033633054 7:143180375-143180397 TTTTGAATTGGAAGAGATGAAGG + Intergenic
1033959913 7:146902054-146902076 TTTTGTATTTGTAGTGGAGACGG + Intronic
1033990108 7:147272677-147272699 TTTTGTATTTGTAGTGGAGATGG + Intronic
1033997189 7:147365231-147365253 TTCTGTATTTGTAGTAGAGACGG - Intronic
1034124490 7:148658842-148658864 TTTTGAATTTTTAGTGGAGATGG + Intergenic
1034180231 7:149131513-149131535 TTCTGTATTTGTAGTAGAGATGG - Intronic
1034679457 7:152917571-152917593 TTTTGTATTTTTAGTGGTGATGG + Intergenic
1035098410 7:156376219-156376241 TCCTGATTTTGTTGTGAAGATGG + Intergenic
1035105356 7:156437366-156437388 ATCTGAATTTATGATGATGAGGG + Intergenic
1035161223 7:156951225-156951247 TTTTGTATTTTTAGTAATGACGG - Intronic
1035693692 8:1577396-1577418 TTTTGAATTTTTAGTAAAGATGG - Intronic
1035866878 8:3093494-3093516 TTTTGTATTTTTAGTAATGATGG - Intronic
1035887368 8:3306342-3306364 TTTTGTATTTTTAGTGGTGATGG + Intronic
1036050889 8:5195481-5195503 TTTTGTATTTTTAGTGGTGATGG + Intergenic
1036920304 8:12847472-12847494 TTTTGTATTTTTAGTGAAGACGG - Intergenic
1037070052 8:14633904-14633926 TTCTTAATTTTTAGTTATAAAGG + Intronic
1037360523 8:18068967-18068989 TTCTGAATTTTTAGTAGAGACGG - Intronic
1037468016 8:19179125-19179147 TTTTGTATTTTTAGTGAAGAGGG + Intergenic
1037519086 8:19662211-19662233 TTTTGTATTTGTAGTGGAGATGG - Intronic
1037778841 8:21853889-21853911 TTCTGACTTTATTCTGATGATGG + Intergenic
1037789541 8:21925022-21925044 TTGTGAATTTGTAGTGAGACTGG + Intronic
1038464390 8:27747547-27747569 TCCTGAAATTCTAGTGAAGAAGG - Intronic
1038465544 8:27759434-27759456 TTTTGTATTTTTAGTGGTGATGG - Intronic
1038702085 8:29858158-29858180 TTTTGCATTTTTAGTGAAGATGG - Intergenic
1038933256 8:32218921-32218943 TTCTGAATCTGTAGTTATTAAGG - Intronic
1039054935 8:33528486-33528508 TTTTGTATTTGTAGTAAAGATGG + Intergenic
1039509350 8:38078461-38078483 TTTTGTATTTGTAGTAAAGATGG - Intergenic
1041035951 8:53790695-53790717 TACAGACTTTGTAGTGAGGAGGG + Intronic
1041258570 8:56000554-56000576 TTTTGTATTTTTAGTAATGACGG - Intronic
1041674377 8:60523327-60523349 TTTTGTATTTTTAGTGAAGACGG + Intronic
1041817256 8:61988276-61988298 TTTTGTATTTTTAGTGAAGACGG + Intergenic
1042134945 8:65623966-65623988 TTTTGTATTTTTAGTAATGATGG + Intronic
1042204726 8:66317598-66317620 TTTTGAATTTTTAGTGGAGATGG - Intergenic
1042291238 8:67171226-67171248 TTCTGTATTTTTAGTAAAGATGG - Intronic
1042355776 8:67825926-67825948 TTTTGAATTTGTAGTAGAGATGG + Intergenic
1042563374 8:70090394-70090416 TTCTGTATTTTTAGTAAAGACGG + Intergenic
1042895170 8:73658740-73658762 TTTTGTATTTGTAGTGAAGACGG - Intronic
1042926589 8:73973598-73973620 TTCTGTGTTTTTAGTGAAGACGG + Intronic
1043446289 8:80322713-80322735 TTTTGTATTTTTAGTGAAGATGG + Intergenic
1043579979 8:81700767-81700789 TTTTGAATTTTTAGTGGAGACGG - Intergenic
1043768488 8:84167227-84167249 TTCTGTATTTTTAGTAAAGACGG - Intergenic
1044084967 8:87933200-87933222 TTTTGTATTTTTAGTGAAGATGG + Intergenic
1044435979 8:92164806-92164828 TTTTGTATTTTTAGTGAAGACGG + Intergenic
1044689338 8:94861431-94861453 TTTTGTATTTTTAGTGGTGACGG + Intronic
1044691940 8:94889465-94889487 TTCTGACTGTCTAGTGATCATGG - Intronic
1045910403 8:107400728-107400750 TTCTGTATTTTTAGTAAAGACGG + Intronic
1046497394 8:115033345-115033367 TTTTGTATTTCTAGTAATGACGG + Intergenic
1046775946 8:118163701-118163723 TTTTGAATTTTTAGTAAAGACGG - Intergenic
1046862015 8:119103939-119103961 TACTGGAATTGTAGTGTTGATGG - Intronic
1047091808 8:121583466-121583488 TTTTGTATTTTTAGTGAAGATGG - Intergenic
1047127735 8:121981202-121981224 TTTTGAATCTATATTGATGAGGG + Intergenic
1047326791 8:123846901-123846923 TTCTGTATTTTTAGAGAAGACGG - Intergenic
1047327427 8:123853323-123853345 TTCTGTATTTTTAGAGAAGACGG + Intronic
1047498505 8:125425629-125425651 TTTTGTATTTTTAGTGAAGACGG + Intergenic
1047735567 8:127762062-127762084 TTTTGAATTTTTAGTGGAGACGG - Intergenic
1048170230 8:132099422-132099444 TTCTGAATTTCTGAAGATGAAGG - Intronic
1048248380 8:132834505-132834527 TTTTGCTTTTGTAGAGATGAGGG + Intronic
1048471281 8:134706519-134706541 TTCTGTATTTTTAGTGGAGACGG - Intronic
1048930260 8:139309425-139309447 TTTTGTATTTTTAGTGAAGATGG + Intergenic
1049122156 8:140748321-140748343 TTCTGTATTTTTAGTAAAGATGG - Intronic
1049149922 8:141028182-141028204 TTTTGTATTTTTAGTAATGACGG + Intergenic
1050404149 9:5289925-5289947 TTCTGGATTTGTTGTTTTGAAGG + Intergenic
1051254631 9:15200826-15200848 TTCTGAATTTTTAGTAGAGACGG - Intronic
1053051883 9:34968878-34968900 TATTGAATATGTAATGATGAAGG + Intronic
1053408778 9:37901336-37901358 TTCTGTATTTTTAGTGGAGACGG + Intronic
1053502338 9:38609305-38609327 TTTTGTATTTTTAGTGGTGACGG - Intergenic
1054460003 9:65457675-65457697 TTGTGTATTTGTAGTAAAGACGG + Intergenic
1054804522 9:69385089-69385111 TTTTGAATTTTTAGTGGAGATGG + Intronic
1055006307 9:71511198-71511220 TTCTTTATTTCTAGTGATTATGG - Intergenic
1055362739 9:75511702-75511724 TTGTTATTTTGTAGTGATGTTGG - Intergenic
1055491530 9:76809523-76809545 TTTTGAATTTTTAGTAAAGACGG - Intronic
1055516857 9:77042514-77042536 TTTTGAATTTTTAGTAGTGATGG + Intergenic
1055520064 9:77071740-77071762 TTCTGTATTTTTAGTAAAGATGG + Intergenic
1055746335 9:79449630-79449652 TTCTGTATTTTCAGTAATGATGG + Intergenic
1056607041 9:88094474-88094496 TTTTGTATTTTTAGTGAAGATGG + Intergenic
1057244434 9:93442552-93442574 TTCTGAAATTTTAGTTATTATGG + Intergenic
1057419770 9:94901767-94901789 TTCTGTATTTTTAGTAAGGACGG - Intronic
1058009469 9:99960612-99960634 TTTTGTATTTTTAGTGAAGACGG + Intronic
1058524966 9:105848598-105848620 TTCTGTATTTTTAGTAAAGACGG - Intergenic
1058785154 9:108379565-108379587 TTTTGAATCTGTTGTGATGTTGG + Intergenic
1058934775 9:109759370-109759392 TTCTGAGTTTGTGGTGATTCTGG - Intronic
1059174148 9:112153981-112154003 TTATGTGTTTGTAGTGATGCTGG - Intronic
1059372082 9:113849956-113849978 TTTTGTATTTTTAGTGAAGACGG + Intergenic
1059910916 9:119043209-119043231 CTCTAAATTTGTGGTGAGGAGGG - Intergenic
1060857332 9:126925374-126925396 TTTTGTATTTTTAGTGAAGAGGG - Intronic
1060951447 9:127606417-127606439 TTTTGTATTTTTAGTGAAGATGG + Intergenic
1061354329 9:130092789-130092811 TTTTGTATTTTTAGTGGTGATGG + Intronic
1061362855 9:130154807-130154829 TTCTGTATTTTTAGTAGTGATGG + Intergenic
1061439024 9:130586919-130586941 TTTTGTATTTTTAGTGAAGACGG + Intronic
1061456927 9:130705345-130705367 TTCTGTATTTTTAGTGGAGACGG - Intergenic
1061457501 9:130709731-130709753 TTCTGTATTTTTAGTAGTGAGGG + Intergenic
1062314252 9:135958217-135958239 TTCTGTATTTTTAGTAAAGATGG + Intronic
1186015232 X:5183788-5183810 TTTTGTATTTTTAGTGGTGACGG - Intergenic
1186100117 X:6146960-6146982 TTTTGTATTTGTAGTAAAGACGG + Intronic
1186123986 X:6392924-6392946 TTATGAATTTATATAGATGAGGG - Intergenic
1186409409 X:9333225-9333247 TTTTGTATTTTTAGTGGTGATGG - Intergenic
1186534752 X:10335071-10335093 TTTTGTATTTTTAGTGAAGACGG - Intergenic
1186845286 X:13524645-13524667 TTCTGAATGTGGGGTGATCAAGG + Intergenic
1187115884 X:16350150-16350172 TTTTGTATTTGTAGTAATGATGG + Intergenic
1187311641 X:18149855-18149877 TTATAAATCTGTAGTAATGAAGG - Intergenic
1188292375 X:28405484-28405506 TTTTGTATTTTTAGTGAAGATGG + Intergenic
1189709802 X:43797689-43797711 TTCTAAATTTGTGGTGAAGGTGG - Intronic
1189799250 X:44676609-44676631 TTCTGTATTTTTAGTGGAGATGG - Intergenic
1189807740 X:44752320-44752342 TTTTGAATTTTTAGTGAAGACGG - Intergenic
1189844324 X:45118968-45118990 TTCTGAATAGGTAATTATGAGGG + Intergenic
1192235487 X:69292847-69292869 TTCTGTATTTTTAGTAAAGACGG - Intergenic
1192475561 X:71438790-71438812 TTTTGTATTTTTAGTGAAGACGG - Intronic
1192673530 X:73170649-73170671 TTTTGAATTTTTAGTAAGGATGG + Intergenic
1192891563 X:75397154-75397176 TTTTGTATTTTTAGTAATGACGG - Intronic
1193023060 X:76813482-76813504 TTTTGTATTTTTAGTGGTGATGG - Intergenic
1193142025 X:78037564-78037586 TTCTTAATTTATAGTGCTGCAGG - Intronic
1194717977 X:97308847-97308869 TTTTGAATTTTTAGTAAAGATGG - Intronic
1196028762 X:111072705-111072727 AACTGAATTTGTAGGGATGGAGG + Intronic
1196247942 X:113422729-113422751 TTCTGAATTTGTAGAAAACAGGG + Intergenic
1196430612 X:115620862-115620884 TTTTGTATTTTTAGTGAAGACGG + Intronic
1196455716 X:115890167-115890189 TTTTAAATTTATAGTGATGAAGG - Intergenic
1196462556 X:115945219-115945241 TTTTGCATTTTTAGTGAAGATGG - Intergenic
1196610408 X:117707907-117707929 TTTTGTATTTTTAGTGAAGATGG + Intergenic
1196828920 X:119761127-119761149 TTTTGTATTTGTAGTAATGATGG + Intergenic
1197838291 X:130718457-130718479 TTCTACATTTTTTGTGATGAAGG - Intronic
1197930306 X:131687849-131687871 TTTTGAATTTTTAGTGGAGATGG + Intergenic
1198033043 X:132773887-132773909 TCCAGAATTAGTAGTGATGGTGG + Intronic
1198063938 X:133077047-133077069 TTGAGACTTTGTAGTGAAGAAGG - Intronic
1198240517 X:134780403-134780425 TTTTGTATTTGTAGTGGAGATGG - Intronic
1198526365 X:137505248-137505270 TTTTGTATTTGTAGTAAAGACGG + Intergenic
1198829344 X:140732031-140732053 TTTTGAATTTTTAGTGGAGACGG - Intergenic
1199360376 X:146910746-146910768 TTCTTAGTTAATAGTGATGATGG - Intergenic
1200319842 X:155176336-155176358 TTTTGTATTTTTAGTGAAGATGG + Intergenic
1200734950 Y:6784153-6784175 TTCTGAACTTTTAGTTCTGAGGG - Intergenic
1201849877 Y:18467394-18467416 TTTTGAATTTGTAGTAGAGATGG + Intergenic
1201883441 Y:18852981-18853003 TTTTGAATTTGTAGTAGAGATGG - Intergenic
1202084526 Y:21122217-21122239 TTTTGTATTTTTAGTGAAGATGG - Intergenic
1202301098 Y:23415241-23415263 TTCTGTATTTTTAGTAAAGATGG + Intergenic
1202569713 Y:26255357-26255379 TTCTGTATTTTTAGTAAAGATGG - Intergenic
1202585272 Y:26417433-26417455 TTCTGTATTTGTAGTAGAGAGGG - Intergenic