ID: 963158097

View in Genome Browser
Species Human (GRCh38)
Location 3:142120899-142120921
Sequence CTGCTTTACCAGCAGCTCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 280}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963158093_963158097 12 Left 963158093 3:142120864-142120886 CCCTTTTTGGCATCAGAATTCTA 0: 1
1: 0
2: 0
3: 29
4: 285
Right 963158097 3:142120899-142120921 CTGCTTTACCAGCAGCTCTGGGG 0: 1
1: 0
2: 0
3: 17
4: 280
963158094_963158097 11 Left 963158094 3:142120865-142120887 CCTTTTTGGCATCAGAATTCTAA 0: 1
1: 0
2: 1
3: 30
4: 268
Right 963158097 3:142120899-142120921 CTGCTTTACCAGCAGCTCTGGGG 0: 1
1: 0
2: 0
3: 17
4: 280
963158092_963158097 13 Left 963158092 3:142120863-142120885 CCCCTTTTTGGCATCAGAATTCT 0: 1
1: 0
2: 1
3: 22
4: 292
Right 963158097 3:142120899-142120921 CTGCTTTACCAGCAGCTCTGGGG 0: 1
1: 0
2: 0
3: 17
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963158097 Original CRISPR CTGCTTTACCAGCAGCTCTG GGG Intronic
900325000 1:2104390-2104412 CTTCTTCCCCTGCAGCTCTGGGG - Intronic
900612134 1:3548709-3548731 CAGCTGTGCCAGCAGCTGTGTGG - Intronic
901054904 1:6444515-6444537 CTGCTTAGCCTCCAGCTCTGCGG - Exonic
901795208 1:11675828-11675850 TTGCTTTGCCATCTGCTCTGGGG - Intronic
904023584 1:27488227-27488249 CTGATTAACCAAAAGCTCTGAGG + Intronic
904033860 1:27548989-27549011 CTCCTTCTTCAGCAGCTCTGAGG - Exonic
904331189 1:29758627-29758649 CTGCTTTCTAACCAGCTCTGGGG + Intergenic
905224155 1:36468187-36468209 GTGCTTTAGATGCAGCTCTGGGG + Exonic
906704333 1:47883888-47883910 CAACTTTACCAAAAGCTCTGAGG + Intronic
906839792 1:49124494-49124516 CTGCTTTACAAGCAACTTAGAGG + Intronic
906911533 1:49957264-49957286 CTGCTTTACCTCCAACTATGTGG + Intronic
907716826 1:56933909-56933931 GTGATTTTCCAGCAGCTCTTTGG + Intronic
909287598 1:73839260-73839282 CTGCTTTATCAGCAGCACCCTGG - Intergenic
911165356 1:94719951-94719973 CTTCTTTCCCTGCAGCCCTGTGG + Intergenic
912383414 1:109259777-109259799 CTCTTTTACCAGCAGCTGGGCGG - Intronic
913241514 1:116834262-116834284 CTGCATTTCCAGCCGCCCTGTGG - Intergenic
914229450 1:145752038-145752060 GTAGTGTACCAGCAGCTCTGAGG - Intronic
914461787 1:147891675-147891697 CTTCTCTAACAGCTGCTCTGTGG + Intergenic
914855559 1:151347645-151347667 CTTCTCTTCCGGCAGCTCTGAGG - Intergenic
916171039 1:162001991-162002013 CTCCTTGGGCAGCAGCTCTGTGG - Intronic
916556759 1:165900091-165900113 CTGCCTTTCCAGCTGCCCTGCGG + Intronic
916684215 1:167130063-167130085 TTGCTTTAACAGCAGCTATGTGG - Intergenic
917207653 1:172594685-172594707 GTGCTTTACCTCCAGCTATGTGG + Intronic
918197209 1:182233633-182233655 CTTTTATTCCAGCAGCTCTGGGG + Intergenic
919043327 1:192420698-192420720 CTGCTTTACCTGCAGCTCCCTGG - Intergenic
919488346 1:198172054-198172076 TTGTATTCCCAGCAGCTCTGTGG + Intronic
919737270 1:200960499-200960521 GTCCTTTTCCTGCAGCTCTGGGG + Intergenic
920340258 1:205271281-205271303 CAGCTCTACCAGCACATCTGGGG - Intronic
921900054 1:220440639-220440661 CTTATTTCCCAGCAGATCTGGGG + Intergenic
922019044 1:221685368-221685390 GTGCTTTACCAGGGGCTCTCGGG - Intergenic
922425547 1:225489313-225489335 TTGAATTACCAGCATCTCTGTGG - Exonic
922876772 1:228945975-228945997 CTTCTTAACAACCAGCTCTGGGG + Intergenic
923036353 1:230287654-230287676 CAGCTTTCCCGGCAGGTCTGTGG + Intergenic
923595988 1:235361221-235361243 ATGCTCTAGTAGCAGCTCTGCGG + Intergenic
923980076 1:239311628-239311650 CTGCACTACCAGCAGCTGAGGGG + Intergenic
1064323963 10:14331550-14331572 CTGCATTCCCAGCACTTCTGGGG + Intronic
1064578710 10:16771764-16771786 CTGCTTTAATAGCTGCTTTGGGG - Intronic
1066551345 10:36561218-36561240 GTGGTTTGCCAGGAGCTCTGGGG - Intergenic
1067069534 10:43121672-43121694 CTGCACTACCAGCAGGCCTGTGG + Intronic
1067328525 10:45292736-45292758 CTGCTTCCTCAGCAGCTCGGAGG + Intergenic
1067435211 10:46272290-46272312 CTGCTTTAACAGCAGCTGACAGG - Intergenic
1067672150 10:48333362-48333384 CTCCTCTACCAGCAGGTCTGTGG + Intronic
1067690899 10:48501446-48501468 CTGGTTTACCAGCATCTCAAGGG + Intronic
1067858386 10:49818048-49818070 CTGGTTTACCATCAGCTGTCAGG - Intergenic
1067917095 10:50411820-50411842 CTGCTTACCCAGCAACTCAGGGG + Intronic
1067971104 10:50971951-50971973 TAGCTTTTTCAGCAGCTCTGTGG - Intergenic
1069860357 10:71467362-71467384 CTGCTCAACCAGAAACTCTGAGG - Intronic
1070117763 10:73545244-73545266 CTACTGTATCAGAAGCTCTGGGG + Intronic
1070358197 10:75661081-75661103 CTGCTTTGCCAGCAGCCAGGCGG + Intronic
1072804806 10:98417618-98417640 CTGCTGCACCAGCAGGTCAGTGG + Exonic
1073062152 10:100739409-100739431 CTCCTCTCCCAGCAGCTGTGTGG - Intronic
1073738848 10:106383217-106383239 CTGCTTTATCAGAAGCTCCAGGG - Intergenic
1074708681 10:116158851-116158873 CAGCTCTGCCAGCAGCGCTGAGG + Intronic
1077058370 11:606886-606908 CTGCTTCAACAGCCACTCTGTGG - Intronic
1077120398 11:904852-904874 CTGCTTTCCCTGCAGCCCTCTGG - Intronic
1077910591 11:6568814-6568836 CTGCTACACCGGCAGCTCTATGG + Exonic
1078458080 11:11491210-11491232 CTGCCATTCCAGGAGCTCTGTGG + Intronic
1078564662 11:12404225-12404247 CTGCATTACCATCAGGTCTTAGG + Intronic
1079538675 11:21545889-21545911 CTTCTGAATCAGCAGCTCTGTGG + Intronic
1079554872 11:21746831-21746853 TTGCTTTCCCAGCAACTCTCAGG - Intergenic
1083061539 11:59877876-59877898 CTCCTTCATCAGCAGCCCTGAGG + Intergenic
1083684821 11:64369826-64369848 CTGCTGCGCCAGCAGCTCGGGGG - Exonic
1083974182 11:66103879-66103901 CTGCTTTATTATCAGCTCAGGGG + Intronic
1084028093 11:66465569-66465591 CTGCTTTGCCAACTGTTCTGGGG - Intronic
1085912648 11:80846638-80846660 CTGCTGCAGTAGCAGCTCTGTGG - Intergenic
1086947725 11:92859809-92859831 CTGCTTTAGGAGCATTTCTGAGG - Intronic
1088767890 11:113002194-113002216 CTCCTTTGCCAGTATCTCTGAGG - Intronic
1089352136 11:117827886-117827908 CTGCTTTTCCTGCACTTCTGGGG + Intronic
1090023970 11:123152028-123152050 TTGCTTTACCAGCAGATTCGAGG - Intronic
1091630706 12:2158584-2158606 CTGATTTACCCGCAGCCATGTGG + Intronic
1092522939 12:9292251-9292273 CTCCCCTACCTGCAGCTCTGTGG - Intergenic
1092544352 12:9439646-9439668 CTCCCCTACCTGCAGCTCTGTGG + Intergenic
1098159850 12:67639501-67639523 CTGGTTTACTGGCAGCCCTGGGG - Intergenic
1101007436 12:100414903-100414925 CTGCAGCAGCAGCAGCTCTGGGG - Intronic
1101192633 12:102351011-102351033 CTGATTTGCCAGGGGCTCTGAGG - Intergenic
1101799097 12:108005002-108005024 CTGCTATACCCAAAGCTCTGTGG - Intergenic
1103084657 12:118053097-118053119 CAGCTTTAGCAGCATCTCTAGGG - Intronic
1103427849 12:120853702-120853724 CTGCTGAACCAGAAACTCTGGGG - Intronic
1104046648 12:125167960-125167982 CTCTTCTACCAGCAGCTCTCAGG - Intergenic
1104122720 12:125814563-125814585 TTGCTCCACCAGCAGCACTGAGG - Intergenic
1104952887 12:132450391-132450413 CTTTTCTGCCAGCAGCTCTGCGG + Intergenic
1105248305 13:18673001-18673023 CTGCTGAATCAGAAGCTCTGGGG + Intergenic
1105513738 13:21073036-21073058 CTGAATTCCCAGGAGCTCTGTGG + Intergenic
1105736945 13:23281400-23281422 CTGCTGAATCAGAAGCTCTGGGG - Intronic
1107826074 13:44330231-44330253 CAGTTCTACCAGCAGCTCTAGGG - Intergenic
1110371371 13:74744239-74744261 ATACTTTACCACCTGCTCTGGGG - Intergenic
1110585415 13:77185363-77185385 CTGCTTTTCCTGTAGCTTTGAGG + Exonic
1111177771 13:84619135-84619157 CTGCTAAACTAGAAGCTCTGGGG - Intergenic
1112524718 13:100133956-100133978 CTGGTTTGCCAGGGGCTCTGAGG + Intronic
1113636799 13:111925053-111925075 CTCCTGAATCAGCAGCTCTGGGG - Intergenic
1113817459 13:113183840-113183862 CTGTTTAAACAGGAGCTCTGTGG + Intronic
1114628035 14:24141916-24141938 CTGCTTTGCCCGCAGCGCTCCGG - Intergenic
1116195825 14:41723566-41723588 CTGCTGCACCAGGATCTCTGGGG + Intronic
1116531136 14:45975562-45975584 GTGATTTGCCAGCAGCTCTCGGG - Intergenic
1120116043 14:80618827-80618849 CTGCTGGACCAGAATCTCTGGGG - Intronic
1120655910 14:87189705-87189727 GTGGTTTGCCAGCAGCTCTTGGG + Intergenic
1122601171 14:102922710-102922732 CTGCTGTGGCTGCAGCTCTGCGG + Exonic
1122690633 14:103530635-103530657 CTGCTTCACCATCAGCACGGAGG - Intronic
1124153132 15:27200137-27200159 ATTGTTTACCAGCTGCTCTGTGG + Intronic
1124658212 15:31525426-31525448 CTGCTGCAGCTGCAGCTCTGTGG + Intronic
1124866469 15:33496976-33496998 TTCCTGTACCAGCTGCTCTGGGG - Intronic
1127938883 15:63672587-63672609 CTCCTTTATGAGCAGCTCTCTGG - Exonic
1128266560 15:66272195-66272217 CTATCTTAACAGCAGCTCTGTGG - Intergenic
1128318484 15:66676400-66676422 CTGCTTCACCAGGAGCTCCTTGG - Intronic
1129371531 15:75098903-75098925 CTGCCCTTGCAGCAGCTCTGAGG - Intronic
1130139913 15:81216355-81216377 CTGCTTTCCCAGGAGCTGTTTGG + Intronic
1130387482 15:83424278-83424300 CTGATTTTCCTTCAGCTCTGTGG + Intergenic
1131719243 15:95149121-95149143 CTGCTTTGCCGGGAGCTCTCTGG - Intergenic
1132148936 15:99446248-99446270 CAGCTTTACCAGCTGGTCTGGGG - Intergenic
1135094642 16:19555168-19555190 CTGCTTTACCCACTGCTTTGCGG - Intergenic
1135175351 16:20222787-20222809 CAGCTTTATCAACATCTCTGTGG + Intergenic
1135948543 16:26889023-26889045 CTGCTTTTTCTGCAGCTCTTGGG - Intergenic
1138705704 16:58912890-58912912 CTGCCTTATGAGGAGCTCTGTGG + Intergenic
1139095261 16:63697533-63697555 CTCCTTTGCCAGAAGCACTGAGG + Intergenic
1142314091 16:89332445-89332467 CACCTGTACCCGCAGCTCTGGGG + Intronic
1146366107 17:32229512-32229534 CTGCTTGGCCCTCAGCTCTGTGG + Intronic
1146491741 17:33288281-33288303 CTGCTCAACAGGCAGCTCTGGGG - Intronic
1147426759 17:40349486-40349508 CTGACTCACCAGCAGCCCTGAGG + Intronic
1148909457 17:50932904-50932926 CTGCTTCTCCAGCAACTGTGCGG - Intergenic
1149544005 17:57489579-57489601 CAGCTTTCCCAGAACCTCTGTGG + Intronic
1151747582 17:76019531-76019553 CAGCTGTTGCAGCAGCTCTGTGG + Exonic
1154440547 18:14386109-14386131 CTGCTGAATCAGAAGCTCTGGGG - Intergenic
1154493834 18:14941503-14941525 CTGCTTTCCGACCAGCCCTGGGG - Intergenic
1156211946 18:34953823-34953845 CTCCTTTCTAAGCAGCTCTGTGG + Intergenic
1158686722 18:59621376-59621398 CTGCCTGACCACCTGCTCTGGGG + Intronic
1159801066 18:72899732-72899754 CTGCTTTACCATCTTCTCTCTGG + Intergenic
1162763112 19:12900228-12900250 CTGTTGTATGAGCAGCTCTGTGG - Intronic
1163141857 19:15355110-15355132 CTGCTCTTCCAGCAGCTGTTCGG + Exonic
1164504369 19:28847015-28847037 AGGCTTTTTCAGCAGCTCTGAGG + Intergenic
1164616215 19:29668230-29668252 CCCCTCTACCAGCAGCCCTGGGG + Intronic
1164670620 19:30070168-30070190 AGGCTTTTCCTGCAGCTCTGAGG - Intergenic
1165115265 19:33524576-33524598 CTGGTCTACCAGAGGCTCTGTGG + Intergenic
1165943766 19:39428956-39428978 CTGATTTAGCTGTAGCTCTGAGG - Intergenic
1166761659 19:45228060-45228082 GTGCTCTTCCAGCAGCTGTGAGG + Exonic
1167062872 19:47161493-47161515 CAAATGTACCAGCAGCTCTGGGG - Intronic
1167116246 19:47490901-47490923 CTGCTAGGCCAGTAGCTCTGAGG - Intronic
925686894 2:6482080-6482102 CTGCTTTACAAGCTGCTATCAGG + Intergenic
925844859 2:8026129-8026151 CTGCTTCCACAGCAGGTCTGTGG + Intergenic
925975592 2:9139924-9139946 CTGCTTGGCCACCAGCACTGAGG + Intergenic
927527076 2:23754513-23754535 CTTTTTTACTAGGAGCTCTGAGG + Intronic
927847918 2:26480804-26480826 CTGCTCCACCTGCACCTCTGTGG + Exonic
928438544 2:31272299-31272321 CAGCTGTAACAGCAGCTCTCTGG + Intergenic
928491955 2:31793575-31793597 CTACTGAGCCAGCAGCTCTGGGG - Intergenic
928578634 2:32682568-32682590 CTGCTCTAGCAGCAGCTTGGTGG + Intronic
928804973 2:35140126-35140148 CTGCATTACCTCCATCTCTGTGG - Intergenic
930235834 2:48888347-48888369 CTGCTTTTCCAGCAGAATTGGGG + Intergenic
931867766 2:66430981-66431003 CGACTTTACCAGCAGCTCAGAGG + Intergenic
932048208 2:68371408-68371430 CTGGTTTACCTGCAGCTTTGAGG + Intronic
932621270 2:73265975-73265997 CTCCTTTACCTCCTGCTCTGGGG - Intronic
933981383 2:87553650-87553672 CTGCTTTACCTGCGGTACTGGGG - Intergenic
935584085 2:104784998-104785020 CTGCCTTTCCAACAGCTCTCAGG - Intergenic
936312447 2:111397152-111397174 CTGCTTTACCTGCAGTACTGGGG + Intergenic
939241531 2:139566882-139566904 CTTCTTTACCCTCAGCTCTAGGG - Intergenic
940042648 2:149376785-149376807 GAGCTTTACCAGCAGTTCTGAGG - Intronic
940856525 2:158732535-158732557 CTGCTGAAGCAGCATCTCTGGGG - Intergenic
941267234 2:163377713-163377735 CTGCTTTACTAAGAACTCTGGGG + Intergenic
945234808 2:207624733-207624755 CTGCTTTCCGCGCTGCTCTGGGG - Intronic
945367070 2:208967408-208967430 CTCATTTACCAACAGATCTGAGG - Intergenic
945571425 2:211472835-211472857 CTACTGAACCAGGAGCTCTGAGG - Intronic
946708403 2:222482090-222482112 CTACTTCACCAGCAGCTTTGAGG + Intronic
947495733 2:230635144-230635166 CTGTATTCCCAGCTGCTCTGAGG + Intergenic
948173746 2:235927363-235927385 CTGCTGCACCAGCATCTCAGTGG + Intronic
1169193593 20:3672139-3672161 CAGCAGTGCCAGCAGCTCTGGGG - Exonic
1169212568 20:3775610-3775632 CTGCCTTAGCAGTAGCACTGTGG + Intergenic
1169998921 20:11593078-11593100 CTGCTTTACTAGCAGGACAGTGG - Intergenic
1170451275 20:16486807-16486829 CTTCCTTACCAGCAACTCTTTGG - Intronic
1172385160 20:34529061-34529083 AGGATTTACCAGCAGCCCTGTGG + Intronic
1173852390 20:46227395-46227417 CTTCTGTCCCAGAAGCTCTGAGG - Intronic
1175321805 20:58093403-58093425 CTGCTGGATCAGAAGCTCTGGGG - Intergenic
1176455496 21:6905058-6905080 CTGCTGAATCAGAAGCTCTGGGG + Intergenic
1176833668 21:13770106-13770128 CTGCTGAATCAGAAGCTCTGGGG + Intergenic
1177057837 21:16331015-16331037 CTGCATTTCTAGCAGCTCTTAGG + Intergenic
1177581093 21:23022290-23022312 GTGATTTGCCAGCAGCTCTTGGG + Intergenic
1178419618 21:32433208-32433230 CTTGTTTGCCAGCAGCTCAGGGG - Intronic
1178666733 21:34554395-34554417 CAGATGTATCAGCAGCTCTGTGG - Intronic
1179537920 21:42064101-42064123 CTGATTCACCAGCAGCCTTGGGG - Intronic
1179543478 21:42099549-42099571 CCGCTTACCCAGCAGCACTGAGG + Intronic
1180212099 21:46301262-46301284 CTGTTATCTCAGCAGCTCTGGGG - Exonic
1181164064 22:20974106-20974128 CTGCTTCAACATCAGCACTGGGG + Exonic
1182294061 22:29302837-29302859 CAGCAGTACCAGCAGCTGTGGGG + Intergenic
1183393237 22:37557650-37557672 CTCCTTTACCAGCCGCTCTAGGG + Intergenic
1183456915 22:37927807-37927829 CACCTTTACCTGCAGCTGTGGGG - Exonic
1183936291 22:41264339-41264361 AGGCTCTACCAGCTGCTCTGCGG + Intronic
1185334978 22:50267378-50267400 CTGGTTTACCAGCTGCTGCGCGG - Exonic
1203292712 22_KI270736v1_random:10776-10798 CAGCTTTCCCAGTAGCTCTAAGG - Intergenic
949555031 3:5145425-5145447 CTCCTCTACCAGCAGGGCTGTGG + Intronic
949855483 3:8457498-8457520 ATGCCTGACCCGCAGCTCTGTGG + Intergenic
952362126 3:32641348-32641370 CTGCTTTACCAATAGAACTGTGG + Intergenic
952867626 3:37864476-37864498 ATTCTTTACCTGCAGCCCTGGGG + Intronic
953636305 3:44668116-44668138 CTGCTTTCCTTGCAGCTCTCTGG + Intergenic
954189395 3:48946218-48946240 CTGCTTCACAAGCAGGACTGAGG - Intronic
956169079 3:66418770-66418792 CCTCTTTCCCAGAAGCTCTGGGG + Intronic
956602579 3:71038065-71038087 CTGCAGTAGCAGCAGCTCTGGGG - Intronic
956869452 3:73402444-73402466 CTGCCTTTCCATCAGCTCAGTGG + Intronic
960051434 3:113242441-113242463 GTGTTTTAGCAGAAGCTCTGTGG + Intronic
960486273 3:118256665-118256687 CTGCATTACTAGCACCACTGTGG + Intergenic
961135749 3:124509329-124509351 CTGTAATCCCAGCAGCTCTGGGG - Intronic
961726662 3:128935181-128935203 CTGCTGCAGCAGCAGCTCCGTGG + Exonic
962014385 3:131425199-131425221 ATGCTTAACAACCAGCTCTGGGG + Intergenic
962241535 3:133754817-133754839 CTGCTGCACCAGCAGCACTTGGG + Intronic
963158097 3:142120899-142120921 CTGCTTTACCAGCAGCTCTGGGG + Intronic
963272678 3:143301368-143301390 CTGATTTCTCTGCAGCTCTGGGG - Intronic
965711260 3:171558597-171558619 CTGCTGTTCCAGGTGCTCTGTGG + Intergenic
968032564 3:195513214-195513236 CTGCTTGAGCAGCAGGTCTTTGG + Intergenic
968669509 4:1841488-1841510 CTTCTTCACCACCACCTCTGCGG + Exonic
969327317 4:6451526-6451548 CTGCTTTGCCAGCTTCTCTCGGG + Intronic
969456194 4:7301045-7301067 CTGGTTTAGCAGCATCTCCGTGG + Intronic
969513975 4:7636300-7636322 CTGCCTCACCCGCATCTCTGCGG + Intronic
969820428 4:9716097-9716119 CTTGTTTGCCAGCAGCTCAGGGG - Intergenic
970513185 4:16801107-16801129 CTGTTTTACCACCAGGTCTTTGG + Intronic
972140338 4:35951160-35951182 CTCCTTGACAAGAAGCTCTGTGG + Intronic
972784916 4:42317887-42317909 CTGGTTTACCAGAAGTTCTAGGG - Intergenic
972891945 4:43568129-43568151 GTGCTTTACCAGGAGCTCTTGGG - Intergenic
973977821 4:56280748-56280770 TTCCTTTTCCAGCAGGTCTGAGG - Intronic
978111693 4:104972141-104972163 CTGCTCCAACAGCAACTCTGAGG + Intergenic
978257828 4:106713783-106713805 CTGCTTTACTTCCAACTCTGTGG + Intergenic
978546819 4:109879431-109879453 CTGGTTCACCAGCTGCACTGAGG - Intergenic
979337879 4:119484524-119484546 CTGCTTTACCTGCATCCCAGAGG - Intergenic
985561770 5:591111-591133 CTGCTTTGCCAGCATCTTTGTGG + Intergenic
985635334 5:1033114-1033136 CTGCTGCACCCCCAGCTCTGAGG + Intronic
986445767 5:7819916-7819938 CTGCTTGGTCAGCAGCTCTGGGG - Intronic
986716136 5:10524912-10524934 CTGCTTAACCACCAGCAATGAGG - Intergenic
987288762 5:16487987-16488009 CTGTTTAAGCAGCAGCTGTGTGG + Intronic
988194012 5:27977634-27977656 CTGCTTTAGCTGCATCTCAGAGG + Intergenic
993739058 5:91514567-91514589 CTGCTCTCTCAGCAGCTGTGCGG + Intergenic
994132511 5:96246486-96246508 TTTCTTAACAAGCAGCTCTGAGG + Intergenic
996430044 5:123364530-123364552 CTGCATTACAAGCAGCAGTGGGG - Exonic
996654952 5:125924716-125924738 CTTCTCTACCAGCAGGGCTGTGG - Intergenic
997064549 5:130546106-130546128 CTCCTCTACCAGCAGGGCTGTGG + Intergenic
997505884 5:134416497-134416519 ATGCATTACCAGTAGCACTGTGG - Intergenic
998812431 5:145979524-145979546 ATGTTTAACAAGCAGCTCTGTGG + Intronic
1001083963 5:168686970-168686992 CTGCCTTACCTGAAGCCCTGGGG + Exonic
1002587657 5:180261721-180261743 CTTCTTTACCAGATGCTTTGTGG - Exonic
1003236054 6:4295918-4295940 CTGCTGAACCAGAAACTCTGGGG + Intergenic
1003911359 6:10747154-10747176 CTGATTTCCACGCAGCTCTGTGG - Intergenic
1004111149 6:12720296-12720318 CTGTTTTGCCAACAGCTATGCGG - Intronic
1004187868 6:13436987-13437009 CTGCTTTCCCAGAGCCTCTGAGG - Intronic
1006828382 6:36953803-36953825 CTGATGCACCAGGAGCTCTGAGG - Intronic
1009301538 6:62030142-62030164 CTGCTTTAACATCAGATGTGAGG + Intronic
1010475852 6:76286496-76286518 CAGCTTCACCAGCAGCTATAAGG - Intergenic
1012528225 6:100202864-100202886 CTGCTTTATCATCTACTCTGTGG + Intergenic
1012652720 6:101777082-101777104 GTTCTTTACCAGCAGCTGCGTGG - Intronic
1012684978 6:102235200-102235222 CTTCTTCATCAGCAGCTCTTCGG - Intergenic
1014720558 6:124912498-124912520 CTGCTTTAACAGAAGCTGGGAGG - Intergenic
1015529295 6:134205080-134205102 GTGCTTGACCAGCAGCCCTCAGG - Intronic
1015771294 6:136771113-136771135 ATGCTTAACCTACAGCTCTGAGG + Intronic
1016694945 6:146982284-146982306 CTGCTTTAACAGCATCACAGGGG + Intergenic
1016984837 6:149887347-149887369 CCCCTTTGCCTGCAGCTCTGTGG + Intronic
1017581350 6:155867928-155867950 CTGCTTTATCAGCACGTCAGTGG + Intergenic
1019480607 7:1265009-1265031 CTGCTGCACGATCAGCTCTGAGG - Intergenic
1022769643 7:33455245-33455267 CTACAGTACCAACAGCTCTGAGG - Intronic
1022888680 7:34673891-34673913 CTGCTTTACCATGAACTATGGGG - Intronic
1024270901 7:47640683-47640705 TTGCTTTATCAACAGCTCTGAGG - Intergenic
1024653397 7:51428381-51428403 CTGCTTTTCCAGGATTTCTGTGG + Intergenic
1026051487 7:66950866-66950888 GTGTTTTACCAGCTGCTGTGGGG + Intronic
1026454433 7:70558373-70558395 CTTCCTTACTAGCAGCTGTGGGG + Intronic
1029577479 7:101412914-101412936 CTGCTTCAGCAGCATCTCTTAGG + Intronic
1030856700 7:114566454-114566476 CTTTTTTACAACCAGCTCTGTGG - Intronic
1032914216 7:136469593-136469615 CTGCTTTAGCTGCATCTCAGAGG + Intergenic
1033822698 7:145153045-145153067 CTGCGTTTCCATCAGATCTGGGG - Intergenic
1034946703 7:155267029-155267051 TTTCTTTCCCAGCAGCTCTCTGG - Intergenic
1035126027 7:156608037-156608059 CTGCCTTTCCAGCAAGTCTGGGG - Intergenic
1036615428 8:10383942-10383964 CTGCTTTCCCAGGGGCTCAGAGG + Intronic
1037003570 8:13749415-13749437 TTGGTTTACCTACAGCTCTGAGG - Intergenic
1037987242 8:23297786-23297808 GTGCTGCTCCAGCAGCTCTGTGG + Exonic
1037997545 8:23364298-23364320 CGGCTTTCCTGGCAGCTCTGAGG - Intronic
1038934111 8:32229461-32229483 CTGCTTTAGCACCAGCAGTGTGG + Intronic
1039969472 8:42308902-42308924 CTGCTGCTCCAGTAGCTCTGGGG - Exonic
1041184327 8:55283354-55283376 CTCCGTCACCAGCTGCTCTGTGG + Intronic
1043428078 8:80168719-80168741 CTGCCTTATCAGCAACTCTCTGG + Intronic
1043476998 8:80615063-80615085 CCTCTCTGCCAGCAGCTCTGTGG + Intergenic
1044458508 8:92416809-92416831 GTGGTTTGCCAGCAGCTCTCGGG + Intergenic
1045261150 8:100575640-100575662 CTACTGGATCAGCAGCTCTGGGG - Intronic
1045288737 8:100813611-100813633 CTCCTTGACCATCACCTCTGGGG + Intergenic
1045969315 8:108061771-108061793 GTGCTTTACCTGCAACTATGTGG - Intronic
1046604628 8:116357416-116357438 CTACTGAACCAGAAGCTCTGGGG - Intergenic
1046941264 8:119933715-119933737 CTGCTGTCTCAGCAGCTCTGAGG + Intronic
1047661150 8:127038389-127038411 CTGCTTTTCAGGCAGATCTGTGG - Intergenic
1048362830 8:133712891-133712913 CTGCTTAATCAGAAACTCTGGGG - Intergenic
1049277419 8:141726748-141726770 CAGCTCTACCAGCCGCTCCGCGG + Intergenic
1049341594 8:142115348-142115370 CTGCCTTCCCTGCAGCTCTCTGG + Intergenic
1049570270 8:143367040-143367062 CCCCTTCGCCAGCAGCTCTGTGG - Intergenic
1053203920 9:36170840-36170862 CTGCTTTGACACCAGCACTGGGG + Exonic
1053458919 9:38253322-38253344 ATACTTTACCAGCAACCCTGTGG - Intergenic
1057138268 9:92710424-92710446 CTGCTTTAGTAGCAGCTGTTGGG - Intergenic
1057261715 9:93588171-93588193 GTGCTTGACCAGATGCTCTGGGG + Intronic
1058923787 9:109641895-109641917 CTGCTTTAGCAGCCTTTCTGAGG - Intronic
1058939499 9:109799875-109799897 CTGGTTTTCCATCAGCTCTAAGG - Intronic
1061211463 9:129195845-129195867 CTGCTTCACCTCCAGCTCTCAGG + Intergenic
1061324109 9:129852413-129852435 CTGCGTTACCAGCTGGTTTGTGG + Intronic
1185672760 X:1825450-1825472 CAGCTTCACCACCAGCACTGGGG + Intergenic
1190101871 X:47528118-47528140 CTCCTTTGCCACCAGGTCTGGGG + Intergenic
1191592608 X:62904590-62904612 CTGCTTTACTTCCAGCTATGTGG + Intergenic
1198095591 X:133376940-133376962 CTGCTTGTCCAGTTGCTCTGAGG - Intronic
1199265871 X:145824641-145824663 CTGCTTTTCTAGCAGCTCAGTGG - Exonic
1199665628 X:150094420-150094442 CTGCTTTACCAAAAACTGTGGGG - Intergenic
1199743297 X:150756157-150756179 CTACTTTACCTGCAGATATGGGG + Intronic
1200229980 X:154439000-154439022 CATCTTTACCAGCTGCCCTGTGG - Exonic