ID: 963161540

View in Genome Browser
Species Human (GRCh38)
Location 3:142155777-142155799
Sequence CTCTGGGACAAGCATCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963161535_963161540 30 Left 963161535 3:142155724-142155746 CCACAGCAGAGGGCAGTTTTGTC No data
Right 963161540 3:142155777-142155799 CTCTGGGACAAGCATCAGAGAGG No data
963161536_963161540 8 Left 963161536 3:142155746-142155768 CCAACGATCAAACATCATGATAA No data
Right 963161540 3:142155777-142155799 CTCTGGGACAAGCATCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963161540 Original CRISPR CTCTGGGACAAGCATCAGAG AGG Intergenic
No off target data available for this crispr