ID: 963162850

View in Genome Browser
Species Human (GRCh38)
Location 3:142169593-142169615
Sequence ACTTCAGTGGGATCTTATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 187}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963162850 Original CRISPR ACTTCAGTGGGATCTTATGG TGG (reversed) Intronic
901848383 1:11999230-11999252 TCTTCTGTGGTATCTTCTGGTGG + Intronic
903311383 1:22459983-22460005 ACTTCTCTAGGATCTTCTGGAGG - Intronic
903989380 1:27255232-27255254 AATTTAGTGGGCTCTTTTGGTGG + Intronic
905611170 1:39353070-39353092 ACTTCAGTAGGATCATCTGGTGG + Exonic
908588161 1:65597257-65597279 ACTGCAATGGGGTCTTGTGGTGG - Intronic
909024893 1:70470176-70470198 ACTTCAGTGTGATTTTGAGGTGG - Intergenic
910244552 1:85124523-85124545 ACTTCACTGGCATTTTTTGGGGG + Intronic
912866644 1:113263517-113263539 ATTACAGTGGGATCTTATTTGGG + Intergenic
913922655 1:124851865-124851887 ATTTCAGTGGGATCTGCAGGCGG + Intergenic
915859967 1:159433598-159433620 ACTTCAGCCTGATCTAATGGAGG - Intergenic
917500209 1:175578827-175578849 ACTTCTGTGGGTTCTGATGCTGG + Intronic
920853334 1:209644103-209644125 ACTGCGGTGGGTTCTAATGGAGG - Intronic
921777135 1:219114043-219114065 ACTTCAGTGTGCTTTTATAGTGG - Intergenic
922399417 1:225237223-225237245 ACTTCAGTGCATTTTTATGGAGG + Intronic
923855502 1:237840913-237840935 ACTTCAGTGTGTTTTTGTGGTGG - Intergenic
924788774 1:247223778-247223800 ACTTCAGTGTGCTTTTGTGGTGG - Intergenic
1063024885 10:2168174-2168196 GCTGCTGTGGGATCTGATGGTGG - Intergenic
1064370689 10:14749737-14749759 ACTTCAGCGGGATGGTAGGGAGG - Intronic
1064777659 10:18796847-18796869 ACTTCAGTGTGTTTTTGTGGTGG - Intergenic
1068568552 10:58603441-58603463 AATTCAGTGGGATCTGTGGGTGG + Intronic
1069473537 10:68713767-68713789 ACTACAGTGGGATTTTACAGTGG + Intergenic
1069937983 10:71932159-71932181 ACTTAAGTGGTTTCTTAAGGTGG - Intergenic
1077807063 11:5601095-5601117 ACTTCAGCAGGATCCTAAGGGGG - Intronic
1078328968 11:10403070-10403092 TCTTGTGTGGGATCTAATGGGGG + Intronic
1079093022 11:17494004-17494026 ACTCCAGTGGGGTCTTATTAGGG + Intronic
1079382136 11:19947572-19947594 ACTTCAGTGGTTTCTTCTGCAGG + Intronic
1079388975 11:20004525-20004547 ACTGCAGTGGGCTCTGATGCTGG + Intronic
1081165883 11:39808661-39808683 TCCTCAGTGGGATCTGCTGGTGG - Intergenic
1081759221 11:45565345-45565367 CCGTCAGTGGGATCTTCAGGAGG + Intergenic
1083050415 11:59771505-59771527 AGTGCAGTGGGAGCTTAGGGAGG + Intronic
1087762612 11:102117638-102117660 AGGTCAGTGAGATCTTGTGGAGG + Intronic
1087824490 11:102749487-102749509 AATTCAGTCAGCTCTTATGGAGG - Intergenic
1088337358 11:108720945-108720967 TCTTCAGTGGGCTCTTACTGTGG + Intronic
1089027352 11:115285390-115285412 ACTTCATTGGGATTTTATTGAGG - Intronic
1090574285 11:128084471-128084493 ACTTAAGTGTGTTTTTATGGTGG + Intergenic
1095530842 12:43184368-43184390 TCTTCAATGGGATGTTATTGAGG - Intergenic
1095890488 12:47231141-47231163 TCTTAAGTGGGATCTTCGGGTGG + Intronic
1098956636 12:76695558-76695580 ACTTCAGTGGGGCCAGATGGAGG + Intergenic
1102530709 12:113544464-113544486 ACTTCAGTTGGATCTGCTGCTGG + Intergenic
1106081469 13:26503948-26503970 ACTGGAGTGGGAGCTTCTGGAGG + Intergenic
1107389335 13:39946854-39946876 ACTTCAGTGTGTTTTTGTGGTGG - Intergenic
1109666856 13:65551546-65551568 ACTTCAGTGTGTTTTTATAGTGG + Intergenic
1110447723 13:75605720-75605742 ACTTCTATGGCATCCTATGGAGG - Exonic
1114187771 14:20416063-20416085 ACTACAGTGGGAGCATATTGAGG + Intergenic
1117094394 14:52282587-52282609 AACTCAATTGGATCTTATGGGGG - Intergenic
1118965570 14:70580991-70581013 TGTTCAGTGGTATCTTTTGGGGG - Intergenic
1120638081 14:86975858-86975880 ACTTCAGTGTGTTTTTATAGTGG - Intergenic
1122224740 14:100267955-100267977 AGTTGAGTGGGATTTTCTGGAGG + Intronic
1124662125 15:31558348-31558370 TCTTCATTGGGATGTTAGGGTGG + Intronic
1125274381 15:37975831-37975853 ACTTCAGTGTGTTTTTGTGGCGG + Intergenic
1127352685 15:58168822-58168844 AACTCAGTGGGAGCTTATAGGGG - Intronic
1129559942 15:76555266-76555288 ACTTAAGTGTGTTTTTATGGTGG - Intronic
1129583169 15:76833410-76833432 GTGTCAGTGGGCTCTTATGGTGG - Intronic
1129782972 15:78286706-78286728 ACCTCAGTTAGGTCTTATGGTGG - Intronic
1129954449 15:79622388-79622410 ACTTCAGTGGGTTTTTGTAGTGG + Intergenic
1130634947 15:85609347-85609369 TTATCAGTGAGATCTTATGGTGG + Intronic
1132058172 15:98668248-98668270 CCTTCAGTGGTATCTGAAGGTGG - Intronic
1132253287 15:100350378-100350400 ACTCCAGTGGCATCTTCTGCGGG + Intergenic
1135082331 16:19446822-19446844 ACTTCTCTGGGATCTTTTGTAGG + Intronic
1135723270 16:24834707-24834729 ACTGCAGTGTGATCTTAGGCTGG + Intergenic
1138286162 16:55811886-55811908 ACTTCAGTGGGTTCTTCCTGCGG + Intronic
1143260734 17:5596500-5596522 GCTTCTGTTGGTTCTTATGGAGG + Intronic
1143692949 17:8586167-8586189 GCTTCAGTGGGAAAGTATGGAGG - Intronic
1146455904 17:33009496-33009518 GATTCATTGGGATCTTATGGAGG + Intergenic
1147916676 17:43891775-43891797 ACTTCAGTTATTTCTTATGGAGG - Intronic
1150590815 17:66560599-66560621 AATTCAGTGTGATCAGATGGAGG - Intronic
1151108299 17:71644819-71644841 ACTTCAGTGTGTTTTTGTGGTGG - Intergenic
1151863026 17:76780060-76780082 ATTTAAGTGAGCTCTTATGGAGG - Intronic
1156359232 18:36369393-36369415 AATTTAAAGGGATCTTATGGTGG + Intronic
1156894277 18:42227497-42227519 ACTTCAGTGGGATTTTTTTCTGG + Intergenic
1158141102 18:54256788-54256810 ACTTCACTGTGATCCAATGGGGG - Intergenic
1159507493 18:69356081-69356103 ACTGCAATGGGATCTTTTAGTGG - Intergenic
1161171089 19:2812844-2812866 ATTTCAGTGGGGGCTGATGGCGG + Intronic
1164232268 19:23300724-23300746 ACTTCAGTGTGTTTTTGTGGTGG + Intergenic
1167007827 19:46787167-46787189 ACATAAGTGGGGTCTTATAGAGG - Intronic
926072150 2:9905582-9905604 ACCTCAGTGGAATCTGCTGGTGG + Intronic
929452353 2:42046522-42046544 ACCTCAGTGGGATCATAGGCTGG + Intergenic
933311283 2:80664715-80664737 ATTTCAGTGGGTTGTGATGGTGG + Intergenic
934148372 2:89118645-89118667 ACTTCAGTGTGTTTTTATAGTGG - Intergenic
934218916 2:90063368-90063390 ACTTCAGTGTGTTTTTATAGTGG + Intergenic
934777339 2:96947839-96947861 TCTTCTGTGGGATCTCATTGTGG - Exonic
935736310 2:106109179-106109201 ACTGCAGTGGGATTTTTCGGGGG - Intronic
935871596 2:107456451-107456473 ACTTAAGTGTGTTTTTATGGTGG - Intergenic
936171729 2:110182676-110182698 ACTTCAGTGTGTTTTTATAGTGG - Intronic
939398564 2:141662214-141662236 ACTTCAGTGTGTTTTTATAGTGG - Intronic
940505737 2:154550576-154550598 ATTTCAGTGTCATCTTTTGGGGG + Intergenic
941412774 2:165180496-165180518 ATTTGATTGGGGTCTTATGGTGG + Intronic
942581889 2:177428429-177428451 ACTTCAGTGTGTTTTTATAGTGG + Intronic
944436753 2:199697663-199697685 ACTTAAGTGTGTTTTTATGGTGG - Intergenic
946939165 2:224753230-224753252 AATTCAGTTGCATCTTCTGGAGG - Intergenic
1171020337 20:21578831-21578853 CCTTCAGTGGGATATTATAAGGG + Intergenic
1173000884 20:39104930-39104952 TCTCCTGTGAGATCTTATGGGGG + Intergenic
1173149593 20:40554767-40554789 ACTTCAGTGGGTTTTGATAGTGG - Intergenic
1175939356 20:62530867-62530889 ACTTCAGTGGGATGTGTTTGCGG + Intergenic
1180583256 22:16861194-16861216 ACTTAAGTGTGTTTTTATGGTGG - Intergenic
1182572420 22:31249031-31249053 AGGTCAGTGGCATCTTTTGGAGG - Intronic
949900824 3:8813468-8813490 ACACCAGTGGGCTCTGATGGGGG + Intronic
949966767 3:9363233-9363255 ACTTCAGGCGGATCTCGTGGCGG + Exonic
950626634 3:14252314-14252336 ACTTCTGTGGGCTCCTTTGGGGG + Intergenic
957445480 3:80309420-80309442 ACTTCAGTGGGGCCGGATGGAGG - Intergenic
957689914 3:83554354-83554376 ACTTCAGTGTGCTCTTGTAGTGG + Intergenic
957896912 3:86432953-86432975 ACTTCAGGGGGTACATATGGAGG - Intergenic
959894378 3:111589947-111589969 ACTTCAGAGGGTTCTTAGGAAGG + Intronic
960679895 3:120237116-120237138 ACTTCAGTGTGTTTTTGTGGTGG + Intronic
963162850 3:142169593-142169615 ACTTCAGTGGGATCTTATGGTGG - Intronic
963246263 3:143066407-143066429 AGTTCAGTGGAAGCCTATGGAGG + Intergenic
964223264 3:154369531-154369553 ACTTCGGTGGGACCGGATGGAGG - Intronic
966548592 3:181179781-181179803 TCTTCAGTGGGACGTTAAGGAGG + Intergenic
967750265 3:193106279-193106301 ACTTCAGTGTGTTTTTATAGTGG + Intergenic
968696375 4:2031451-2031473 ACTTCAGTGTGTTTTTATAGTGG + Intronic
968838338 4:2981684-2981706 ACTGGAGTGAGAACTTATGGTGG - Intronic
969499546 4:7544424-7544446 ACCTTAGTGGGAGCATATGGAGG + Intronic
970138914 4:12958479-12958501 ACTTCAGTTGGAAATTTTGGGGG - Intergenic
970236586 4:13964961-13964983 TTTTCAGTGGGATGTCATGGTGG + Intergenic
970293703 4:14604890-14604912 ATTTCATTTGGATCTTATTGAGG + Intergenic
971998878 4:34003039-34003061 ACTTAACTGGAATATTATGGAGG + Intergenic
972351141 4:38236940-38236962 ACTGCAGGGGGTTCTGATGGTGG + Intergenic
974094663 4:57350602-57350624 ACTTAAGTGTGTTTTTATGGTGG + Intergenic
980685139 4:136218286-136218308 ACTTAAGTGTGTTTTTATGGTGG + Intergenic
980737665 4:136912327-136912349 TCTTCAGTGGGATCTTTGGCTGG - Intergenic
981401998 4:144323755-144323777 ACTTCAGTGGGTTTTTGTGGTGG - Intergenic
982376076 4:154692335-154692357 ATTTCACAGGGATCTGATGGAGG + Intronic
982543763 4:156708364-156708386 ACTTATTTGGGATCTTATGTTGG + Intergenic
983002094 4:162428246-162428268 ACTTTAGTGGGATTTCAAGGTGG - Intergenic
984482373 4:180322007-180322029 ACTACTGTGTGATCTTATGAAGG + Intergenic
985130465 4:186733795-186733817 ACTGCAGTGGGGTCTTACGGTGG + Intergenic
986906238 5:12496516-12496538 AGTTCAGTGGTATCTTATTGTGG - Intergenic
987042167 5:14073076-14073098 ACTTGATTGGGATATTTTGGGGG + Intergenic
987660857 5:20873627-20873649 ACTTAAGTGTGTTCTTGTGGTGG - Intergenic
987866558 5:23547620-23547642 ACTTCAGTGTGTTTTTATAGTGG + Intergenic
987993844 5:25249678-25249700 ACTTCAGTGTGTTTTTATAGCGG + Intergenic
988331630 5:29849272-29849294 CCTTCAGTTGAATCTTAAGGAGG + Intergenic
988762783 5:34332058-34332080 ACTTAAGTGTGTTCTTGTGGTGG + Intergenic
989813700 5:45710111-45710133 AATTCAGTGGCATTTTATTGTGG + Intergenic
991640030 5:68743011-68743033 ACTTCAGTGGAAGTTTCTGGGGG - Intergenic
991712251 5:69419462-69419484 AGTTGGGTGGGTTCTTATGGTGG - Exonic
995258105 5:110071004-110071026 ACTTCAGTGAGTTTTTGTGGTGG + Intergenic
996885137 5:128345177-128345199 ACTTCAATGCCATCTTATAGGGG + Intronic
997227271 5:132218369-132218391 AGATCATTGGGATCTTATAGGGG + Intronic
1000357886 5:160418615-160418637 ACTTCAGTGGGGTATCATGCGGG - Intronic
1001305339 5:170568414-170568436 ACATAAGTGGGATGTTGTGGAGG - Intronic
1003729350 6:8803774-8803796 AGTGCAGAGGGATCTTAAGGAGG - Intergenic
1009060270 6:58389642-58389664 ACTTCAGTGTGTTTTTGTGGTGG - Intergenic
1009230641 6:61057757-61057779 ACTTCAGTGTGTTTTTGTGGTGG + Intergenic
1009596982 6:65747911-65747933 ACTTCAGTGTGTTTTTGTGGTGG - Intergenic
1010466709 6:76175835-76175857 ACTTAAGTGTGTTCTTGTGGTGG - Intergenic
1011313471 6:86005399-86005421 ACTGAAGTGGTATCTTATTGTGG + Intergenic
1011320426 6:86086023-86086045 ACTTCAGTGTGTTTTCATGGTGG + Intergenic
1013896991 6:115101320-115101342 ACTTCAGTGTGTTTTTATAGTGG + Intergenic
1016278923 6:142389833-142389855 ACTTGAATGAGATCATATGGAGG - Intronic
1016640131 6:146338715-146338737 CCTGCAGTGGAATGTTATGGGGG + Intronic
1017222691 6:151985142-151985164 ACTCCAGTGGGATTTCATGCTGG + Intronic
1018661295 6:166089609-166089631 ACTTCAGTGGAAGATTGTGGTGG - Intergenic
1020083293 7:5297727-5297749 ACTTCTGTGGGAAATTCTGGGGG - Intronic
1022422005 7:30232061-30232083 ACTTCAGTTGGTTCTTACCGTGG + Intergenic
1023523104 7:41068756-41068778 ACTTCACTGGAATATTCTGGTGG - Intergenic
1024794818 7:53008084-53008106 ACTGAAGTGAGAACTTATGGTGG + Intergenic
1025210984 7:57019476-57019498 ACTTCTGTGGGAAATTCTGGGGG + Intergenic
1025660971 7:63557371-63557393 ACTTCTGTGGGAAATTCTGGGGG - Intergenic
1028109655 7:86924324-86924346 ACTTTAATTGGATCTTATAGAGG - Intronic
1028292290 7:89080200-89080222 ACTTCAGTAGGATTTGATTGAGG - Intronic
1028858072 7:95614566-95614588 ACTTCAGTGTGTTTTTATAGTGG - Intergenic
1028865588 7:95707643-95707665 ACTTCAGTGTGTTCTTGTTGTGG - Intergenic
1030696434 7:112589924-112589946 ACTTCAGTGTGTTTTTATAGTGG - Intergenic
1031061791 7:117060143-117060165 AGTGCAGTGGGATCTTTTGGTGG + Intronic
1037622617 8:20578111-20578133 ACTGCAATGGGGTCTTATAGTGG + Intergenic
1038225598 8:25654356-25654378 ACTTCAGTGGTTCTTTATGGAGG + Intergenic
1039822837 8:41148848-41148870 ACTTCAGTGGGTTCTTCTCGTGG + Intergenic
1040088251 8:43367532-43367554 ACTTCAGTGGGCTTTTGTAGTGG - Intergenic
1040091810 8:43406746-43406768 ACTTCAGTGTGTTTTTATAGTGG + Intergenic
1042120186 8:65478910-65478932 ACTGCAGTGGGCTCTTATCTTGG - Intergenic
1042764571 8:72307077-72307099 ACTTCACTGTGATTTTGTGGAGG + Intergenic
1044955767 8:97478002-97478024 ACTTCAGTGTGTTTTTGTGGTGG - Intergenic
1046715790 8:117565221-117565243 ACTTCACTGAGATGTTTTGGAGG - Intergenic
1048596139 8:135868457-135868479 CCTTCAATGGTATCTTTTGGTGG - Intergenic
1048780235 8:137991499-137991521 ACTTCAGTGGGGCCAGATGGAGG - Intergenic
1050240001 9:3624924-3624946 ACTTCAGTGTGTTTTTATAGTGG + Intergenic
1051885873 9:21892154-21892176 ACTTAAGTGTGTTTTTATGGTGG - Intronic
1055118150 9:72627433-72627455 ACTGCAGTGGGATCTACTTGTGG - Intronic
1055509584 9:76983100-76983122 ACTTCAGTGTGTTTTTGTGGTGG + Intergenic
1056053221 9:82791869-82791891 ACTTCAGTGAGATGTTGTGTAGG - Intergenic
1057935307 9:99233512-99233534 TCTTCAGTGGGATCTTCAGCTGG + Intergenic
1058199854 9:102026351-102026373 ACTTCAGTGTGTTTTTATTGTGG + Intergenic
1062253842 9:135611666-135611688 ACCTCAGTGGGAGCTTCTGGAGG - Intergenic
1186686001 X:11924789-11924811 ACTTCAGTGTGTTTTTATAGTGG - Intergenic
1186772239 X:12829459-12829481 ACTGCAATGGGGTCTTATAGTGG - Intergenic
1187709748 X:22041351-22041373 ACTTCATAGGGGTCTTATGAAGG - Intronic
1187801559 X:23069299-23069321 ACTTAAGTGTGTTTTTATGGTGG - Intergenic
1191815422 X:65239684-65239706 ACTTCAGTGTGTTTTTGTGGTGG + Intergenic
1192002967 X:67175858-67175880 ACTTCAGTGTGTTTTTGTGGCGG + Intergenic
1193499511 X:82257888-82257910 ACTTAAGTGTGATTTTGTGGTGG + Intergenic
1194150302 X:90316967-90316989 ACTTGATTGTGATTTTATGGTGG - Intergenic
1197236473 X:124071359-124071381 ACTTAAGTTTGATTTTATGGTGG - Intronic
1197423844 X:126271496-126271518 ACTTCAGTGTGTTTTTATAGTGG + Intergenic
1199257656 X:145734803-145734825 TCTTCAGTGGGATATAATGAAGG + Intergenic
1199360030 X:146907207-146907229 ACTGGAGTGGGAACTTGTGGTGG - Intergenic
1200496665 Y:3893724-3893746 ACTTGATTGTGATTTTATGGTGG - Intergenic