ID: 963168045

View in Genome Browser
Species Human (GRCh38)
Location 3:142225181-142225203
Sequence CGGCCACCTGCAGCACCCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 0, 3: 40, 4: 260}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963168045_963168050 -7 Left 963168045 3:142225181-142225203 CCCGCGGGTGCTGCAGGTGGCCG 0: 1
1: 0
2: 0
3: 40
4: 260
Right 963168050 3:142225197-142225219 GTGGCCGCGTCCAGGGCGGTAGG 0: 1
1: 0
2: 0
3: 7
4: 100
963168045_963168054 -2 Left 963168045 3:142225181-142225203 CCCGCGGGTGCTGCAGGTGGCCG 0: 1
1: 0
2: 0
3: 40
4: 260
Right 963168054 3:142225202-142225224 CGCGTCCAGGGCGGTAGGTGGGG 0: 1
1: 0
2: 1
3: 3
4: 85
963168045_963168056 20 Left 963168045 3:142225181-142225203 CCCGCGGGTGCTGCAGGTGGCCG 0: 1
1: 0
2: 0
3: 40
4: 260
Right 963168056 3:142225224-142225246 GCCTGCCCGCTCGCCTCCCGAGG 0: 1
1: 0
2: 3
3: 18
4: 203
963168045_963168058 24 Left 963168045 3:142225181-142225203 CCCGCGGGTGCTGCAGGTGGCCG 0: 1
1: 0
2: 0
3: 40
4: 260
Right 963168058 3:142225228-142225250 GCCCGCTCGCCTCCCGAGGCCGG 0: 1
1: 0
2: 1
3: 12
4: 163
963168045_963168053 -3 Left 963168045 3:142225181-142225203 CCCGCGGGTGCTGCAGGTGGCCG 0: 1
1: 0
2: 0
3: 40
4: 260
Right 963168053 3:142225201-142225223 CCGCGTCCAGGGCGGTAGGTGGG 0: 1
1: 0
2: 0
3: 6
4: 39
963168045_963168051 -4 Left 963168045 3:142225181-142225203 CCCGCGGGTGCTGCAGGTGGCCG 0: 1
1: 0
2: 0
3: 40
4: 260
Right 963168051 3:142225200-142225222 GCCGCGTCCAGGGCGGTAGGTGG 0: 1
1: 0
2: 0
3: 13
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963168045 Original CRISPR CGGCCACCTGCAGCACCCGC GGG (reversed) Intronic
900161965 1:1228119-1228141 CGGCCACGGGCAGCCTCCGCAGG - Intronic
900320173 1:2079641-2079663 CCGCCATCAGCAGCAGCCGCGGG - Intronic
900423351 1:2565149-2565171 CAGCCACCTGCTGCATCCGCGGG + Intronic
900540786 1:3201670-3201692 CAGCCACTTCCAGCACCTGCAGG + Intronic
902515263 1:16986549-16986571 CGGCCTCCTGCAGGGGCCGCTGG - Exonic
902664550 1:17928227-17928249 GGGCCAGCTGCAGCACTGGCGGG + Intergenic
903085467 1:20853611-20853633 CTGCAACCTCCAGCACCCTCAGG - Exonic
903263378 1:22142976-22142998 CGCCCACCTGCAGCCCCGACGGG - Intronic
903642289 1:24868247-24868269 CAGCCACGAGCAGCACCCGGAGG - Intergenic
905366690 1:37455413-37455435 TGGCCACCTGCAGACCCTGCAGG - Intergenic
907388779 1:54142827-54142849 CAGCCCCCTGGAGCACCTGCTGG + Intronic
909082848 1:71134603-71134625 TGGTCTCCTGCAGCACCCTCAGG - Intergenic
909749269 1:79138329-79138351 TGGCCTCCTGCAGCACCCCCAGG + Intergenic
911826850 1:102497990-102498012 TGGTCTCCTGCAGCACCCTCAGG + Intergenic
912097345 1:106161598-106161620 TGGCCTCCTGCAGCGCCCCCAGG + Intergenic
912439063 1:109684728-109684750 CGGTCTCCTGCAGTACCCTCAGG + Intronic
912576159 1:110674608-110674630 CGGCCACCTCCGGCTCCAGCAGG + Exonic
914672471 1:149881950-149881972 AGGCCACCTGCAGCACACAGAGG + Intronic
915410487 1:155697821-155697843 TGGTCTCCTGCAGCACCCTCAGG - Intronic
915459976 1:156064487-156064509 CGGCTCACTGCAGCACCCCCAGG + Intronic
915735298 1:158080808-158080830 CTGCCACCTGCAGCACACGGAGG + Intronic
915747765 1:158177913-158177935 CCGCCACCTGCCCCACCCTCTGG + Intergenic
915934821 1:160084288-160084310 CGGCGACCTGGAGCACCTGGAGG + Exonic
916966162 1:169945064-169945086 AAGCCACCTTCAGCACCCCCTGG + Intronic
917278156 1:173352785-173352807 TGGCCTCCTGCAGCACCCCCAGG - Intergenic
918999635 1:191813771-191813793 TGGTCTCCTGCAGCACCCTCAGG - Intergenic
919025595 1:192165203-192165225 TGGTCTCCTGCAGCACCCCCAGG + Intronic
919538131 1:198813943-198813965 TGGTCACCTGCAGTACCCTCAGG - Intergenic
920339959 1:205269528-205269550 CGCCCACCTGAAGGACCCCCTGG + Exonic
921930239 1:220748675-220748697 TGCCCACCTGCTGCAGCCGCCGG - Exonic
922707581 1:227797356-227797378 GGACCACCTGCAGCTCCAGCTGG + Intergenic
924502872 1:244653221-244653243 AGGCCCCCTGAAGCGCCCGCGGG + Exonic
924733008 1:246729318-246729340 TGGTCTCCTGCAGCACCCTCAGG - Intronic
1062798729 10:363535-363557 AGGCCACACACAGCACCCGCGGG + Intronic
1062860407 10:805594-805616 TGGGTACCTGCAGCACCCCCTGG - Intergenic
1063107880 10:3009368-3009390 CGGACACCTGCTGCCCCCGCTGG - Intergenic
1065140280 10:22713796-22713818 CGGCCCCCAGCAGCTCCCGCCGG + Intronic
1065512473 10:26492938-26492960 TGGCCTCCTGCAGCGCCCCCAGG - Intronic
1066597064 10:37062512-37062534 CGCCCACCTGGAACTCCCGCTGG - Intergenic
1066621283 10:37354104-37354126 TGGTCTCCTGCAGCACCCCCAGG + Intronic
1067279740 10:44862207-44862229 CAGCCACCTGCAGTGCCCGTGGG - Intergenic
1067296951 10:44980055-44980077 CCCCCACCTGCAGCACAGGCAGG - Intronic
1069072834 10:64007298-64007320 TGGTCTCCTGCAGCACCCTCAGG - Intergenic
1069709199 10:70478393-70478415 CGGCTACCCGCGACACCCGCTGG - Intergenic
1069959273 10:72070134-72070156 GGGCCACCTGCAGCCCTGGCTGG - Intronic
1070482454 10:76896115-76896137 TGGCCTCCTGCAGCGCCCCCAGG - Intronic
1070555538 10:77524936-77524958 CGGCCTCCCTCAGCACCAGCAGG + Intronic
1071298151 10:84237463-84237485 CGGGCAGCCGCAGCTCCCGCAGG + Exonic
1073003275 10:100301366-100301388 TGGCCACCTGCAGTGCCCCCAGG - Intronic
1075754755 10:124801911-124801933 GGGCCCCCTGCCGCGCCCGCTGG + Intronic
1076302248 10:129437169-129437191 CGGCCACGTTCACAACCCGCTGG - Intergenic
1076643861 10:131937890-131937912 CTGCCCCGTGCAGCACACGCGGG + Intronic
1076992529 11:282914-282936 CTGCCATCTCCAGCACCCACAGG - Intronic
1077051310 11:568274-568296 CGACCCCCCGCAGCCCCCGCGGG + Intergenic
1077143768 11:1035952-1035974 TGGTCACCTGCAGCAGCCGCAGG + Intronic
1077185865 11:1235072-1235094 TGGCCCCTTGCAGCACCTGCAGG + Exonic
1077250241 11:1557620-1557642 TGCCCACCTGACGCACCCGCTGG + Intronic
1080640522 11:34155789-34155811 CGGCCTTCTGCAGCCCCTGCTGG + Intronic
1081329736 11:41788542-41788564 CGCCCACCTGGAGCCCCAGCTGG + Intergenic
1081906610 11:46674353-46674375 CTGACTCCTGCAGCACCCCCGGG + Intronic
1083099270 11:60285945-60285967 TGGTCTCCTGCAGCACCCTCAGG - Intronic
1083173117 11:60934542-60934564 CTGCCACCTGCAGTACCAGCGGG + Exonic
1083429921 11:62609001-62609023 CCGCCACCTCCAGGACCCCCTGG + Exonic
1083895243 11:65616476-65616498 CGGCCACCTGTAACTCCAGCCGG + Intronic
1083953148 11:65967707-65967729 CGTCCTCCTCCAGCACCTGCGGG - Exonic
1084270742 11:68027882-68027904 TGGCCACCAGCAGCATCCTCAGG - Exonic
1084404058 11:68960862-68960884 CGGTCAGCAGCAGCACCAGCCGG - Intergenic
1085284801 11:75352418-75352440 CGGCCTCCTGCAGCCCCTGCTGG - Intergenic
1085959473 11:81443556-81443578 TGGCCTCCTGCAGCACCCCCAGG - Intergenic
1087086072 11:94219957-94219979 TGGTCTCCTGCAGCACCCTCAGG - Intergenic
1089198157 11:116707428-116707450 CTGCCACCTCCCGCGCCCGCTGG + Intergenic
1091067818 11:132533189-132533211 CAGATACCTGCAGCACCAGCAGG - Intronic
1091584950 12:1810888-1810910 CTGCCGAATGCAGCACCCGCAGG - Intronic
1092136305 12:6150046-6150068 CTGCCAGCTACAGCACCAGCTGG - Intergenic
1094107926 12:26833182-26833204 CGGCCACTTCCAGCTCCCGCCGG - Exonic
1094377112 12:29801963-29801985 CGGCCGCCTGCAGCGCCCCCAGG - Intergenic
1094740375 12:33281750-33281772 TGGTCTCCTGCAGCACCCTCAGG - Intergenic
1095800659 12:46268032-46268054 CGGCCGCACGCAGCACCCCCCGG + Intronic
1096148970 12:49296921-49296943 CCTCCACCTGCTGCACCTGCTGG - Exonic
1098161107 12:67648878-67648900 CGGGCGGCTGCAGCACCCTCCGG - Exonic
1099559642 12:84155437-84155459 CGCCCACCTGCAACTCCAGCTGG + Intergenic
1100392628 12:94157223-94157245 AATCCACCTGCAGCACCTGCTGG - Intronic
1102436317 12:112926801-112926823 TGGTCTCCTGCAGCACCCCCAGG - Intronic
1103852814 12:123944172-123944194 CAGACACCTGCACCACCCCCTGG - Intronic
1104021334 12:124994149-124994171 CTGCCGCCTGCGGCCCCCGCCGG + Intronic
1105004183 12:132710885-132710907 CCGCCAGCTGCAGCGCCTGCCGG - Exonic
1109590622 13:64476148-64476170 TGGCCTCCTGCAGAACCCTCAGG + Intergenic
1110464018 13:75780262-75780284 TGGTCTCCTGCAGCACCCCCAGG - Intronic
1110529108 13:76575859-76575881 CGGTCTCCTGCAGTACCCTCTGG + Intergenic
1111940500 13:94601956-94601978 CGGCCACCAGCAGCACGTGAGGG - Exonic
1113201272 13:107868564-107868586 ACGCCACCTGCTGCTCCCGCGGG - Intergenic
1113714861 13:112496350-112496372 CGCCCGCCTGCTGCACCCCCTGG - Intronic
1114495246 14:23127491-23127513 CTGCCTCCTGCATCTCCCGCCGG + Intronic
1120145967 14:80978659-80978681 CCTCCATCTGCAGCACCTGCAGG - Intronic
1120932885 14:89866475-89866497 GGGCCCCCTCCAGCACCTGCAGG + Intronic
1122293154 14:100690283-100690305 CTCCCACCTGCAGCACCTCCTGG - Intergenic
1122338117 14:101007147-101007169 CGGCCGCCAGCAGCCCCGGCTGG - Intergenic
1122864456 14:104597246-104597268 CCCCCACCAGCAGCACCCCCCGG + Intronic
1122975112 14:105167833-105167855 CGGTCCCCCGCAGCGCCCGCCGG + Exonic
1123034975 14:105468255-105468277 CAGCCATCTGCAGGCCCCGCAGG - Intronic
1124363386 15:29054690-29054712 AGGCCAGCTGCAGCCCCAGCAGG + Exonic
1124427029 15:29570895-29570917 CGGGCGCCCGCAGCCCCCGCCGG + Intergenic
1124469259 15:29968722-29968744 TGGCCATCTGCAGCACCGTCAGG + Intronic
1124962737 15:34410450-34410472 AGGCCAGCTGCAGCCCCAGCAGG + Intronic
1124979363 15:34556672-34556694 AGGCCAGCTGCAGCCCCAGCAGG + Intronic
1126837148 15:52679074-52679096 CGGTCACCTGAGGCAGCCGCGGG - Intronic
1127916414 15:63459111-63459133 CGCCCACCCGGAACACCCGCTGG - Intergenic
1128758086 15:70196609-70196631 CCAGCACCAGCAGCACCCGCTGG + Intergenic
1129458767 15:75689495-75689517 CCGACACCTCCAGCACCAGCTGG + Exonic
1130273090 15:82462583-82462605 CTGACACCTCCAGCACCAGCTGG - Intergenic
1130465442 15:84189954-84189976 CTGACACCTCCAGCACCAGCTGG - Intergenic
1130487250 15:84404866-84404888 CTGACACCTCCAGCACCAGCTGG + Intergenic
1130498823 15:84483582-84483604 CTGACACCTCCAGCACCAGCTGG + Intergenic
1130587731 15:85194549-85194571 CTGACACCTCCAGCACCAGCTGG - Intergenic
1132672027 16:1105997-1106019 TGCCCACCTGCAGTCCCCGCGGG + Intergenic
1132939363 16:2499286-2499308 CCGCCTCCTGCAGCCTCCGCTGG - Intronic
1133221475 16:4320861-4320883 CGGCCTCCCCCAGCACCCCCCGG + Intronic
1134014513 16:10879004-10879026 AGGCCACCAGCAGCGCGCGCGGG + Intronic
1134050110 16:11131460-11131482 CGGCCTCCTGAAGCAGCCTCTGG - Intronic
1136361543 16:29783577-29783599 CGGTCTCCTGCAGTACCCTCAGG + Intergenic
1137272289 16:46909851-46909873 TGGCCTCCTGCACCGCCCGCCGG - Exonic
1138224457 16:55280875-55280897 CGTCCAGCTGCAGCACACCCTGG - Intergenic
1138602251 16:58063065-58063087 CAGCCAGCTGCAGCTCCCACTGG + Intergenic
1140491310 16:75338260-75338282 CTGCCACCTGCAGCAACCTCAGG - Intronic
1140927630 16:79599314-79599336 CGGCCACCACCACCACCCGACGG - Exonic
1142196816 16:88742804-88742826 CATCCACCTGCAGCCCCCACTGG - Intronic
1142489095 17:266426-266448 CGGCCACCTGCAGCATGGGGAGG - Intronic
1144630683 17:16870681-16870703 GGGCCACCTGCTGCTCCCCCTGG - Intergenic
1144650636 17:17004768-17004790 GGGCCACCTGCTGCTCCCCCTGG + Intergenic
1146544322 17:33725173-33725195 CATCCACCTGCAGGCCCCGCTGG - Intronic
1147999603 17:44380085-44380107 AGCCCAGCAGCAGCACCCGCCGG + Exonic
1151730642 17:75909229-75909251 CAGCCACCTGCAGGACCTGCAGG - Intronic
1151738185 17:75959565-75959587 CGGCCACCTCCAGCCCACCCAGG + Intronic
1152049357 17:77959686-77959708 CGCCCACCCGCAGCACGCCCCGG - Intergenic
1152068636 17:78124610-78124632 AGGCCACCAGCAGCAGCAGCAGG + Exonic
1152471613 17:80492663-80492685 CTGCCACCTGCACCACCACCTGG - Intergenic
1154012667 18:10589187-10589209 GGGCCACCTGGAGCCCACGCTGG - Intergenic
1155170568 18:23264207-23264229 CTGGCACCTGCAGAACCAGCAGG - Intronic
1155806226 18:30175033-30175055 CGGCCTCCTGCAGGATCCACTGG - Intergenic
1156993570 18:43439556-43439578 TGGTCTCCTGCAGCACCCTCAGG + Intergenic
1157826780 18:50819580-50819602 CAGCCGCCTGCAGGAGCCGCAGG - Exonic
1159511286 18:69400912-69400934 CCGCCCCCGGCAGCACCCACGGG - Intergenic
1159549444 18:69879284-69879306 TGGCCTCCTGCAGCACCCCCAGG - Intronic
1160247584 18:77171221-77171243 CGGCCTCCCGCACCAGCCGCTGG - Intergenic
1160679763 19:407377-407399 CGGCCAGCAGGTGCACCCGCAGG + Exonic
1160860487 19:1235429-1235451 CGGCCACCCGCCGCCCCCTCGGG - Intronic
1160910561 19:1471984-1472006 TGGGCACCTCCAGCACCTGCTGG - Exonic
1161077044 19:2290870-2290892 CGGCCAGGTGCAGCTCGCGCAGG + Exonic
1161231974 19:3178936-3178958 CGGCCACCGACAGCCCCCGCAGG - Exonic
1161428543 19:4217572-4217594 AGGCCGCCTCCAGCTCCCGCAGG - Exonic
1162793985 19:13077327-13077349 CATCCTCCTGCAGCACCCTCCGG + Intronic
1163453045 19:17390530-17390552 CGGCCGCCGGCAGCCCCCGGAGG + Intergenic
1164326438 19:24196661-24196683 CGGTCTCCTGCAGTACCCTCAGG - Intergenic
1166107678 19:40605424-40605446 CGTCCACGTGGAGCACCCGCAGG + Exonic
1166912611 19:46170759-46170781 TGGCCTCCTGCAGCACCCCCAGG + Intergenic
1167080808 19:47275094-47275116 CGGTCTCCCGCGGCACCCGCCGG + Exonic
1167119353 19:47507455-47507477 CCACCACCTGCAGCTCCCGAAGG + Intronic
1167291938 19:48629356-48629378 CGACCACCTGCTGCCTCCGCTGG + Exonic
1167305078 19:48703499-48703521 CGTTCACCTGCAGGCCCCGCAGG - Exonic
925165267 2:1711706-1711728 GGGCCACCTGCAGGATCCACTGG + Intronic
926131223 2:10304110-10304132 CTGCCTCCTGCAGCACCTCCCGG + Intronic
926581267 2:14634195-14634217 CCACCACCTGCTGCACCAGCTGG + Exonic
928198066 2:29229051-29229073 CAGCCACCTCCACCACCTGCGGG + Exonic
929000697 2:37344770-37344792 CGGCCACCAGCAGCAGCAGGTGG - Exonic
929501313 2:42493707-42493729 CGGCCACCCGCAGGTACCGCCGG - Exonic
932188278 2:69717134-69717156 CAGCCACCTCCTGCACCCTCAGG - Intronic
932562792 2:72887612-72887634 CGGGCACCCGCACCACGCGCAGG - Exonic
934929985 2:98414360-98414382 TGGCCTCCTGCAGCACCCCCAGG + Intergenic
934950037 2:98570015-98570037 CGGCCACGTGCAGCTGGCGCTGG + Intronic
935018321 2:99205675-99205697 TGGCCTCCTGCAGCACCCCCAGG + Intronic
936556014 2:113499421-113499443 GGGCCACCTGCAGCCCCGGCTGG - Exonic
937670608 2:124533659-124533681 TGGCCTCCTGCAGCACCCCTTGG - Intronic
937751455 2:125479477-125479499 CGGCCACCTGGAACTCACGCTGG + Intergenic
943750794 2:191507499-191507521 TGGTCTCCTGCAGCACCCCCAGG + Intergenic
946325696 2:218983808-218983830 CTGCCACCTGCTTCACCCTCCGG - Intronic
946329466 2:219001400-219001422 CGGCCCCCTTCGCCACCCGCTGG + Intergenic
946422059 2:219570803-219570825 CCGCCCCCCGCAGCACCCACTGG + Exonic
947276488 2:228397545-228397567 TGGCCTCCTGCAGCACCCCCAGG - Intergenic
947611690 2:231528681-231528703 GGCCCACCAGCAGCACCAGCAGG + Exonic
948707491 2:239804208-239804230 CAGCCACCCCCAGCACCCGAGGG - Intergenic
948707985 2:239807017-239807039 CTGCCCCTTGCAGCACCCGTGGG - Intergenic
949000471 2:241610252-241610274 CGGCCCCCTCCAGCCTCCGCCGG + Intronic
1169488431 20:6052493-6052515 CGGCCACCTGGAGCAGCTGCAGG - Exonic
1170629688 20:18056611-18056633 CCGCCACCTGCACCACGCCCTGG - Intronic
1172273528 20:33667662-33667684 CCGCCACCAGCAGATCCCGCAGG - Exonic
1172761404 20:37325797-37325819 CCACCACCTGCACCACCTGCTGG + Intergenic
1172899804 20:38326249-38326271 TGGCCACCTGCAGCCCCCAGTGG - Exonic
1173840042 20:46151206-46151228 CTGCATCCTGCAGGACCCGCCGG - Intergenic
1174402386 20:50282988-50283010 CGGCCACCAGCACCACCGCCTGG + Intergenic
1176159528 20:63641382-63641404 CGGCCGCGTGCAGCTCCTGCAGG + Exonic
1178535035 21:33403790-33403812 CCCCCACCTGGGGCACCCGCAGG - Intronic
1178922413 21:36747550-36747572 CGCCCACGCGCTGCACCCGCGGG - Intronic
1179245984 21:39634641-39634663 AGGCCCCCTGCAGCCCCTGCAGG - Intronic
1179887272 21:44319555-44319577 CCGCCTCCTGTACCACCCGCAGG - Intronic
1179999092 21:44987068-44987090 CGGCCCCCAGCATCACCCCCAGG - Intergenic
1180023042 21:45141621-45141643 GGGCCACCTTCACCACCCGTGGG + Intronic
1180162537 21:46004666-46004688 CGGTCACCAGCAGGACCCTCAGG - Exonic
1180975411 22:19845309-19845331 GGTCCACCTGCAGCACCCACAGG - Intronic
1181517501 22:23423617-23423639 CTGGCACCTGCAGCTCCCGGGGG - Intergenic
1183552185 22:38495883-38495905 CGGCCACCTGCTGTACTTGCTGG + Exonic
1183931484 22:41238285-41238307 CGTCCAGCAGCAGCTCCCGCAGG + Exonic
1184235490 22:43180870-43180892 CGGGCACCTGCTGCAGCTGCTGG + Exonic
1184783275 22:46659590-46659612 CGGCTCCCTTCAGCACCCTCAGG + Intronic
1185012674 22:48324024-48324046 CTGCAGCCTGCAGCACCCACAGG + Intergenic
949292728 3:2484955-2484977 CGGCCACCTGGAACTCGCGCTGG - Intronic
950695906 3:14701095-14701117 AGGCCACCTGGAGCATCTGCTGG - Intronic
956552635 3:70478922-70478944 TGGTCTCCTGCAGCACCCCCAGG + Intergenic
957623081 3:82620894-82620916 TGGTCTCCTGCAGCACCCTCAGG - Intergenic
957778943 3:84793352-84793374 TGGCCTCCTGCAGCACCCCCAGG + Intergenic
963168045 3:142225181-142225203 CGGCCACCTGCAGCACCCGCGGG - Intronic
963439281 3:145316518-145316540 TGGTCTCCTGCAGCACCCTCAGG - Intergenic
968473742 4:793330-793352 CGGTCCCCTGCAGCCCCAGCAGG - Intronic
969126480 4:4951946-4951968 CTGCCACATGCAGCTCCCCCAGG + Intergenic
969197700 4:5576400-5576422 CTGCCTCCTGCTGCACCAGCTGG + Exonic
972897200 4:43638130-43638152 TGGCCTCCTGCAGCGCCCCCAGG + Intergenic
974605765 4:64147517-64147539 TGGCCTCCTGCAGTACCCTCAGG - Intergenic
975585062 4:75940886-75940908 CGGCCAGCAGCAGCAGCAGCAGG + Exonic
978505618 4:109453354-109453376 TGGCCTCCAGCAGCACCCCCAGG - Intronic
979993832 4:127407668-127407690 TGGTCTCCTGCAGCACCCCCAGG + Intergenic
980577209 4:134698916-134698938 TGGCCTCCTGCAGCACCCCCAGG + Intergenic
980930343 4:139177676-139177698 CGTGCACCTGCAGCGCCCGCCGG + Intergenic
985645232 5:1081819-1081841 CGGCCACCAGTGGCACCTGCCGG - Intronic
987039255 5:14046379-14046401 GGGCCACCTGCACCACAGGCTGG + Intergenic
991250784 5:64558875-64558897 TGGCCTCCTGCAGCGCCCCCAGG + Intronic
991263475 5:64690827-64690849 CGGCCAGCCGCCGCACGCGCGGG - Intronic
992820750 5:80493671-80493693 TGGCCTCCTGCAGTACCCTCAGG + Intronic
992860332 5:80902782-80902804 TGGCCTCCTGCAGCACCCCCAGG - Intergenic
993202232 5:84830611-84830633 CGCCCACCTGGAACTCCCGCTGG + Intergenic
993411295 5:87576471-87576493 TGGCCTCCTGCAGCGCCCCCAGG + Intergenic
993533339 5:89050297-89050319 CGGTCTCCTGCAGTACCCTCAGG + Intergenic
997513499 5:134468661-134468683 CAGTCACCTGCAGCATCCCCTGG + Intergenic
998453713 5:142254124-142254146 CTGCCAACTGCAGCAACCACAGG - Intergenic
999768149 5:154755982-154756004 CGGGCAGCTGCAGCGGCCGCGGG - Intronic
1001382153 5:171311966-171311988 CGGCCACCTGCTTCCCCCGCGGG + Exonic
1002186551 5:177457375-177457397 CGCCCACCTGCATCAGCCTCTGG - Exonic
1004267228 6:14159262-14159284 TGGTCTCCTGCAGCACCCCCAGG - Intergenic
1004507453 6:16258554-16258576 AGGCCCTCTCCAGCACCCGCTGG + Intronic
1006056122 6:31385666-31385688 CTGCCACCTCCAGCACCAGGGGG + Intergenic
1006674809 6:35754814-35754836 CAGGCTCCTGCAGCACCCACAGG - Intergenic
1007631373 6:43275269-43275291 CGGCGCCCTGCACCCCCCGCCGG + Intronic
1013560618 6:111301142-111301164 TGGCCTCCTGCAGCACCCCCAGG + Intronic
1013855244 6:114564541-114564563 TGGTCTCCTGCAGCACCCTCAGG + Intergenic
1015341860 6:132109918-132109940 TGGTCTCCTGCAGCACCCTCAGG - Intergenic
1018059844 6:160081592-160081614 TGGCCTCCTGCAGCGCCCCCAGG - Intronic
1018102157 6:160450145-160450167 TGGCCTCCTGCAGTACCCTCAGG - Intronic
1019002837 6:168769983-168770005 TGGCCTCCTGCAGCACCCCCAGG - Intergenic
1019109862 6:169701432-169701454 CGGCCTCCTGCACCTCCCGTCGG - Intronic
1019198675 6:170296730-170296752 CGGGCTCCTGCAGCACCTCCTGG - Intronic
1019577590 7:1744923-1744945 AGCCCAGCTGCAGCACCTGCAGG - Exonic
1020383129 7:7567243-7567265 CGGCCGCCCGCAGCCCCCGGTGG - Intronic
1021109666 7:16679137-16679159 TGGTCTCCTGCAGCACCCCCAGG - Intronic
1022421438 7:30227020-30227042 AGGCCACCTGCCCCACCTGCTGG - Intergenic
1022481134 7:30743904-30743926 CAGCCACCTCCAGCCCCTGCAGG + Intronic
1023927205 7:44678162-44678184 GGGGAACCTGCAGCCCCCGCAGG + Intronic
1024553503 7:50583493-50583515 TGGCCTCCTGCAGCGCCCGCAGG + Intergenic
1024946134 7:54809117-54809139 TGGCCTCCTGCAGCACCCCCAGG + Intergenic
1025246936 7:57324590-57324612 TGGCCTCCTGCAGCACCCCCAGG + Intergenic
1025870132 7:65423504-65423526 TGGCCTCCTGCAGCGCCCCCAGG + Intergenic
1026501467 7:70946597-70946619 CGACCTCCTTCAGCACCCACTGG + Intergenic
1026955943 7:74376543-74376565 GGGCCTCCTGCAGCTCCAGCCGG - Exonic
1028762350 7:94509947-94509969 CCGCCACCTGCGCCTCCCGCCGG - Exonic
1030057990 7:105600259-105600281 CGGGCACCTGCAGTCCCAGCGGG - Intronic
1033132019 7:138752789-138752811 CGGCTTCCTGCAGCAGGCGCTGG + Exonic
1033221149 7:139526794-139526816 TGGCCTCCTGCAGCCCCTGCTGG + Intronic
1034251770 7:149697965-149697987 CGGTCTCCTGCAGCACCCTCAGG + Intergenic
1036226060 8:6958413-6958435 CAGCGCCCTGCAGCACCAGCAGG + Intergenic
1036234567 8:7027066-7027088 CAGCGCCCTGCAGCACCAGCCGG + Intergenic
1036910719 8:12755216-12755238 CGGCCACCTGAAGGGCGCGCTGG - Exonic
1037529362 8:19758002-19758024 CCGCCACCTCCAGCACACACAGG + Intronic
1037834235 8:22206944-22206966 GGGCCATCTCCAGCACCCCCGGG + Exonic
1037913428 8:22757861-22757883 CGGCCACCTGCAGCCCTGCCTGG + Intronic
1039941781 8:42097696-42097718 CTGCCACCTTCTGCACCCCCTGG + Intergenic
1041210444 8:55545251-55545273 TGGTCTCCTGCAGCACCCCCAGG + Intergenic
1044070273 8:87751671-87751693 TGGTCTCCTGCAGCACCCTCGGG - Intergenic
1045148684 8:99378047-99378069 TGGCCTCCTGCAGCGCCCCCAGG - Intronic
1045813980 8:106258118-106258140 TGGTCTCCTGCAGCACCCTCAGG + Intergenic
1049897015 9:117945-117967 GGGCCACCTGCAGCCCCGGCTGG + Exonic
1051745391 9:20290613-20290635 CCACCACCTGCAGCTCCTGCAGG + Intergenic
1052125919 9:24774373-24774395 TGGTCTCCTGCAGCACCCTCAGG - Intergenic
1053740115 9:41128197-41128219 GGGCCACCTGCAGCCCCGGCTGG + Exonic
1054443079 9:65284191-65284213 GGGCCACCTGCAGCCCCGGCTGG + Exonic
1054487202 9:65737310-65737332 GGGCCACCTGCAGCCCCGGCTGG - Exonic
1054688235 9:68303116-68303138 GGGCCACCTGCAGCCCCGGCTGG - Exonic
1057370915 9:94472211-94472233 CGGTCTCCTGTAGCACCCCCAGG - Intergenic
1057505842 9:95632795-95632817 TGGGCACCTGCAGCACCATCAGG - Intergenic
1058225459 9:102356208-102356230 TGGCCTCCTGCAGTACCCTCAGG + Intergenic
1060599577 9:124869117-124869139 CGCCCACTTCCGGCACCCGCCGG - Exonic
1060999544 9:127895433-127895455 CAACCACCTGCAGCACCTGGAGG + Intronic
1061862127 9:133473462-133473484 CAGCCCCTGGCAGCACCCGCTGG - Exonic
1062384857 9:136305173-136305195 CGGCCACCTCCAGCCCCACCTGG + Intronic
1186994538 X:15105924-15105946 TGGCCTCCTGCAGCGCCCCCAGG - Intergenic
1191115059 X:56843768-56843790 AGGACACCTGCAGCACCTTCAGG + Intergenic
1191721994 X:64238883-64238905 TGGCCTCCTGCAGCGCCCCCAGG - Intergenic
1192753920 X:74025328-74025350 TGGTCTCCTGCAGCACCCCCAGG - Intergenic
1193712086 X:84893049-84893071 TGGTCTCCTGCAGCACCCTCAGG + Intergenic
1195694580 X:107657302-107657324 CACCCACCTGCAGCCCCTGCTGG - Intergenic
1197772367 X:130097526-130097548 AGGCCTCCTGCAGCACCCAAAGG - Intronic
1198507789 X:137318467-137318489 TGGCCACCTTCAGCAGCCTCTGG + Intergenic
1198994718 X:142561175-142561197 TGGCCTCCTGCAGCGCCCCCAGG + Intergenic
1202354164 Y:24028223-24028245 TGGCCTCCTGCAGCAACCCCAGG + Intergenic
1202516615 Y:25641889-25641911 TGGCCTCCTGCAGCAACCCCAGG - Intergenic