ID: 963171715

View in Genome Browser
Species Human (GRCh38)
Location 3:142257772-142257794
Sequence TGAGAGGCTTAGTACTGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963171702_963171715 30 Left 963171702 3:142257719-142257741 CCCTGCCAGGGTGACTGTGTTCA No data
Right 963171715 3:142257772-142257794 TGAGAGGCTTAGTACTGCAGAGG No data
963171711_963171715 1 Left 963171711 3:142257748-142257770 CCTGGGCCTCCTTGAGGAGCAAC No data
Right 963171715 3:142257772-142257794 TGAGAGGCTTAGTACTGCAGAGG No data
963171708_963171715 6 Left 963171708 3:142257743-142257765 CCCCACCTGGGCCTCCTTGAGGA No data
Right 963171715 3:142257772-142257794 TGAGAGGCTTAGTACTGCAGAGG No data
963171714_963171715 -8 Left 963171714 3:142257757-142257779 CCTTGAGGAGCAACATGAGAGGC No data
Right 963171715 3:142257772-142257794 TGAGAGGCTTAGTACTGCAGAGG No data
963171703_963171715 29 Left 963171703 3:142257720-142257742 CCTGCCAGGGTGACTGTGTTCAT No data
Right 963171715 3:142257772-142257794 TGAGAGGCTTAGTACTGCAGAGG No data
963171710_963171715 4 Left 963171710 3:142257745-142257767 CCACCTGGGCCTCCTTGAGGAGC No data
Right 963171715 3:142257772-142257794 TGAGAGGCTTAGTACTGCAGAGG No data
963171704_963171715 25 Left 963171704 3:142257724-142257746 CCAGGGTGACTGTGTTCATCCCC No data
Right 963171715 3:142257772-142257794 TGAGAGGCTTAGTACTGCAGAGG No data
963171712_963171715 -5 Left 963171712 3:142257754-142257776 CCTCCTTGAGGAGCAACATGAGA No data
Right 963171715 3:142257772-142257794 TGAGAGGCTTAGTACTGCAGAGG No data
963171709_963171715 5 Left 963171709 3:142257744-142257766 CCCACCTGGGCCTCCTTGAGGAG No data
Right 963171715 3:142257772-142257794 TGAGAGGCTTAGTACTGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963171715 Original CRISPR TGAGAGGCTTAGTACTGCAG AGG Intergenic
No off target data available for this crispr