ID: 963173098

View in Genome Browser
Species Human (GRCh38)
Location 3:142271075-142271097
Sequence TACAATAGGGAGCAGACGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963173093_963173098 -4 Left 963173093 3:142271056-142271078 CCTATAGTAGGCAAATCCATACA No data
Right 963173098 3:142271075-142271097 TACAATAGGGAGCAGACGGCCGG No data
963173090_963173098 29 Left 963173090 3:142271023-142271045 CCACATACTGTATAATTCCATTT 0: 5
1: 78
2: 481
3: 1166
4: 2038
Right 963173098 3:142271075-142271097 TACAATAGGGAGCAGACGGCCGG No data
963173091_963173098 12 Left 963173091 3:142271040-142271062 CCATTTGTATGAAATACCTATAG No data
Right 963173098 3:142271075-142271097 TACAATAGGGAGCAGACGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963173098 Original CRISPR TACAATAGGGAGCAGACGGC CGG Intergenic
No off target data available for this crispr