ID: 963174762 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:142286292-142286314 |
| Sequence | CCACCTCTCTGGATGCTTCA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 963174762_963174766 | 11 | Left | 963174762 | 3:142286292-142286314 | CCCTGAAGCATCCAGAGAGGTGG | No data | ||
| Right | 963174766 | 3:142286326-142286348 | ATTTGATATGTTTAGTTAGATGG | No data | ||||
| 963174762_963174767 | 12 | Left | 963174762 | 3:142286292-142286314 | CCCTGAAGCATCCAGAGAGGTGG | No data | ||
| Right | 963174767 | 3:142286327-142286349 | TTTGATATGTTTAGTTAGATGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 963174762 | Original CRISPR | CCACCTCTCTGGATGCTTCA GGG (reversed) | Intergenic | ||