ID: 963174762

View in Genome Browser
Species Human (GRCh38)
Location 3:142286292-142286314
Sequence CCACCTCTCTGGATGCTTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963174762_963174766 11 Left 963174762 3:142286292-142286314 CCCTGAAGCATCCAGAGAGGTGG No data
Right 963174766 3:142286326-142286348 ATTTGATATGTTTAGTTAGATGG No data
963174762_963174767 12 Left 963174762 3:142286292-142286314 CCCTGAAGCATCCAGAGAGGTGG No data
Right 963174767 3:142286327-142286349 TTTGATATGTTTAGTTAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963174762 Original CRISPR CCACCTCTCTGGATGCTTCA GGG (reversed) Intergenic