ID: 963175017

View in Genome Browser
Species Human (GRCh38)
Location 3:142289160-142289182
Sequence ATCTCATGCTAAGAAAATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963175017_963175023 24 Left 963175017 3:142289160-142289182 CCTTAATTTTCTTAGCATGAGAT No data
Right 963175023 3:142289207-142289229 GACAGTGATGCTGCTTCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963175017 Original CRISPR ATCTCATGCTAAGAAAATTA AGG (reversed) Intergenic
No off target data available for this crispr