ID: 963176886

View in Genome Browser
Species Human (GRCh38)
Location 3:142307460-142307482
Sequence CTGAATGCATTGATTGAGCA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 151}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963176884_963176886 2 Left 963176884 3:142307435-142307457 CCTTCACAAATTGCACTTGAGAT 0: 1
1: 0
2: 1
3: 14
4: 133
Right 963176886 3:142307460-142307482 CTGAATGCATTGATTGAGCAAGG 0: 1
1: 0
2: 0
3: 11
4: 151
963176883_963176886 11 Left 963176883 3:142307426-142307448 CCATAGTCTCCTTCACAAATTGC 0: 1
1: 0
2: 0
3: 14
4: 154
Right 963176886 3:142307460-142307482 CTGAATGCATTGATTGAGCAAGG 0: 1
1: 0
2: 0
3: 11
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963176886 Original CRISPR CTGAATGCATTGATTGAGCA AGG Exonic
903342200 1:22661456-22661478 CTGTGTGCATTGGTTGGGCAAGG - Exonic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
907282327 1:53359341-53359363 CTGAGTGCATTGATCTAGGATGG - Intergenic
907577898 1:55544923-55544945 CTGCATGCAATGAGTAAGCATGG - Intergenic
907661178 1:56393894-56393916 CTAGATGCATCAATTGAGCATGG + Intergenic
910167374 1:84341634-84341656 CTGAACCCAATGATTGACCAGGG - Intronic
913137861 1:115910215-115910237 CTGGGAGGATTGATTGAGCATGG + Intergenic
916014723 1:160739839-160739861 CTGATTACATTGCTTGAGTAAGG - Intronic
921200097 1:212796394-212796416 CTGATTGTATTGATGAAGCATGG + Intronic
922093104 1:222416418-222416440 ATGAATGCATTGATGGGCCAAGG - Intergenic
922919475 1:229289892-229289914 CTGGAAGCATTGATTAAACATGG + Intronic
1063081518 10:2772341-2772363 TTGAATGCATAGACTGAGTAAGG + Intergenic
1064433826 10:15293638-15293660 CTGAATGCATTCATAGAGGTGGG + Intronic
1064576525 10:16751560-16751582 CTGAATGAATTAATGAAGCAAGG - Intronic
1066392274 10:34987140-34987162 GTGAGTGGATTGATTGAGCCCGG - Intergenic
1066561691 10:36676537-36676559 CTGACTGATTGGATTGAGCAGGG - Intergenic
1073948125 10:108776040-108776062 CTGCAGGCATTGAATGAGAAAGG - Intergenic
1075182086 10:120220544-120220566 CGGAAGACATTGATGGAGCAAGG - Intergenic
1078629175 11:12986358-12986380 CAGAATGCATTGATTCGTCAGGG - Intergenic
1079589808 11:22168483-22168505 GTGAATGCATTGGTTTGGCATGG - Intergenic
1080163242 11:29204721-29204743 TTGAATCAATGGATTGAGCAAGG + Intergenic
1080914256 11:36639335-36639357 CTGATTGTATTGACTGAGAATGG + Intronic
1081635756 11:44720644-44720666 CTGATTGCATTGATTATGCCAGG + Intergenic
1082171659 11:49012376-49012398 CGGAATGCAGAGATGGAGCAGGG + Intergenic
1082623804 11:55459363-55459385 CTGAATTCTTGGGTTGAGCAAGG - Intergenic
1084379782 11:68804492-68804514 GTGAAAGGATTGATTGAGCCTGG + Intronic
1084894347 11:72254589-72254611 GTGAATGCATTGATTAGGAAAGG + Intergenic
1087946209 11:104163672-104163694 CTGAATGCATTGTTTGGGGAGGG - Intronic
1089344970 11:117785262-117785284 CTGAAAGCACTGATTTAGCCAGG + Intronic
1091494881 12:963946-963968 CTGAATGAAATGAGTGAGAAGGG + Intronic
1093413518 12:18894949-18894971 CTGAATGCCTTATTTCAGCAAGG + Intergenic
1094205883 12:27839904-27839926 GTGAATGCATTGTTAGAGCTCGG - Intergenic
1095040322 12:37433757-37433779 GTGAATCCATTTATAGAGCATGG - Intergenic
1095189855 12:39245094-39245116 AACAATGCATTGATTGAGCAAGG + Intergenic
1102623153 12:114213053-114213075 CTGTATGCAGTGACTGAGCAAGG - Intergenic
1102744336 12:115237133-115237155 CAGAATCCATTGATGGAGAACGG + Intergenic
1103060300 12:117853296-117853318 GTGAATGCATTTATTGACAAAGG + Intronic
1106192350 13:27464477-27464499 CTGTATGCATTGTGTGTGCAGGG - Intergenic
1107229627 13:38092674-38092696 CTGTATGCCTGGATTCAGCATGG + Intergenic
1107665754 13:42688625-42688647 CTGAATACATTGGCTGGGCATGG - Intergenic
1108011900 13:46024013-46024035 CTGAATCAATTGAATTAGCAAGG + Intronic
1110610915 13:77486581-77486603 CTGATTACCTTGATTGATCAAGG + Intergenic
1110883229 13:80599419-80599441 CTGAATGCATTCACTGTGCCAGG - Intergenic
1111118954 13:83821685-83821707 CTGAATACATTAAATGACCATGG - Intergenic
1111564556 13:89997783-89997805 CAGAATGTCTTGAATGAGCATGG - Intergenic
1111989686 13:95104210-95104232 CTGAAAGAATTGCTTGAACATGG - Intronic
1117003941 14:51399200-51399222 CTGAATGCAATGTTTAAGGAAGG - Intergenic
1121211957 14:92213935-92213957 CAGAATGCAGTGGTTGTGCATGG + Intergenic
1123848195 15:24326027-24326049 CAGAAGGCATTCATTGAACAGGG - Intergenic
1125761005 15:42095482-42095504 ATGAATGTAGTGGTTGAGCATGG + Intergenic
1128584806 15:68839338-68839360 CTCAATGCATTTATTGAAAAAGG + Intronic
1128862268 15:71083781-71083803 ATGAATGGACTGATTGAGCTAGG + Intergenic
1130237162 15:82146480-82146502 CTGACTGCATTGATAGACCCTGG + Intronic
1130695321 15:86125377-86125399 CTGAATTCAGTGAATGAGAATGG - Intergenic
1131389791 15:92037747-92037769 CTGAATGAACTGCTGGAGCAAGG - Intronic
1133709276 16:8385547-8385569 CTGAATGCATTCGGTGAACATGG - Intergenic
1134406594 16:13964755-13964777 CTGAATTCTTTTTTTGAGCATGG - Intergenic
1139293563 16:65879364-65879386 CTGAATGCATGGATGGAGGGTGG + Intergenic
1140734030 16:77881967-77881989 ATGAATGCCTTCATTGAGCATGG - Intronic
1141283390 16:82649300-82649322 ATGAATGCATAGATGGAGGATGG + Intronic
1141725284 16:85783943-85783965 CTGAAAGCCTTGATTGTGCAGGG - Intronic
1148841935 17:50504433-50504455 GTGGATGCATTGCTTGAGCCTGG - Intergenic
1152432053 17:80253959-80253981 ATGAATGCTTTGATTGAGTCTGG + Intergenic
1155836441 18:30591760-30591782 ATGAATGGATTGCTTGAGCTTGG - Intergenic
1156551467 18:38023603-38023625 CTGACTGCATTGATACAGGAGGG - Intergenic
1157172714 18:45422700-45422722 CTGGCTCCATTGATGGAGCAGGG - Intronic
1160907324 19:1457459-1457481 CTGAATGCATGGATGGATCGTGG + Intronic
1164628867 19:29747830-29747852 CTGAGGGCAGAGATTGAGCATGG + Intergenic
1167598418 19:50439461-50439483 GTGAATGCATGGATGGAGCTTGG - Intronic
1167945680 19:52986701-52986723 TTGAATGCAAAGATGGAGCAAGG - Intergenic
925845033 2:8027255-8027277 CGGCAAGCATTGACTGAGCAAGG - Intergenic
926142759 2:10377980-10378002 CTGAAGGCCTTAATTGACCAAGG + Intronic
927252459 2:21009117-21009139 ATGAAAGCATTGGTAGAGCAAGG - Exonic
927668890 2:25052332-25052354 CAGAATGCATTCATTCAACATGG - Intronic
930245034 2:48975163-48975185 GTGAATCCATGGATTGAGTAAGG + Intronic
931825470 2:65996050-65996072 CGGAAGGAATTGACTGAGCAAGG + Intergenic
939651758 2:144771289-144771311 CTGAATGCATTGTTTTAGGCAGG - Intergenic
941232949 2:162934015-162934037 CTGAATGCATGTAGTGAGCATGG - Intergenic
941369719 2:164649417-164649439 TTGAATTCATTGATTGATCTGGG + Intergenic
944921804 2:204421919-204421941 ATGAATGCTTTGATTTAGCCAGG - Intergenic
947932480 2:233975245-233975267 GTAAATGCATTGATGAAGCACGG + Intronic
1170201529 20:13749532-13749554 CTGAATGGGTAGATTGAGCAAGG + Intronic
1171534890 20:25878440-25878462 GTGAATCCATTTATAGAGCACGG - Intergenic
1171573003 20:26271510-26271532 GTGAATCCATTTATAGAGCACGG + Intergenic
1171806189 20:29682497-29682519 GTGAATCCATTTATAGAGCACGG + Intergenic
1171837870 20:30173920-30173942 GTGAATCCATTTATAGAGCACGG - Intergenic
1175383304 20:58578195-58578217 CGGAGTGCAGTGATAGAGCATGG - Intergenic
1176047158 20:63098773-63098795 GTGAATGCATGGATGGATCATGG + Intergenic
1176047174 20:63098894-63098916 GTGAATGCATGGATGGAACATGG + Intergenic
1176047190 20:63099015-63099037 GTGAATGCATGGATGGATCATGG + Intergenic
1178485213 21:33014992-33015014 CTGAATGCAATGATGGTGCAAGG - Intergenic
1178672586 21:34604886-34604908 ATGAATGGATTGATGGAGCCAGG + Intronic
1180574257 22:16757984-16758006 GTGAATCCATTTATAGAGCACGG - Intergenic
951541600 3:23787331-23787353 GTGAATGGATTCATTGAGCCTGG - Intergenic
952975119 3:38687369-38687391 CTGAATGCAATAATTGGACAAGG + Intergenic
953442319 3:42928950-42928972 CTGAATGGCTTGAGAGAGCAGGG - Intronic
954196387 3:48999517-48999539 CAGAAGGCAGTGATGGAGCAGGG - Intronic
958036146 3:88172508-88172530 ATGTATGCATTGCTTGAGCTGGG - Intergenic
958704327 3:97634677-97634699 CTGAATCCAGTGATTGAGGTAGG + Intronic
960442326 3:117704099-117704121 CTGAATACAATTAATGAGCATGG + Intergenic
960597350 3:119418176-119418198 CTGAGAGCACTGAGTGAGCAAGG + Exonic
962857617 3:139363183-139363205 CTTAATGCCTTAATGGAGCATGG - Intronic
963176886 3:142307460-142307482 CTGAATGCATTGATTGAGCAAGG + Exonic
966319908 3:178690717-178690739 CTGACTGCATTGATTTAGAAAGG - Intronic
966729179 3:183136331-183136353 CTGAATGTATTAGATGAGCAGGG + Intronic
967649747 3:191972666-191972688 CTGAATGGATGGAATGAGCTGGG - Intergenic
967919193 3:194601994-194602016 CAGAGTGCATTCAGTGAGCAGGG - Intronic
969251256 4:5970230-5970252 CTGGACGCCTTGAGTGAGCAGGG - Intronic
970567028 4:17341431-17341453 GTGAATGCATTGCTTGCCCAAGG - Intergenic
973875756 4:55216942-55216964 GTAAATGCATTCATAGAGCATGG + Intergenic
975597091 4:76058341-76058363 CTGAATGAATTGCTTGAGTTTGG + Intronic
978792570 4:112678046-112678068 CTAAATGAAGTGATGGAGCAAGG - Intergenic
982939888 4:161537214-161537236 CTGAATCCAGTGTTTGAACAAGG - Intronic
988431042 5:31118921-31118943 CTGAAAGCACTGATTGACTAGGG - Intergenic
989986985 5:50712644-50712666 CTGAAGGCATTCACAGAGCAGGG + Intronic
990315923 5:54583343-54583365 CTGAATGAAAACATTGAGCATGG + Intergenic
995195955 5:109368722-109368744 CTGAATGCAGTGATGGGGAATGG - Exonic
996316609 5:122167575-122167597 CTGACTGCATTGCATGAGCATGG + Intronic
996525191 5:124472249-124472271 CTGAATGCTTTTATTTAGAAGGG + Intergenic
997199605 5:132001867-132001889 CTGAAAGCATTGTTTGTGCCTGG - Intronic
997771640 5:136560413-136560435 CTGACTGCATTTTCTGAGCATGG + Intergenic
997854022 5:137357225-137357247 CTGAATGGATGGAGTTAGCACGG - Intronic
999832818 5:155337061-155337083 CCAAATGCATTGATTGATGAGGG + Intergenic
1000549223 5:162638376-162638398 TGGAATGCATTTATAGAGCATGG - Intergenic
1002309698 5:178306934-178306956 AAGAATGCATTCATTGAGAAGGG + Intronic
1005484895 6:26290334-26290356 CTGAATGCAAAGATGGAACAAGG - Intergenic
1008698222 6:54067138-54067160 CTGAAGGCATTTATTTATCAAGG + Intronic
1012309191 6:97700304-97700326 CTGAATGATTTTATTGAGGATGG + Intergenic
1014974398 6:127861335-127861357 CTGACTGCATTGATTATACAGGG + Intronic
1016673638 6:146737905-146737927 CTCAAAGCATTGAAAGAGCATGG - Intronic
1017053883 6:150420512-150420534 CTGAATGAATGTATGGAGCAGGG - Intergenic
1017340175 6:153311938-153311960 GTGACTGCAGTGATTGACCATGG - Intergenic
1017739791 6:157396884-157396906 CTGTATGCCTTTATTGAGCTGGG + Intronic
1018524335 6:164690924-164690946 CTGAAGGCATTAAATGTGCATGG - Intergenic
1018845737 6:167553978-167554000 CTGCATGCGTTGTCTGAGCAGGG + Intergenic
1019353329 7:565399-565421 CTGAATGCATTGCTTCATGAGGG - Intronic
1019886159 7:3907888-3907910 TAGAATACTTTGATTGAGCAAGG + Intronic
1022865037 7:34408986-34409008 CTGTATGCATTGAGGCAGCAGGG + Intergenic
1026282339 7:68933098-68933120 CTGCATGCCTGGAGTGAGCAGGG - Intergenic
1029141202 7:98411742-98411764 CTGACTGCATTTGTTGATCAAGG - Intergenic
1029277719 7:99417352-99417374 CTGAATGCTTTTTTTGATCAAGG + Exonic
1030675095 7:112376072-112376094 CTGAATGGATTGACTTATCAAGG - Intergenic
1033000919 7:137503635-137503657 CTGAATGTAGTTATTGACCAAGG - Intronic
1033034503 7:137861190-137861212 CTGAATTCAATGATTGATTAAGG + Intergenic
1034785116 7:153919092-153919114 TTGAATGCATGGCTTGAGAATGG + Intronic
1039031541 8:33315162-33315184 GTGAAAGCATTTATTGGGCAAGG - Intergenic
1043077882 8:75724937-75724959 CTAAATGCATTTATTCAACATGG - Intergenic
1044145572 8:88709680-88709702 CTGAAGGTACTGACTGAGCAAGG + Intergenic
1049862874 8:144912306-144912328 CTGAATGCCTTGGCTGGGCATGG - Intergenic
1050630254 9:7550629-7550651 CTGCATGCCTTAATTCAGCAAGG - Intergenic
1051858961 9:21601960-21601982 CTGAAGGCATGGAGTGAGCGAGG - Intergenic
1052528803 9:29655897-29655919 CTGAATGCAAAGATGGAACAAGG - Intergenic
1056722125 9:89081623-89081645 CTGAATGCATTGAATTAGAAAGG - Intronic
1056964626 9:91155389-91155411 CTGACTGCCCTGATCGAGCATGG - Intergenic
1057842963 9:98501067-98501089 CAGAATGTATTAACTGAGCAAGG + Intronic
1060509148 9:124219381-124219403 CTTAATGCATAGGATGAGCAGGG + Intergenic
1062609005 9:137364734-137364756 GTGAATGCATTGATGGAGGTGGG - Intronic
1186849311 X:13564963-13564985 CTGAAGGCATTCAATCAGCAGGG - Intergenic
1188293491 X:28417393-28417415 CTGAATGGACTGATGCAGCATGG - Intergenic
1194785335 X:98077095-98077117 CTGATTACATTGATTGGTCAAGG + Intergenic
1195951758 X:110282750-110282772 CTGAAACACTTGATTGAGCAAGG - Intronic
1198690098 X:139273092-139273114 CTTAATGCATTGGTTGAAAATGG + Intergenic
1199508000 X:148587935-148587957 CTGATAGCATTGATTTTGCATGG + Intronic