ID: 963182961

View in Genome Browser
Species Human (GRCh38)
Location 3:142379707-142379729
Sequence GACAAATGGCCTTTCTGCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 141}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963182961_963182963 -2 Left 963182961 3:142379707-142379729 CCTTTGCAGAAAGGCCATTTGTC 0: 1
1: 0
2: 0
3: 15
4: 141
Right 963182963 3:142379728-142379750 TCACTTGCAACTAAAAATGCAGG 0: 1
1: 1
2: 3
3: 19
4: 196
963182961_963182964 18 Left 963182961 3:142379707-142379729 CCTTTGCAGAAAGGCCATTTGTC 0: 1
1: 0
2: 0
3: 15
4: 141
Right 963182964 3:142379748-142379770 AGGCTCTGAATTATTATGAAAGG 0: 1
1: 0
2: 0
3: 11
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963182961 Original CRISPR GACAAATGGCCTTTCTGCAA AGG (reversed) Intronic
902190104 1:14756385-14756407 GACAAATGCCATTTTTGCAGGGG - Intronic
903459022 1:23508074-23508096 GACCAAAAGCATTTCTGCAAAGG + Exonic
904670780 1:32163379-32163401 GACAAAAGCCTTTCCTGCAAAGG + Intronic
906687279 1:47770804-47770826 GCCAAAGGCCCTTTCTGCTAGGG + Intronic
907291541 1:53416530-53416552 GAAAAATGGCCTTCTTGCCAAGG - Intergenic
908365045 1:63413312-63413334 GATAAATGCCATTTCTGAAATGG - Intronic
909977491 1:82062059-82062081 TATAAATAGCCTTTCTACAATGG - Intergenic
911277209 1:95876928-95876950 GAGAAATTGCCAGTCTGCAATGG + Intergenic
912715186 1:111978477-111978499 AAAAAATGGGCTTTCTGGAATGG + Intronic
912993642 1:114512010-114512032 GACAAATGCCCTTACAACAATGG + Intergenic
918587375 1:186203397-186203419 GAGAAATCCCCTTTCTTCAAGGG + Intergenic
923707513 1:236356490-236356512 GCCAGAGGACCTTTCTGCAAGGG + Intronic
1062956926 10:1546660-1546682 GGGACGTGGCCTTTCTGCAAAGG - Intronic
1065063432 10:21932737-21932759 GACAAATGGCCTATCTGCTCTGG - Intronic
1065297711 10:24292430-24292452 GGCAAATGGCCTTCCTGTAAAGG - Intronic
1065940848 10:30562843-30562865 GACTACTGGCCTTTCTACTATGG + Intergenic
1068979059 10:63042198-63042220 GACAAATGGCCTTTGGGTAGTGG - Intergenic
1069077167 10:64050784-64050806 CACAAAGGGACTGTCTGCAAAGG + Intergenic
1069783819 10:70975287-70975309 AAGAAGTGGCCTTTCTGAAAGGG + Intergenic
1070618966 10:77992000-77992022 GACAAAAGGAGTTTCTGTAAGGG + Intronic
1071093264 10:81945053-81945075 CACAAAAGGCCTCTCTGCAGAGG - Intronic
1073520356 10:104122326-104122348 AACTAGTGGGCTTTCTGCAACGG + Intronic
1074356830 10:112793282-112793304 GACACTTTGCCTTTCAGCAAAGG - Intronic
1074934196 10:118161600-118161622 GACAAATGGTATCTCTGCACGGG - Intergenic
1075636317 10:124033197-124033219 GACCCATGGCCTGTCTGAAATGG - Intronic
1078262603 11:9724750-9724772 TAAAAATGGCCTTTCTGCATGGG + Exonic
1078745147 11:14106499-14106521 CACAAGTGGAGTTTCTGCAAAGG + Intronic
1081366498 11:42241584-42241606 GAGAACTGGCCTATCTGTAAAGG - Intergenic
1086921384 11:92591320-92591342 CACAAATGAGCTTTCTGCATTGG + Intronic
1090272867 11:125400106-125400128 GATCAATGGCCTTTCTGCCGTGG - Intronic
1092990589 12:13894143-13894165 GCCAAATGGCTTTTCTAAAATGG - Intronic
1096681060 12:53255550-53255572 GACACATACCCTTTCTGGAAAGG + Intergenic
1097507347 12:60491679-60491701 GAGAAACAGCCTTTATGCAAAGG + Intergenic
1099079596 12:78160115-78160137 AACAAATGACTTTTCTTCAAAGG - Intronic
1099823515 12:87746021-87746043 GTCAAAAGGGCTTTCTGTAAGGG + Intergenic
1100507985 12:95239534-95239556 TACAAATTGCTTTTCTGAAAGGG + Intronic
1104037264 12:125106185-125106207 GACAAATGGACTTTCTCTCAGGG - Intronic
1105817266 13:24047992-24048014 GACAGATGTCCTTTTTGCCAAGG + Intronic
1106086763 13:26549665-26549687 GTCAAATATCCTTTCTTCAAGGG + Intergenic
1115709900 14:36039341-36039363 GAGAAATGGCAATTCTGGAATGG + Intergenic
1117055705 14:51910277-51910299 AACAAATGGCATGTGTGCAAAGG + Intronic
1120426245 14:84351479-84351501 CACAGATGGCATTTCTGGAATGG + Intergenic
1121619081 14:95333690-95333712 GCCACATGGCCTAGCTGCAAAGG - Intergenic
1121708738 14:96020952-96020974 TACAAATGGACTTACTGAAATGG + Intergenic
1125907635 15:43408134-43408156 AACAAACTGCCTTTCTGCAAAGG + Intronic
1130101403 15:80897078-80897100 GATAAATGGCTGTTCCGCAAAGG + Intronic
1133848090 16:9475929-9475951 CGGAAATGGCCTTTCGGCAATGG + Intergenic
1134206114 16:12239125-12239147 GGCACATGGCCTTTCTGAATAGG + Intronic
1134842730 16:17414642-17414664 GCAAAAGGGCATTTCTGCAAAGG + Intronic
1137862145 16:51857163-51857185 GACACTTGGCATTTCTCCAAAGG - Intergenic
1141345357 16:83239919-83239941 CAGAGATGGCCTTTCTGAAAGGG + Intronic
1143812071 17:9479929-9479951 GGCAAAGGGCCTTTACGCAAAGG - Intronic
1146972819 17:37086435-37086457 GAGAACTGCCCTTTCTGCACTGG - Exonic
1149104393 17:52944261-52944283 GACTCTTTGCCTTTCTGCAAAGG - Intergenic
1155126214 18:22878729-22878751 GAGAGATGCCCTTGCTGCAAGGG - Intronic
1158914366 18:62106813-62106835 GAGAAATGGCCAAGCTGCAAAGG + Exonic
1160191529 18:76718359-76718381 GACAAATTGATTTTCAGCAAAGG + Intergenic
1167128581 19:47569160-47569182 GACAAATGGCATCTCTAGAAAGG + Intergenic
1167839157 19:52099693-52099715 AACAAATGCCCTTTCTGCTTGGG + Intergenic
1167860669 19:52280969-52280991 TACAAATGGCCTTTCTCCATTGG - Intronic
926680125 2:15656715-15656737 GAAAAAAGGCCCTTCTACAAAGG - Intergenic
927099794 2:19779356-19779378 GATAAGTAGCATTTCTGCAAGGG - Intergenic
927293611 2:21428209-21428231 GACAAATGGCCTATTTACCAAGG - Intergenic
929124292 2:38509157-38509179 GAGAAATGGCCTTTCTCTAAGGG - Intergenic
929816605 2:45237727-45237749 GACAAAGGGCATTTCTGGGAGGG - Intergenic
929943687 2:46354167-46354189 GTTCAAGGGCCTTTCTGCAAGGG - Intronic
931103199 2:59025448-59025470 GAGAAATGAGCTTTCAGCAAAGG + Intergenic
933583285 2:84151663-84151685 GTCAATTGGCCTTTCTTCATGGG - Intergenic
935221813 2:101021778-101021800 GACAAATGGACTTTCAGCATTGG - Intronic
935231009 2:101095769-101095791 GAGAAATGCCCTTTTTGCATGGG - Intronic
936162080 2:110091528-110091550 GACAATTGGCCTTTCTGGGCAGG - Intronic
936182582 2:110279826-110279848 GACAATTGGCCTTTCTGGGCAGG + Intergenic
936947955 2:117947518-117947540 GACAGACGGCCTTTGTGAAAAGG - Intronic
938114546 2:128594427-128594449 GACCAAAGGCCTTCCTGGAAGGG - Intergenic
940497398 2:154450117-154450139 CACAAATGGGCTTTTTGCAAAGG + Intronic
944955807 2:204807310-204807332 TAAAAATGGCTTTTCTTCAAAGG + Intronic
945538098 2:211045586-211045608 GAGAATTGCCCTTTCTGAAAAGG - Intergenic
946931983 2:224679877-224679899 ATGAAATGGCCTTTCTGAAAAGG + Intergenic
947027847 2:225758998-225759020 GAAAAATGGCCTTACTGAGAAGG - Intergenic
948564625 2:238876050-238876072 GACAGATTTCCTTTCTGCCAGGG - Intronic
1170061759 20:12266273-12266295 GACAATTAGCCTTTTTGCAAAGG - Intergenic
1171354870 20:24536309-24536331 GACAAATGTCCATTCTGAATTGG - Intronic
1172602415 20:36193055-36193077 GACAACTGGGGTTTATGCAAAGG + Intronic
1174548718 20:51345614-51345636 GACAAAGGGTGTTTCTGCACAGG + Intergenic
1178733748 21:35130411-35130433 CAGAAATGGCCTTTCTGCCCAGG + Intronic
1181874988 22:25933360-25933382 GAGAACTGGCTTTACTGCAAAGG - Intronic
1181875000 22:25933446-25933468 GACAAAAGGCCTGTGTGGAAGGG - Intronic
1183186088 22:36292403-36292425 GACAAATGGAGCTTCTGCAAAGG + Intronic
949630645 3:5922605-5922627 GTCAAATGGCTTTTATGAAAAGG - Intergenic
950240894 3:11369097-11369119 GATATTTGGCCTTTCTGCACAGG + Intronic
950259532 3:11534295-11534317 GGCAGATGCCCGTTCTGCAAAGG + Intronic
951318928 3:21221849-21221871 GACAAATGGCCTTTGTCACAAGG - Intergenic
954690953 3:52395299-52395321 GACAGATTGGCTGTCTGCAAGGG - Exonic
955462078 3:59194212-59194234 GCCAAATTGCCTTTCAGAAATGG + Intergenic
955505772 3:59631773-59631795 GGCACTTAGCCTTTCTGCAAGGG + Intergenic
957215077 3:77309674-77309696 GGCAACTGCCCTGTCTGCAAAGG + Intronic
960117239 3:113908405-113908427 CACAATTGGCTTTGCTGCAAAGG - Intronic
962411143 3:135142904-135142926 GCCAAATGGCATTTTTGCAAAGG + Intronic
963182961 3:142379707-142379729 GACAAATGGCCTTTCTGCAAAGG - Intronic
963343244 3:144063086-144063108 GCCAAATGACCCTTCAGCAATGG + Intergenic
963361477 3:144278574-144278596 GATAAATGGTCTTTCTGAAATGG - Intergenic
964451039 3:156813603-156813625 GACAGAGGGGCTTTCTGGAAAGG - Intergenic
965464577 3:169012066-169012088 GTCAAATGGTATTTCTTCAACGG + Intergenic
966086499 3:176073964-176073986 GTCAAGTGGACTTTATGCAAGGG + Intergenic
966705662 3:182911117-182911139 CACAACTGGTCTTTTTGCAAGGG + Intronic
968805198 4:2767613-2767635 GAAAAATGGCGTTTGTGAAAGGG - Intergenic
970499698 4:16664934-16664956 GACAAATGTACTTTCTGCATTGG + Intronic
971495860 4:27264510-27264532 GACAGATGCCCTTTCTGCCATGG - Intergenic
981592709 4:146382077-146382099 GACAAAGGGCTTTGTTGCAAAGG + Intronic
982421574 4:155204968-155204990 GAAAAATGGACCTTCTGTAAAGG + Intergenic
985379514 4:189377508-189377530 CACAACTGGCCTGTCTGAAAAGG - Intergenic
989132178 5:38118375-38118397 CACAAATGTCCTTTTTGCACAGG + Intergenic
989641459 5:43587313-43587335 GAAAGATGGCGTTACTGCAAAGG - Intergenic
989669344 5:43896726-43896748 GATAAATGGAATTTCAGCAAAGG + Intergenic
990339396 5:54807847-54807869 CACTCATGGGCTTTCTGCAATGG - Intergenic
990989994 5:61675191-61675213 GACAAAAGCCCTTTCAACAAAGG + Intronic
991934288 5:71786494-71786516 GACAAAGAGCCTTTGTGAAAGGG + Intergenic
992985864 5:82228968-82228990 GTCAAATCGACTTTCTGCCACGG - Intronic
994106494 5:95955282-95955304 GCCAAATGCCCTTTCTGTAGAGG + Intronic
994537271 5:101048235-101048257 GACAAATGGCCTTTATAGGAGGG - Intergenic
999501716 5:152153314-152153336 GACAAATGGACTTACTGTGAAGG + Intergenic
1000618470 5:163456770-163456792 GAAAAATGGCCTTTCTTGTATGG - Intronic
1001327539 5:170740034-170740056 GACACAGGGCCATTCTGCCATGG + Intergenic
1003628589 6:7766083-7766105 GGGAAATGGCCTTTCTCCATCGG + Intronic
1004571390 6:16849129-16849151 GACAAACAGCCTTTCAGCAAGGG - Intergenic
1007147547 6:39651323-39651345 GACAAAGGGCCTATCTTCAGGGG + Intronic
1007690296 6:43696657-43696679 GCCAGATGCCCTTTCTGAAAAGG + Intergenic
1012422178 6:99077628-99077650 AAGAAATAGCCTTTGTGCAAAGG + Intergenic
1012771532 6:103441515-103441537 TGCAAATGTCCTCTCTGCAAAGG - Intergenic
1014843727 6:126250651-126250673 TACAAAAGGCATTTCTGAAAGGG - Intergenic
1023149480 7:37187858-37187880 GACACAAGGCCATTCTTCAAGGG + Intronic
1024467748 7:49730588-49730610 GACAAATGCCCTTTTTTCATGGG + Intergenic
1028060288 7:86304872-86304894 AACATAAGGCTTTTCTGCAAGGG - Intergenic
1030795743 7:113785004-113785026 GCCACATGTCCTTGCTGCAAGGG - Intergenic
1031700060 7:124913725-124913747 GACAAATGGTCATTCTTAAATGG + Intronic
1031840245 7:126728971-126728993 GAGAAAAAGCCTTTCTGAAAAGG - Intronic
1033112210 7:138590238-138590260 GAGAAGTGGCATTTCTCCAAGGG + Intergenic
1037395984 8:18443903-18443925 TAAAAATGGCATTTCTGCATAGG - Intergenic
1039119230 8:34127199-34127221 AAAAAATGGCCCCTCTGCAAAGG - Intergenic
1040956583 8:52985930-52985952 GACAAATGGCCTTTGTTGAGTGG - Intergenic
1044706920 8:95017879-95017901 GACAAAATGTCTTTCTTCAAAGG - Intronic
1046594424 8:116244441-116244463 GAGAAATCCCCTATCTGCAAGGG + Intergenic
1048541879 8:135349398-135349420 TACAAATGGGCTTTCTTCACTGG - Intergenic
1052392129 9:27892662-27892684 GACAAATGACCCCTCAGCAAGGG - Intergenic
1055484240 9:76741583-76741605 GACATATGGCCCTCCTGCGAAGG + Intronic
1058787389 9:108403663-108403685 GAAAACTGCCCTTACTGCAAAGG + Intergenic
1059052719 9:110944417-110944439 TACAAATTTTCTTTCTGCAAAGG + Intronic
1059396514 9:114037464-114037486 GACAGTTGGCCACTCTGCAAAGG + Intronic
1059545339 9:115170245-115170267 GATAAATGGCTTTTATGAAATGG - Intronic
1060884535 9:127141082-127141104 GAGGGATGGCCTTTCTGCAGCGG + Intronic
1061141443 9:128769890-128769912 GACAAATGGCCATTGTGCTTGGG - Intronic
1189174173 X:38937664-38937686 GAGAAATGGCTCTTCTCCAAAGG - Intergenic
1189399439 X:40652878-40652900 GAACCATGGCCTTTCAGCAAAGG + Intronic
1193408077 X:81127890-81127912 GACAAATGGCTCTTCAACAAAGG + Intronic
1196411840 X:115427955-115427977 GACAAATGGGTTTTATTCAAAGG + Intergenic
1198043529 X:132877572-132877594 GTCAAATGGCCTGTGTGAAACGG - Intronic
1198140017 X:133792938-133792960 AACAAAAGGCCATTATGCAAAGG + Intronic