ID: 963186978

View in Genome Browser
Species Human (GRCh38)
Location 3:142429441-142429463
Sequence ATTACGGCTAAATCCAGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 69}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963186978_963186987 8 Left 963186978 3:142429441-142429463 CCCGGCCTGGATTTAGCCGTAAT 0: 1
1: 0
2: 0
3: 2
4: 69
Right 963186987 3:142429472-142429494 GAAATTTTAGTGGCATGGTGGGG 0: 1
1: 0
2: 2
3: 29
4: 264
963186978_963186985 6 Left 963186978 3:142429441-142429463 CCCGGCCTGGATTTAGCCGTAAT 0: 1
1: 0
2: 0
3: 2
4: 69
Right 963186985 3:142429470-142429492 AGGAAATTTTAGTGGCATGGTGG 0: 1
1: 0
2: 0
3: 21
4: 230
963186978_963186983 -2 Left 963186978 3:142429441-142429463 CCCGGCCTGGATTTAGCCGTAAT 0: 1
1: 0
2: 0
3: 2
4: 69
Right 963186983 3:142429462-142429484 ATCTTGTCAGGAAATTTTAGTGG 0: 1
1: 0
2: 0
3: 20
4: 208
963186978_963186986 7 Left 963186978 3:142429441-142429463 CCCGGCCTGGATTTAGCCGTAAT 0: 1
1: 0
2: 0
3: 2
4: 69
Right 963186986 3:142429471-142429493 GGAAATTTTAGTGGCATGGTGGG 0: 1
1: 0
2: 1
3: 17
4: 177
963186978_963186984 3 Left 963186978 3:142429441-142429463 CCCGGCCTGGATTTAGCCGTAAT 0: 1
1: 0
2: 0
3: 2
4: 69
Right 963186984 3:142429467-142429489 GTCAGGAAATTTTAGTGGCATGG 0: 1
1: 0
2: 0
3: 12
4: 173
963186978_963186988 19 Left 963186978 3:142429441-142429463 CCCGGCCTGGATTTAGCCGTAAT 0: 1
1: 0
2: 0
3: 2
4: 69
Right 963186988 3:142429483-142429505 GGCATGGTGGGGATAAAAGAAGG 0: 1
1: 0
2: 2
3: 28
4: 313

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963186978 Original CRISPR ATTACGGCTAAATCCAGGCC GGG (reversed) Intronic
903567034 1:24275379-24275401 ATTAAGTCTAAATCCAGCCAGGG + Intergenic
905161433 1:36038548-36038570 CTTAAGAATAAATCCAGGCCGGG - Intronic
915451320 1:156007350-156007372 ATTACAAGTAAATTCAGGCCAGG + Intergenic
917625689 1:176843708-176843730 GTCAGGGTTAAATCCAGGCCCGG + Exonic
923015562 1:230124164-230124186 TTTCCACCTAAATCCAGGCCGGG - Intronic
1063678025 10:8159191-8159213 ATCAAGACTAAATCCTGGCCAGG + Intergenic
1066423784 10:35286105-35286127 GTTAAACCTAAATCCAGGCCAGG - Intronic
1069594177 10:69659909-69659931 ATTACTGTTAGATCCAGGTCGGG - Intergenic
1070733617 10:78848667-78848689 ATTAAGGCTAGATCTTGGCCAGG - Intergenic
1076288052 10:129320641-129320663 ATTCCTCCTACATCCAGGCCAGG - Intergenic
1085113162 11:73906544-73906566 ATAAAAACTAAATCCAGGCCAGG - Intronic
1085655094 11:78306985-78307007 ATTATGCCCAAATACAGGCCTGG - Intronic
1087069149 11:94058862-94058884 ATTAAAGCAAAAACCAGGCCAGG - Intronic
1089663199 11:119999081-119999103 ATTTCACTTAAATCCAGGCCAGG - Intergenic
1089807441 11:121104157-121104179 ATGAAGGATAAATCCATGCCAGG + Intronic
1096494745 12:52033476-52033498 ATTTCCCCTAAATCCAGGCCAGG - Intronic
1097089054 12:56490908-56490930 ATAAAAGCTAAATCCGGGCCGGG + Intergenic
1097328970 12:58312482-58312504 ATTTTGGCTAAAGACAGGCCAGG + Intergenic
1103327599 12:120131772-120131794 GTTAAAGCAAAATCCAGGCCAGG - Intronic
1108071325 13:46631904-46631926 ATTAAGACTTAATTCAGGCCGGG + Intronic
1112356547 13:98678621-98678643 ATTATGGCAAAATACAGACCAGG - Intergenic
1113083450 13:106541464-106541486 GATACTGCTAAATCCAGGACAGG + Intergenic
1118255334 14:64200578-64200600 GTTACAGCTGTATCCAGGCCTGG + Intronic
1120176860 14:81303684-81303706 ATGAAGGCAAAATCCAGTCCAGG - Intronic
1128550216 15:68593466-68593488 AGTAGGGCTACATCCAGACCTGG - Intronic
1131000419 15:88935542-88935564 ATTAAGAGTAAATCCAGTCCGGG + Intergenic
1133307906 16:4822682-4822704 ATTAAAAGTAAATCCAGGCCGGG - Intronic
1136613515 16:31381396-31381418 ATTTTGGCTAAATCTAGGCTGGG + Intronic
1138580576 16:57938269-57938291 ATTCCTACTAAGTCCAGGCCTGG - Intronic
1139713690 16:68795866-68795888 AATAAAGCTAAATGCAGGCCGGG + Intronic
1143561492 17:7698434-7698456 ATTACTGTTAAGTCTAGGCCGGG + Intronic
1147891769 17:43722383-43722405 ATGGAGGCTGAATCCAGGCCAGG - Intergenic
1153853422 18:9119531-9119553 CTTTGGGCTAAATCCAGGACTGG - Exonic
1156714529 18:39991188-39991210 ATTAAGGCAAATTCCAGGTCAGG + Intergenic
1161183942 19:2903505-2903527 ATTAAAACTTAATCCAGGCCGGG - Intronic
1163033259 19:14558048-14558070 ATTAAGGATAAATATAGGCCGGG - Intronic
1167975710 19:53224458-53224480 CTTTGGGCTAAATCCAGGACTGG + Intergenic
1168167512 19:54561250-54561272 ATTACCGCTAAAACCAAGGCAGG + Intergenic
933721472 2:85400188-85400210 TTTGCGCCTAAATCCATGCCGGG - Intronic
934700343 2:96434647-96434669 ATTATTGCTAAAGACAGGCCAGG - Intergenic
939551418 2:143620237-143620259 ATTAGTGGTAAATCCAGTCCTGG + Intronic
1176922272 21:14702557-14702579 TTTAAGGCTGAATTCAGGCCAGG + Intergenic
1182109051 22:27710088-27710110 ACTACAGCCAAATCCAGCCCAGG + Intergenic
953439001 3:42902074-42902096 AATACGGCTGAATGCAGGCGAGG - Intronic
958445842 3:94213921-94213943 ATTCCTGCTGAATGCAGGCCAGG + Intergenic
960722119 3:120635180-120635202 ATTAAAGCTGAATCTAGGCCGGG + Intronic
963186978 3:142429441-142429463 ATTACGGCTAAATCCAGGCCGGG - Intronic
963863283 3:150332739-150332761 ATGAGTGCTCAATCCAGGCCTGG + Intergenic
964493859 3:157267487-157267509 ATTAAGGCTAAAAACTGGCCAGG + Intronic
966420426 3:179729267-179729289 ATTACTGCTGAAGGCAGGCCAGG + Intronic
974071086 4:57124377-57124399 ATAATGGCTAAATCAAGGCTTGG - Intergenic
975552487 4:75627564-75627586 ATTAAAACTAAATTCAGGCCGGG - Intronic
976103045 4:81586321-81586343 GTTAAGAATAAATCCAGGCCGGG + Intronic
987409589 5:17601753-17601775 ATTACGGGTAAGTCCAGGATGGG + Intergenic
992876246 5:81058958-81058980 ATTACAGACAAGTCCAGGCCTGG - Intronic
997654435 5:135544780-135544802 AATGCGGCCAAATCCAGCCCGGG - Intergenic
999163038 5:149521580-149521602 ATTACTTCTAAATCGAGGCCGGG - Intronic
1004450229 6:15738656-15738678 ATTCTTGCTAAAGCCAGGCCAGG - Intergenic
1004509942 6:16277274-16277296 TTCTCTGCTAAATCCAGGCCTGG + Intronic
1006508123 6:34503955-34503977 ACTACAGATAAATCCAGGACAGG - Intronic
1015176800 6:130318226-130318248 AGTACAGCTAAAGTCAGGCCTGG + Intronic
1031266962 7:119593142-119593164 ATTAAGGCTAGATCTTGGCCAGG - Intergenic
1034106496 7:148495123-148495145 ATTACTTAGAAATCCAGGCCAGG + Intergenic
1038388541 8:27172977-27172999 ATTACCTCTAAAGCCAGGCATGG - Intergenic
1040991520 8:53356275-53356297 AAAATGGCTAATTCCAGGCCTGG + Intergenic
1042386128 8:68177014-68177036 CTTTGGGCTAAATCCAGGACTGG - Intronic
1046474407 8:114722661-114722683 ATTAAAGAAAAATCCAGGCCTGG - Intergenic
1051520538 9:17982317-17982339 ATTAAGAATAAAACCAGGCCAGG + Intergenic
1187236752 X:17475006-17475028 ATTATGGCTCATTCCAGGGCAGG - Intronic
1187718573 X:22128741-22128763 ATTATTGCTACATCCTGGCCAGG + Intronic
1194586410 X:95740237-95740259 ATCACGGCTTATTGCAGGCCAGG + Intergenic
1201934135 Y:19387594-19387616 ATTATAGAAAAATCCAGGCCAGG - Intergenic