ID: 963188874

View in Genome Browser
Species Human (GRCh38)
Location 3:142447470-142447492
Sequence TTCCCCCATCCCACCCAGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 314}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963188874_963188881 25 Left 963188874 3:142447470-142447492 CCGCTCTGGGTGGGATGGGGGAA 0: 1
1: 0
2: 0
3: 24
4: 314
Right 963188881 3:142447518-142447540 CGCAGCCTCTGTAAGGAAAAAGG 0: 1
1: 0
2: 1
3: 6
4: 145
963188874_963188880 18 Left 963188874 3:142447470-142447492 CCGCTCTGGGTGGGATGGGGGAA 0: 1
1: 0
2: 0
3: 24
4: 314
Right 963188880 3:142447511-142447533 CCAGCTTCGCAGCCTCTGTAAGG 0: 1
1: 0
2: 1
3: 15
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963188874 Original CRISPR TTCCCCCATCCCACCCAGAG CGG (reversed) Intronic
901423852 1:9168783-9168805 TTCTCCCATGTGACCCAGAGAGG - Intergenic
901634659 1:10664948-10664970 GCCCCTCATCCCACCCAGGGAGG - Intronic
901680572 1:10910408-10910430 CACCAGCATCCCACCCAGAGAGG + Intergenic
901687482 1:10951090-10951112 ATTCCCCGTCCCACCCCGAGAGG + Intronic
902967057 1:20012925-20012947 TACCCCCATGGCATCCAGAGGGG + Intergenic
904285613 1:29451668-29451690 TTCCCCCTCCCCACCCCCAGTGG + Intergenic
904419810 1:30384357-30384379 TTCCCCCTCCCCACCCCCAGTGG - Intergenic
906076943 1:43058794-43058816 TCCCCCTTTCCCAGCCAGAGCGG - Intergenic
907402029 1:54230170-54230192 TTCCCCGTGCCCACCCAGACTGG + Intronic
908808720 1:67957611-67957633 TTTTCCTATACCACCCAGAGAGG - Intergenic
910408266 1:86913737-86913759 TTCCCCCCTCCCACCTGGTGTGG + Intronic
910509272 1:87985301-87985323 TCCCCCTAGCCCAGCCAGAGAGG - Intergenic
912238034 1:107873865-107873887 TTCCCCCACCCCAGGTAGAGTGG + Intronic
912695935 1:111842271-111842293 GCCCCCCAACCCACCCTGAGCGG + Intronic
913091459 1:115479189-115479211 TTCTCCCTTCCCACCCAGGCTGG - Intergenic
914830587 1:151168174-151168196 TTCCCCTATGCCACCCTCAGAGG + Exonic
915332594 1:155122533-155122555 TCCCCACATCCCACTCAGAAGGG - Intergenic
919108045 1:193179140-193179162 TTTCCCCATCCCTCCCAAAAAGG + Exonic
920241646 1:204556347-204556369 ATCCCCCATCACACACAGAAAGG - Exonic
920311771 1:205052842-205052864 TGCCCCCATTCCAGCCAGTGGGG - Intronic
924327946 1:242914248-242914270 TTTCCCCATCACAGCCGGAGAGG + Intergenic
1064174421 10:13061964-13061986 TTCCCCCCCACCACCCAGAAAGG + Intronic
1064194088 10:13231450-13231472 TTCCCTCTTCCCACCCACTGTGG + Intronic
1064343272 10:14506609-14506631 TCACCCCATCCCACCCAGGATGG + Intergenic
1066449341 10:35514045-35514067 TTCCTCCACCACACCCTGAGAGG + Intronic
1067164027 10:43851059-43851081 GTCTCCCATCACCCCCAGAGAGG - Intergenic
1067669107 10:48303529-48303551 TTTCCCCATCCCAGCCTCAGAGG + Intergenic
1070644964 10:78195418-78195440 TTCTCCCTTCCCAGCCAGTGGGG - Intergenic
1070765900 10:79056250-79056272 ATGCCCAATCCCACACAGAGAGG - Intergenic
1072487405 10:95869007-95869029 TTCACCTACCCCACCCAGAGTGG - Exonic
1073333304 10:102685579-102685601 TTCTCACATCCCTCCCAAAGGGG + Intronic
1073400039 10:103249935-103249957 TGCCCCCTTCCCACCCACTGTGG - Intergenic
1074699963 10:116084086-116084108 TGCCCCCACCCCACACAAAGAGG + Intronic
1074728122 10:116336324-116336346 TTGCCCCATTCCAGCCACAGTGG - Intronic
1074962450 10:118459580-118459602 TTCCCCCAGCACACCGAAAGAGG - Intergenic
1075720926 10:124586978-124587000 TTCCCCCACACCAGCCAGAAGGG - Intronic
1076135540 10:128043293-128043315 GTCTCCCATCACCCCCAGAGGGG - Intronic
1077915769 11:6610747-6610769 TTCCCCCATCCCTACCACTGTGG + Exonic
1078325865 11:10380366-10380388 TTCCCCCATCCCAGGCATGGGGG - Intronic
1078355740 11:10630182-10630204 TTCACCCACCTCATCCAGAGGGG - Intronic
1079137294 11:17783119-17783141 TACCCCCAGCCCAGCCACAGGGG - Intergenic
1080306724 11:30844591-30844613 TTCCCACATCCCAGCCACACTGG - Intronic
1080515179 11:33013995-33014017 TTCCCCCCTCCCATGCAGTGAGG + Intergenic
1080569337 11:33542213-33542235 TCCCCCCATCCCAGCCAGTATGG + Intronic
1080688166 11:34533153-34533175 TTTCCCCAGCCCACCCAGCAAGG - Intergenic
1081475073 11:43421673-43421695 GTCTCCCATCACACCCAGATGGG + Intronic
1081991145 11:47338346-47338368 TGCCTCCATCTCCCCCAGAGCGG + Intronic
1083472928 11:62896323-62896345 CACCCACATCCCACCCAGGGTGG - Intergenic
1084760478 11:71267724-71267746 TCCCCCAAACCCAGCCAGAGAGG - Intergenic
1085389999 11:76177436-76177458 TTCCCCTCTCCCTACCAGAGAGG - Intergenic
1085640079 11:78188153-78188175 TTCCCCAATCTCACCCAGGCTGG + Intronic
1088555831 11:111059605-111059627 GTCCCCCATCCCACCTCAAGGGG - Intergenic
1089457502 11:118634136-118634158 GTCCCCCTTCCCACCCTCAGAGG + Intronic
1089683656 11:120133507-120133529 TTCCCCCTTAGCACCCAGAGAGG + Intronic
1090653035 11:128823880-128823902 CCCCCCCACCCCACCCAGGGTGG + Intergenic
1091694547 12:2619068-2619090 ACCCCAGATCCCACCCAGAGAGG + Intronic
1093396109 12:18684519-18684541 TTTTCCCATCCCACCCTGATGGG - Intronic
1093886657 12:24469106-24469128 ATCTCCCATCACACCCAGATGGG - Intergenic
1095764319 12:45877423-45877445 TTCTCCCATCACCCCCAGATGGG + Intronic
1096551810 12:52378113-52378135 TGCCCCCTGCCCACCCAGGGGGG - Exonic
1097256665 12:57681680-57681702 TTACTCCATCCTACCCAGGGTGG + Intergenic
1097802095 12:63925840-63925862 TTCCCCTAACCCAGCCACAGTGG + Intronic
1100202115 12:92310262-92310284 TTCCCCCAACCCCCTCAGTGAGG + Intergenic
1102215554 12:111159068-111159090 ATCCCTCATCCCACTCAGACAGG + Intronic
1103201344 12:119090543-119090565 TCCCCACATCCCACCAGGAGTGG + Intronic
1104138490 12:125963055-125963077 TTCCCCTCTGCCACCCAGACTGG - Intergenic
1104152616 12:126098140-126098162 TTCCACCCACCCTCCCAGAGTGG + Intergenic
1104708728 12:130969554-130969576 GTCTCCCATCACCCCCAGAGGGG + Intronic
1105048539 12:133027594-133027616 TTCCAGCTTCCCACCCGGAGTGG + Intergenic
1105767824 13:23579000-23579022 GGCCCGCATCCCAGCCAGAGGGG - Intronic
1107045490 13:35988129-35988151 TTCCTCCCTCCAACCCTGAGTGG + Intronic
1107248782 13:38331536-38331558 CCTCCCCATCCCACCCAGACTGG + Intergenic
1110778807 13:79440942-79440964 GTCCCCCATCACCCCCAGATGGG - Intergenic
1110841263 13:80146239-80146261 TTCACCCATCTCACTCACAGGGG + Intergenic
1112561111 13:100514974-100514996 TTCCCACAGCCCTCCAAGAGCGG - Intronic
1114146720 14:19985786-19985808 CTCCCCCTTCCAACACAGAGTGG + Intergenic
1114664057 14:24368294-24368316 CTCCCCCCTCCCACCCAGGCCGG + Exonic
1114965770 14:27957329-27957351 TTCCTCCATCCCCATCAGAGGGG - Intergenic
1116200337 14:41785743-41785765 GTCTCCCATCACTCCCAGAGCGG - Intronic
1119496498 14:75084140-75084162 TCTCCCTCTCCCACCCAGAGGGG + Exonic
1119655982 14:76417341-76417363 TTCCCACATTCCACCCACACTGG - Intronic
1120157241 14:81107047-81107069 TTCCCTCATCCTGCCCAGAAAGG + Intronic
1120796941 14:88644573-88644595 TCACACCATCCCTCCCAGAGAGG + Intronic
1121010508 14:90517509-90517531 TGCCCCCAGCCCGCCCAGAGCGG + Intergenic
1121364416 14:93294731-93294753 CTCTAACATCCCACCCAGAGAGG + Exonic
1121405015 14:93714435-93714457 CTCCCCCCTCACACCCAGTGAGG + Intergenic
1121598291 14:95183112-95183134 TTCCCACTTCCAACCCAGAGAGG + Exonic
1128865191 15:71109688-71109710 GTCCACCATCACACACAGAGTGG + Intronic
1129344584 15:74908637-74908659 GTCTCCCATCACACCCAGATGGG - Intergenic
1130288178 15:82572505-82572527 TTCCCTCATCCCAACAAGATGGG + Intronic
1130866253 15:87935599-87935621 TTCTCCCATCCCACCCATGCTGG - Intronic
1131716724 15:95119686-95119708 TTCCCGCATCCCTCCCAGCATGG + Intergenic
1133977286 16:10608316-10608338 GTCCCCCATCGCCCCCAGATGGG + Intergenic
1138100973 16:54252264-54252286 GTCTCCCATCACACCCAGATGGG + Intronic
1138545306 16:57715697-57715719 TTCTCCCACGCCACACAGAGGGG + Intronic
1138914552 16:61447547-61447569 GTCTCCCATCCCCCCCAGATGGG - Intergenic
1139761365 16:69187122-69187144 TTCCCTCTTCCCGCCCGGAGGGG - Exonic
1140207518 16:72945914-72945936 TCCCCCCAGCACACCCACAGAGG + Intronic
1141231001 16:82167593-82167615 GTCTCCCATCACACCCAGATGGG - Intronic
1141254239 16:82385945-82385967 TTCCTCCATCCCACACATAATGG - Intergenic
1141254248 16:82385989-82386011 TTCCTCCATCCCACACATAATGG - Intergenic
1142202514 16:88767997-88768019 TTCCCCCAGGCCCTCCAGAGGGG + Intronic
1142753279 17:2000897-2000919 TCCCACCATCCCTCCAAGAGGGG - Intronic
1142756320 17:2018449-2018471 GTCCCAGATCCCAGCCAGAGAGG + Intronic
1144470294 17:15533996-15534018 TTCCTCCACCACACTCAGAGTGG + Intronic
1144779013 17:17798655-17798677 TTCCCCCACACACCCCAGAGAGG - Intronic
1144926048 17:18809684-18809706 TTCCTCCACCACACTCAGAGTGG - Intergenic
1145009724 17:19361130-19361152 GTCTCCCATCACACCCAGATGGG + Intronic
1145838200 17:27970734-27970756 TTCCCCCAGCCCAATCAGTGTGG - Intergenic
1146528301 17:33585498-33585520 TTTTTCCTTCCCACCCAGAGTGG + Intronic
1146689392 17:34862776-34862798 GTCTCCCATCACCCCCAGAGGGG + Intergenic
1146974124 17:37096548-37096570 CTCCTCCATCCTTCCCAGAGAGG + Intronic
1147418380 17:40309602-40309624 TTCCCCCACCTCACCTAGACTGG + Intronic
1147588366 17:41665983-41666005 CTCCCCCATCGCAGCCAGACCGG + Intergenic
1147845697 17:43402617-43402639 TTCCCCAATCCCTAGCAGAGGGG + Intergenic
1147970560 17:44217492-44217514 TTCTCCCAGCCCATCCACAGTGG - Intronic
1149440344 17:56668707-56668729 ATCTCCCATCACCCCCAGAGGGG + Intergenic
1151694117 17:75705434-75705456 TTCCCTCACCCCAAGCAGAGGGG + Intronic
1152310959 17:79549572-79549594 TTCCAGCCTCCCACCCAAAGCGG + Intergenic
1152573787 17:81131544-81131566 TTCCCCCATCCCTCCCTGGCGGG + Intronic
1154389251 18:13922566-13922588 TTCCCACATCCCTCCCAGATTGG + Intergenic
1154463842 18:14623358-14623380 CTCCCCCTTCCAACACAGAGTGG + Intergenic
1155117446 18:22783702-22783724 CTCCCCCTGCCCACCCACAGGGG - Intergenic
1156364366 18:36412091-36412113 ATCCCCCATCCCACGCAGGCAGG + Intronic
1157367142 18:47075593-47075615 TTCCCCCGTTCCCCACAGAGTGG + Intronic
1157395569 18:47338115-47338137 TTCCCTCCTCCCTCCCAGATGGG + Intergenic
1160362741 18:78297480-78297502 TTCCCTCATCCCTTCCTGAGAGG + Intergenic
1160732869 19:649158-649180 TTCCCCCATTCCACCGTCAGGGG - Intronic
1161531782 19:4793897-4793919 TTCCCCCATCTCAGCAGGAGAGG - Exonic
1162551581 19:11361197-11361219 TTCCACTATCCCACCCCTAGGGG + Exonic
1163152684 19:15424465-15424487 ATCCCCCATCCCACCCATCCAGG - Intronic
1163414320 19:17176732-17176754 TTCCCCCATCCTGCCTGGAGTGG + Intronic
1164130934 19:22361281-22361303 TCCCCCCACCCCTCCCACAGTGG - Intergenic
1166549795 19:43657631-43657653 CTCCCCCATCCCACTCTGGGTGG + Intronic
1167166500 19:47803093-47803115 ATCCCCCACCCCACCAAAAGAGG + Intronic
1168714776 19:58520256-58520278 TTCCCCAGTCCCACCCACAGCGG - Intronic
925198361 2:1946211-1946233 GTCTCCCATCACACCCAGATGGG + Intronic
925458437 2:4039724-4039746 TCCCCCCACCCCTCCCACAGTGG + Intergenic
925741731 2:7010780-7010802 TTCCCTGATCCCACCCAGGTGGG + Intronic
927770094 2:25853086-25853108 TTCCCCCTTTCCACCATGAGTGG + Intronic
927794046 2:26033417-26033439 TTACCTCATCCCAACCCGAGCGG + Intergenic
928447329 2:31344971-31344993 TCTCCCCAGCCCAGCCAGAGTGG + Intronic
929281522 2:40085987-40086009 TTTCCCCATGCCACCCAGGCTGG + Intergenic
932851760 2:75194427-75194449 TTCCCTCACCCCACCTGGAGGGG - Intronic
933754212 2:85625137-85625159 ATCCTCATTCCCACCCAGAGTGG + Intronic
934019630 2:87932994-87933016 TTCCCCCAACCTAGCTAGAGGGG - Intergenic
934112561 2:88756819-88756841 CTCCCCCATCTCAGCCAGAATGG - Intergenic
935186247 2:100735858-100735880 TTCCACCATCGCACCCAGGCTGG - Intergenic
936163770 2:110103280-110103302 CTCCCCCATCTCAGCCAGAATGG - Intronic
936169570 2:110156660-110156682 TTGGACCACCCCACCCAGAGAGG - Intronic
937081653 2:119144717-119144739 TTGCCCCATCCCTCCCGGAATGG + Intergenic
937316922 2:120937586-120937608 TTCCCCAACCCCACCCACTGGGG + Intronic
940013521 2:149079810-149079832 TTAAACCAACCCACCCAGAGGGG + Intronic
940913007 2:159225405-159225427 TCCCCACATCCCACCCGGAAGGG + Intronic
941532318 2:166685792-166685814 TTCCCCCATGCCATTAAGAGTGG + Intergenic
941770293 2:169337712-169337734 TTCATCCATTCCACCCAAAGTGG + Intronic
942066197 2:172274153-172274175 ATCCCCCATGCCACCCACATGGG + Intergenic
945505712 2:210637861-210637883 TTCCCCCATCCCCCACTGACAGG + Intronic
946135785 2:217645739-217645761 TTCTACCTTCCAACCCAGAGGGG - Intronic
946286778 2:218710168-218710190 TAACCCCAACCCACCCAGCGGGG - Intergenic
948512030 2:238474849-238474871 TTCCCCCCACCCACCTAGAAAGG - Intergenic
1169338968 20:4781618-4781640 TTCCACCATCCCAGCCAGATAGG + Exonic
1169700467 20:8440631-8440653 TTCCCCCAACCCTTCCAAAGTGG - Intronic
1169895241 20:10498345-10498367 CTTCTCCATCCCACCCAGTGTGG + Intronic
1171035227 20:21708374-21708396 TTCCTCCGCCCCACCCGGAGTGG + Intronic
1171537853 20:25912881-25912903 TTCTCCCATCCCAACAAGAATGG + Intergenic
1172385431 20:34530848-34530870 TCACCCCAGCCCAGCCAGAGTGG + Intronic
1172904301 20:38357432-38357454 GTACCACATCCCACCCTGAGTGG - Intronic
1172948432 20:38706166-38706188 CTCCCCCACCCCACCCTGAGAGG - Intergenic
1173500526 20:43549565-43549587 CTCCCCCTTCCCACCCAGGCTGG - Intronic
1173908459 20:46646026-46646048 TTCCCCCATGCACCCCAGAATGG - Intronic
1174465498 20:50714036-50714058 TGCCCCAATCACAGCCAGAGCGG + Intergenic
1176016713 20:62937741-62937763 TTCCCCCGCCCCACCCCGTGCGG + Intronic
1176041707 20:63069103-63069125 TTCCCCCTTTCCTCCCAGAGAGG + Intergenic
1176159258 20:63640336-63640358 TTCCCACTTGGCACCCAGAGGGG - Exonic
1176810689 21:13535015-13535037 CTCCCCCTTCCAACACAGAGTGG - Intergenic
1178440450 21:32593936-32593958 TTCCCACATCCCACCCTAAATGG - Intronic
1180049079 21:45323214-45323236 TGACCCCATCCCAGCCAGAGCGG + Intergenic
1181052541 22:20244574-20244596 CTCACCCAGCCCACCCAGGGAGG - Intronic
1181266342 22:21633102-21633124 TCTCCCCACCCCACGCAGAGAGG + Exonic
1181550894 22:23638596-23638618 AGCCCCCACCCCACCCACAGGGG - Intergenic
1181624588 22:24114614-24114636 TCCATCCATCCCACCCGGAGAGG - Intronic
1181778761 22:25178284-25178306 TTCCCACTTGGCACCCAGAGGGG - Intronic
1181797392 22:25320093-25320115 AGCCCCCACCCCACCCACAGGGG + Intergenic
1181864690 22:25846082-25846104 TTCCCTCCTCCCCACCAGAGAGG + Exonic
1181991449 22:26839918-26839940 TTCCCTGATCCCAGCCAGAATGG - Intergenic
1182038745 22:27219853-27219875 TCCCCCCACCCCACCCAGGCAGG + Intergenic
1183687388 22:39368951-39368973 TTCTCCCATCTGCCCCAGAGGGG + Intronic
1183740236 22:39664931-39664953 TTCCCCCATCCGCCCAGGAGGGG - Intronic
1183958915 22:41399163-41399185 TTCCTTCTTCCCAGCCAGAGAGG + Exonic
1183988666 22:41583690-41583712 TTCCACCTTCCCACCCACATCGG - Intronic
1184792809 22:46710878-46710900 CTCGCCCAGCCCAGCCAGAGAGG + Intronic
950103137 3:10370421-10370443 TTCCCCCACCCCACCCAATTTGG - Intronic
952907660 3:38153075-38153097 TTTCCCCTTCCCACCCAGCAGGG - Intergenic
953389526 3:42526313-42526335 GCACCCCATCCCATCCAGAGGGG + Intronic
953406018 3:42660174-42660196 CTGACTCATCCCACCCAGAGTGG - Intronic
957098280 3:75798320-75798342 TTCCCCCAACCTAGCAAGAGAGG - Intergenic
959688439 3:109172597-109172619 TTCTCCCACCCCTCCCAAAGAGG - Intergenic
960139641 3:114139694-114139716 TTCCCCCTTCTCATCCACAGGGG - Exonic
960950898 3:122997838-122997860 CTGCCCCACACCACCCAGAGTGG + Intronic
961417870 3:126774548-126774570 CTTCCCCATCCCAGCCAGGGTGG - Intronic
961580831 3:127880657-127880679 TTCTCCCATCACCCCCAGATGGG - Intergenic
963121951 3:141783836-141783858 CTCCTCCTTCCCACCCACAGAGG - Intronic
963188874 3:142447470-142447492 TTCCCCCATCCCACCCAGAGCGG - Intronic
963598451 3:147357140-147357162 GTCCCGCTTCCAACCCAGAGAGG + Intergenic
964419488 3:156486454-156486476 AACCCCCATCCCAACCAGGGTGG - Intronic
965876245 3:173324790-173324812 ATGCCCCACCCCACCCAGGGTGG - Intergenic
966714119 3:182998942-182998964 TTTCCCCAACCCAGCTAGAGAGG - Intergenic
967009902 3:185423059-185423081 GTCCCCCATCACCCCCAGATAGG + Intronic
967118154 3:186360755-186360777 TTCCCCCATCCAGACCAGAGGGG + Intronic
970405909 4:15764103-15764125 TATCAACATCCCACCCAGAGGGG - Intergenic
973565006 4:52176686-52176708 TTCTCCCCTCCCTACCAGAGAGG - Intergenic
974708827 4:65560578-65560600 TTCCCCTATCTCTCCTAGAGTGG - Intronic
975477909 4:74844151-74844173 GTCCCCCATCACCCCCAGATGGG + Intergenic
975556602 4:75672404-75672426 TCCCCCCATCCCAACAAAAGCGG + Intronic
975882635 4:78928881-78928903 GTCTCCCATCACCCCCAGAGGGG - Intronic
978348907 4:107800711-107800733 TTCCCCTATCCCACTCCCAGTGG + Intergenic
981015401 4:139969024-139969046 CCCTCCCATCCCAGCCAGAGTGG + Intronic
981528503 4:145731315-145731337 TTCCCCAACCCCTCCCAGAAAGG + Intronic
985887553 5:2691700-2691722 TTCCCCCATCCCATGAATAGTGG + Intergenic
986247077 5:6018648-6018670 CTCCCCATTCCCACCCACAGTGG - Intergenic
986308164 5:6531029-6531051 CTCCCCCATCCCACCCCTATAGG - Intergenic
986332004 5:6724202-6724224 TTCCCACCTCCCCCACAGAGAGG + Intronic
988798398 5:34673824-34673846 TTCCCAATTCTCACCCAGAGAGG + Intronic
989153338 5:38321164-38321186 TTCTCCCATCACCCCCAGATGGG - Intronic
989461747 5:41707518-41707540 TTCCCCCAACCTCACCAGAGAGG - Intergenic
991106696 5:62851673-62851695 TCCCCCCATCCCAGTCATAGAGG - Intergenic
991666649 5:69006139-69006161 TTCCCTCATCCCAGCCTGAAAGG - Intergenic
991670093 5:69038572-69038594 GTCTCCCATCACACCCAGATGGG - Intergenic
991772106 5:70050022-70050044 CTCCCCCACACCAGCCAGAGAGG - Intronic
991851399 5:70925440-70925462 CTCCCCCACACCAGCCAGAGAGG - Intronic
992778219 5:80106194-80106216 TACCCCCTCACCACCCAGAGAGG + Intergenic
992799732 5:80285010-80285032 CCTCCCCACCCCACCCAGAGAGG + Intergenic
993491594 5:88558306-88558328 TTCCCCCGACCCACCCCGGGTGG + Intergenic
998106727 5:139473554-139473576 TTCCCCCATCCCTTCTGGAGAGG - Intergenic
1001143490 5:169164454-169164476 CTTCACCATCCCACCCAGAGTGG - Intronic
1001666515 5:173437775-173437797 TTCCCCCAACCTATCCATAGAGG - Intergenic
1002161038 5:177314282-177314304 CACCCCTATCCCACCCAGACTGG - Intergenic
1002399028 5:178981002-178981024 TTCCCCCATCCCCCCGGGATTGG - Exonic
1003111989 6:3258744-3258766 TTTCCCCAGCCCGTCCAGAGAGG + Intronic
1003486457 6:6584325-6584347 GTCCCCCATCACCCCCAGATGGG - Intergenic
1005036313 6:21558244-21558266 TTTCCCCTTCCCACCAAGTGAGG + Intergenic
1006138596 6:31912996-31913018 TTTCACCATCTTACCCAGAGTGG - Intronic
1007853599 6:44830629-44830651 TTCCACCATAAGACCCAGAGGGG + Intronic
1008109755 6:47478605-47478627 CTCCCCCATCCCACGAGGAGGGG - Intronic
1008160332 6:48068687-48068709 CTCCCCCATCCCACCCCCTGGGG + Exonic
1009674149 6:66795138-66795160 GTCTCCCATCCCTCCCAGATGGG - Intergenic
1009925760 6:70118867-70118889 TTCTCCCACCCCACCCCCAGTGG + Intronic
1010020877 6:71158650-71158672 TTCCCCCAGCCCATCTAAAGGGG + Intergenic
1010169333 6:72956828-72956850 TTCCCCCCTCCCACCAAGATGGG + Intronic
1011169830 6:84493141-84493163 TTCCCCTAACCCCCTCAGAGAGG + Intergenic
1012492486 6:99797841-99797863 CTCCCCTACCCCAGCCAGAGTGG - Intergenic
1014335772 6:120134242-120134264 GTCTCCCATCACACCCAGATGGG - Intergenic
1016442478 6:144097927-144097949 ATCCCCCATCACCCCCAGATGGG - Intergenic
1016897691 6:149069614-149069636 CTCCCCCATCCTAACCATAGAGG + Intronic
1018066007 6:160125545-160125567 TGCCCACATCCCTCCCTGAGTGG - Intronic
1018066185 6:160126448-160126470 TGCCCACATCCCTCCCCGAGTGG - Intronic
1018066281 6:160126941-160126963 TGCCCACATCCCTCCCTGAGTGG - Intronic
1019579321 7:1752269-1752291 GACCCCGACCCCACCCAGAGGGG + Intergenic
1021891243 7:25188218-25188240 CTCCCCCATCTCACCAGGAGAGG + Intergenic
1023816741 7:43956335-43956357 GTCCCCCAGCCCACCCACAATGG + Intergenic
1024430838 7:49286163-49286185 CTTCCCCATCCCATCCCGAGTGG + Intergenic
1024491071 7:49986391-49986413 TTCCCCCTTCCCTCCCAGCTGGG + Intronic
1024639443 7:51317086-51317108 ATCCCCCACTCCGCCCAGAGAGG - Intergenic
1024766749 7:52669062-52669084 TTACCCCACCCCAACCACAGAGG + Intergenic
1025971006 7:66325488-66325510 TTCCCCCCTCCCCCCAAGACAGG + Intronic
1026807262 7:73436130-73436152 TCCCCCCTTCCCAGCCAGAGAGG - Intergenic
1026842781 7:73679753-73679775 TTCCCCCCACCCACTCAGATTGG - Intergenic
1027270276 7:76515120-76515142 CCACCACATCCCACCCAGAGAGG + Exonic
1027482696 7:78718597-78718619 GTCCCCCATCACCCCCAGATGGG + Intronic
1028329819 7:89576339-89576361 TTCCCCCAACCTAGCTAGAGAGG + Intergenic
1031564990 7:123285185-123285207 TTCCCCCATCACACCATGTGGGG + Intergenic
1032398503 7:131607776-131607798 TTCCCCCTTGGCTCCCAGAGAGG - Intergenic
1032810815 7:135415027-135415049 ATCCCCCACCCCACCAACAGAGG + Intronic
1033499711 7:141935746-141935768 CTACCCCATCCCACCCACTGAGG + Intronic
1034108692 7:148515102-148515124 TTCCCCCAGACCACTCAAAGAGG + Intergenic
1034337225 7:150331295-150331317 GTCTGCCATCCCACCCTGAGCGG - Exonic
1035746852 8:1967260-1967282 TTCCCCCATCCCCCCGCGTGTGG - Intergenic
1035842347 8:2826368-2826390 TTTCTCCCTCCCACTCAGAGCGG - Intergenic
1036038182 8:5043037-5043059 GTCCCCCATCACCCCCAGAAGGG - Intergenic
1037209222 8:16364952-16364974 TTCAGCCTTCCCAGCCAGAGAGG - Intronic
1037410000 8:18586209-18586231 TACTCCCATCCCAGCCAAAGTGG - Intronic
1037719820 8:21432957-21432979 TTCCCCCAACCCAGCAAGACAGG + Intergenic
1037759100 8:21730032-21730054 GCCCCCCCTCCCACCAAGAGAGG - Intronic
1037812656 8:22096218-22096240 TTCCCCCACCTCTCCCAGACAGG + Intronic
1038511394 8:28139187-28139209 TACCCCCAACCCACCCCTAGAGG - Intronic
1038664788 8:29528854-29528876 TGCCCCAGTCCCACCCTGAGTGG - Intergenic
1038681295 8:29670813-29670835 TTCTCCCATCACCCCCAGATGGG + Intergenic
1038687221 8:29729478-29729500 GTCTCCCATCACCCCCAGAGGGG - Intergenic
1038863612 8:31414662-31414684 GTCTCCCATCACACCCAGATGGG - Intergenic
1039021448 8:33211578-33211600 TTCCCCTCTCCTGCCCAGAGAGG + Intergenic
1039058162 8:33553099-33553121 TTCCCCCATAGCACACATAGAGG - Intronic
1039086022 8:33780915-33780937 TTCCCCCACCCTGCCCAGATTGG + Intergenic
1040587493 8:48757216-48757238 TTCCCCCAACCCCTCCAAAGTGG - Intergenic
1041063827 8:54061774-54061796 TTACCCCCTGCCCCCCAGAGAGG - Intronic
1045137623 8:99238395-99238417 TTCCCCTAATCCCCCCAGAGTGG - Intronic
1047914241 8:129565112-129565134 TCCCCACATGCCCCCCAGAGTGG - Intergenic
1048580614 8:135727467-135727489 TCCCCCCATCCCAGCCATATGGG + Intergenic
1048780742 8:137997300-137997322 TTCTCCCATCACTCCCAGATGGG + Intergenic
1049039732 8:140103403-140103425 GTCCCCAACCCCACCCACAGGGG + Intronic
1049453543 8:142675451-142675473 TTCCCCAAGCCCACCCAGCTGGG - Intronic
1049662898 8:143828326-143828348 TTCCCCCAGCCCACACCCAGCGG - Intronic
1049795181 8:144493876-144493898 CTCCCCCACCCCACCCAGCACGG - Intronic
1051899415 9:22023166-22023188 CTTCCCCATCCTAGCCAGAGAGG - Intronic
1052667838 9:31517927-31517949 TTCCCCCAACCTAGCAAGAGAGG - Intergenic
1052987985 9:34501959-34501981 TTCCCCCTTCCCAACGGGAGAGG + Intronic
1055531871 9:77192884-77192906 TTTCCCCATCCTAGCTAGAGAGG - Intronic
1056821297 9:89843941-89843963 TGTCCCCATCCCACCCAGAAAGG - Intergenic
1057144804 9:92750863-92750885 TTCCCCCATCCCCTTCAGTGAGG - Intronic
1058068089 9:100571811-100571833 GTCCCCCATCACCCCCAGATGGG - Intronic
1058349851 9:104009057-104009079 TTCCCCCATCTCCCTCAGTGGGG + Intergenic
1060300500 9:122371966-122371988 CTCCCCCATGAAACCCAGAGTGG - Intronic
1060829640 9:126705615-126705637 TTCCCCCACGCAACCCTGAGTGG + Intergenic
1061290904 9:129649807-129649829 TTCCCCCATCTCACCCTGGCTGG + Intergenic
1061352768 9:130078840-130078862 TTACCCCATCCCACCCAGGAGGG - Intronic
1062278186 9:135740425-135740447 TTCCCCCAGTCAGCCCAGAGGGG + Intronic
1062303708 9:135890035-135890057 CCCTCCCATCCCACCCCGAGGGG - Intronic
1185550587 X:980522-980544 TTCCTCCATCCCAGCCCCAGGGG - Intergenic
1185600698 X:1336937-1336959 TTCCCTCATCCCACCCTGGAGGG - Intronic
1185650076 X:1641432-1641454 TGTCCCCATCACACACAGAGCGG - Intronic
1185650123 X:1641680-1641702 TGTCCCCATCTCACACAGAGAGG - Intronic
1185884260 X:3768326-3768348 TTTCGCCATGTCACCCAGAGTGG + Intergenic
1186154059 X:6707505-6707527 TTCTCCCATCACCCCCAGATGGG - Intergenic
1187181297 X:16946413-16946435 TGCCCCCTTCCCAACCAGGGCGG + Intergenic
1187488117 X:19723866-19723888 ATTCCCCACCCCACCAAGAGGGG - Intronic
1188003175 X:25001038-25001060 TTCCCTCAACCCTCCCACAGAGG + Intergenic
1189885772 X:45543000-45543022 TTGCCCCATCCCACCCATGGTGG + Intergenic
1190885872 X:54530538-54530560 TTGCCCCATCCCACCTAGAAAGG + Intronic
1195287395 X:103398321-103398343 TTACCTCCTCCCTCCCAGAGAGG + Intergenic
1195548573 X:106140225-106140247 TTCCCCCAACCTACCTAGAGAGG + Intergenic
1199124897 X:144106141-144106163 TTCCCCCAACCTAGCTAGAGGGG + Intergenic
1200117414 X:153775454-153775476 TGCCCCCATCGCACCCTGGGCGG + Intronic
1200150113 X:153947195-153947217 TCCCCCCAACCCACCCAAGGAGG + Intergenic
1200956571 Y:8954267-8954289 TTCCCCTTGGCCACCCAGAGTGG - Intergenic
1201225353 Y:11813206-11813228 TTTCCCCATCACAGCCAGAGAGG + Intergenic
1202277460 Y:23138471-23138493 TTCCCCCGCCCCACCCAAAGGGG - Intronic
1202288568 Y:23282217-23282239 TTCCCCCGCCCCACCCAAAGGGG + Intronic
1202430452 Y:24772194-24772216 TTCCCCCGCCCCACCCAAAGGGG - Intronic
1202440340 Y:24897893-24897915 TTCCCCCGCCCCACCCAAAGGGG + Intronic