ID: 963190028

View in Genome Browser
Species Human (GRCh38)
Location 3:142459709-142459731
Sequence TCATACATGCAGGTTCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 6, 2: 14, 3: 37, 4: 174}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963190028 Original CRISPR TCATACATGCAGGTTCTGCA GGG Intronic
902393645 1:16120394-16120416 TCAGAGATGAAGGTTCTGCTAGG + Intergenic
904975883 1:34455933-34455955 TCATGCATCCTAGTTCTGCAAGG - Intergenic
906359231 1:45138592-45138614 TCAAATAAGCAGGTTCCGCAGGG + Intronic
912374813 1:109201482-109201504 GCATACAAGCAGGTCCTCCAGGG + Intronic
913027439 1:114858695-114858717 TCATACTTGCAGTTCCTGAATGG - Exonic
917445093 1:175100006-175100028 GGATGCATGCAGGTTCTCCATGG - Intronic
918684202 1:187395393-187395415 TGATAGATGCAGATTCTGCTAGG + Intergenic
921156619 1:212444111-212444133 TCACACATGCAGGCTGAGCAGGG - Intronic
921869845 1:220128179-220128201 TCATATATGCAGTTTCAGCAGGG + Intronic
922793297 1:228322601-228322623 TCATATATATAGGTTCTGCAGGG - Intronic
923554822 1:234992307-234992329 TCATACCTGCAGATTCTGCAGGG - Intergenic
923686593 1:236157674-236157696 TTGTACATGCAGGTTCTACAGGG - Intronic
923861660 1:237897911-237897933 ACCTATATGCAGGTTCTGCAGGG - Intergenic
923916306 1:238510124-238510146 TCATCCATCCACGTTCTGGAGGG + Intergenic
1063603642 10:7504939-7504961 TCTGACAAGCATGTTCTGCATGG - Intergenic
1065330063 10:24586665-24586687 TCATTCAGGCAGGATCTTCAAGG + Intronic
1066346126 10:34588520-34588542 TCATACATGGAGGTTGTACATGG - Intronic
1067169067 10:43891082-43891104 TCCTAGAATCAGGTTCTGCAAGG + Intergenic
1068482085 10:57604333-57604355 TTGTTTATGCAGGTTCTGCAGGG - Intergenic
1069624000 10:69855967-69855989 TCATTCATGCATATTCAGCAAGG + Intronic
1070583114 10:77738927-77738949 CCATACATGCAGGTACTGCAGGG + Intergenic
1073641220 10:105254575-105254597 TCTTACATGCAGGTTCTGCAGGG - Intronic
1074113781 10:110440735-110440757 TCATTCATTCAGGATCTCCAAGG + Intergenic
1075076533 10:119354864-119354886 TCATATACTCAGGTTCTGTAGGG + Intronic
1079907193 11:26263401-26263423 TCATACTTTCAGGTTCTACCAGG + Intergenic
1083615766 11:64025463-64025485 TCATCCATGCAGGAAATGCATGG - Intronic
1083832710 11:65243054-65243076 TTAAACATGCAGCTTCTGCAAGG - Intergenic
1084462739 11:69305164-69305186 TAATACGAGCAGGTTCTTCATGG - Intronic
1084643449 11:70439909-70439931 TCATAGATGTGGGTTCTGCAGGG - Intergenic
1087853440 11:103060484-103060506 TTATACAGGCAGGTTCCACAGGG + Intergenic
1087965965 11:104416033-104416055 TTATACATGCAGGTTAAGCAGGG + Intergenic
1088094305 11:106080248-106080270 TCATATATGCAGGTTCCATAGGG + Intronic
1088295027 11:108283737-108283759 TCATATACGTGGGTTCTGCAGGG - Intronic
1089562967 11:119354866-119354888 TCATATACGCAGGTTCTGCAGGG + Intergenic
1090754714 11:129779753-129779775 TCAGACAGGCAGCTTCTCCAAGG + Intergenic
1091094488 11:132807544-132807566 TCACACATACTGGTTCTGAATGG + Intronic
1091293586 11:134456661-134456683 TCAGAAATGGAGGTACTGCAAGG + Intergenic
1091804896 12:3348755-3348777 TCATGTATGTGGGTTCTGCAGGG - Intergenic
1093743194 12:22711553-22711575 TCATTTATGGAGGTTCTGTAAGG + Intergenic
1094548079 12:31423591-31423613 TCATACCTGGTGATTCTGCAAGG + Exonic
1098266574 12:68727789-68727811 TCGTATATGCAGGTTCTGCAGGG - Intronic
1098450876 12:70616945-70616967 TTGTATATGCAGGTTTTGCAAGG - Intronic
1099460380 12:82913883-82913905 TCCTATATTCTGGTTCTGCAGGG - Intronic
1101213631 12:102559779-102559801 TCATATATGCTGGTTCTGCAGGG + Intergenic
1101502426 12:105316597-105316619 TCATATAAGCAGATTCTGCAGGG + Intronic
1104191534 12:126486209-126486231 TCACATATGCATGTTCTGCAGGG - Intergenic
1105024089 12:132837183-132837205 TCATACATGCTGGGCCTTCAAGG + Intronic
1106621165 13:31372581-31372603 TAATACCTGCCAGTTCTGCATGG - Intergenic
1111158814 13:84365885-84365907 TCATACATGCAGGTTCTGTACGG + Intergenic
1112650908 13:101397266-101397288 TGATACATGCAGGATCTGCATGG - Intronic
1113803353 13:113097737-113097759 ACAAAGATGCAGTTTCTGCAGGG + Intronic
1114480464 14:23030621-23030643 TCATATATGCAGGTTCTGCAGGG - Intronic
1114860897 14:26520297-26520319 TCCTACATGCAGGCTCCCCAGGG + Intronic
1115919155 14:38353738-38353760 ACATATATACAGGATCTGCATGG + Intergenic
1117348741 14:54860071-54860093 TCATATATGCAGGTTCTGCAGGG - Intronic
1118741623 14:68743718-68743740 TCTTAAACGCATGTTCTGCACGG + Intergenic
1118963426 14:70556770-70556792 TCGTATACACAGGTTCTGCAGGG + Intergenic
1119105120 14:71916447-71916469 TTATAAATCCAGGTTCTTCAAGG + Intergenic
1119986033 14:79138458-79138480 TCAGACATGTATGTTCTGAAAGG + Intronic
1121656522 14:95600728-95600750 TCCTCCATGGAGTTTCTGCACGG + Intergenic
1124050050 15:26188638-26188660 ACAAACCTGCATGTTCTGCAGGG + Intergenic
1125873055 15:43119980-43120002 TTGTACATGCGGGTTTTGCAGGG - Intronic
1126536831 15:49775463-49775485 TCAAACACGCAGCTTCTGCTGGG + Intergenic
1128761652 15:70220149-70220171 TCATATATGCAGGTTCTGCAGGG - Intergenic
1129809198 15:78493328-78493350 TCATATATGTGGCTTCTGCAAGG - Intronic
1131322186 15:91405101-91405123 TGATACCTGCATGTTCAGCATGG + Intergenic
1134139652 16:11706979-11707001 TCATACAGGCAGGCTCTGAAGGG + Intronic
1137527573 16:49249771-49249793 TCTTACTTGCAGATTCTGGAAGG - Intergenic
1142381542 16:89735214-89735236 TCCTAAGTGCAGGTTCTGTAGGG + Intronic
1147248375 17:39137648-39137670 TCAGACATGCACGTTCTCAAGGG + Intronic
1152082940 17:78199774-78199796 TCTGAGATGCAGGTTCTACAGGG + Intronic
1153178443 18:2405725-2405747 TCATACAGGAAGGCTTTGCAGGG + Intergenic
1153206863 18:2712544-2712566 TCATATACACAGGTTCTGCAGGG + Intronic
1156896118 18:42247819-42247841 TCATTCATGTAGAGTCTGCATGG - Intergenic
1159034140 18:63261057-63261079 TGATTCATGCAGGTACTGCCAGG + Intronic
1159080669 18:63731787-63731809 TGATCCACACAGGTTCTGCAAGG - Intergenic
1160374031 18:78397423-78397445 ACATCAATGCAGGTCCTGCACGG + Intergenic
1161349064 19:3782624-3782646 CCATGCAGGCAGGTTCTGGAAGG + Intronic
1163503498 19:17689556-17689578 TCATAAATGCAGAATGTGCATGG + Intergenic
925007479 2:455267-455289 TCACACAAGCAGGTTCTGCAGGG - Intergenic
925668909 2:6290800-6290822 TCATGCCTCCAGGTGCTGCATGG - Intergenic
926304656 2:11629169-11629191 GCATGCATCCAGGGTCTGCAGGG - Intronic
929020895 2:37552150-37552172 TCAGTCAAGCAGGTTCTTCAGGG + Intergenic
929165069 2:38874012-38874034 TCCTCTATGCAGGTTCTACAGGG - Intronic
929207939 2:39319445-39319467 TCATATATGTGGGTTTTGCAGGG + Intronic
929214240 2:39393796-39393818 TCATATACACAGGTTCTGCAGGG - Intronic
929727734 2:44448175-44448197 TCATATATGCAGTTTCTGCAGGG - Intronic
930289136 2:49471456-49471478 TCATATACGCAGGCTCTGAAGGG + Intergenic
932115931 2:69047113-69047135 TAGTATATGCAGGTTCTGCAGGG + Intronic
935169148 2:100597056-100597078 TCGTATAGGCAGGTTCTGCAGGG - Intergenic
935441359 2:103100501-103100523 TAAAACAGGCAGGTTCTTCAGGG - Intergenic
936363134 2:111825404-111825426 ACCCATATGCAGGTTCTGCAGGG - Intronic
936846069 2:116835034-116835056 TTTTATATGCGGGTTCTGCAGGG - Intergenic
941875637 2:170430095-170430117 TCATATATGTGGGTTCTTCAGGG + Intronic
942003957 2:171679061-171679083 TCATACAAGCAGGCCCTCCAAGG + Intergenic
942624517 2:177885367-177885389 TCATATCTGTGGGTTCTGCAGGG + Intronic
943477441 2:188375957-188375979 TCATATATACGGGTTCCGCATGG - Intronic
943597438 2:189875358-189875380 TCATATATGTGGGTTCTGGAGGG - Intronic
944027077 2:195183205-195183227 TCATATAGGCAGTTTCTGCCTGG + Intergenic
945205152 2:207323595-207323617 TCAATCATGCAGTTTGTGCATGG - Intergenic
945955675 2:216083744-216083766 TCTTAATTGCAGGTTCTGCCTGG - Intronic
946377614 2:219322457-219322479 TCATACTTCCAGGTTTTTCATGG - Intergenic
947134639 2:226965044-226965066 TCATACTTGGAGGTTCTGGGTGG - Intronic
947726055 2:232401509-232401531 TAATACAAGCAGGCTGTGCACGG - Intergenic
947955799 2:234189712-234189734 GCATGCAGGCAGGTTCTACATGG + Intergenic
1172695350 20:36818691-36818713 TTATACAAGCAAATTCTGCATGG + Intronic
1173260043 20:41425924-41425946 TCACACATGGAGCTTCAGCATGG - Intronic
1174491379 20:50899133-50899155 TGGTATATGCAGGTTCTCCAGGG + Intronic
1174996929 20:55580466-55580488 TTAAACATGCGTGTTCTGCAAGG - Intergenic
1177910744 21:27028308-27028330 TCCTACATATGGGTTCTGCAGGG - Intergenic
1178692512 21:34761349-34761371 TCATGCATGCAGCTCCTGCAAGG + Intergenic
1179363313 21:40733118-40733140 ACATGCATGCAGGTGCTGGAGGG + Intronic
1182382623 22:29905225-29905247 TCATATAGGCAGGTTCCACAGGG - Intronic
1184325216 22:43777874-43777896 TCCCACCAGCAGGTTCTGCAAGG - Intronic
1184859755 22:47166663-47166685 TCATACATGTACGCCCTGCAGGG + Intronic
950277128 3:11671518-11671540 TCATACAGGTGGGCTCTGCAGGG - Intronic
950535114 3:13574209-13574231 TCACACACGCAGGTTCTGCAGGG - Intronic
950841521 3:15972990-15973012 TCATATATGCATGTTCCTCAGGG + Intergenic
951705453 3:25539983-25540005 TCGTACACACAGGTTCTGCAGGG + Intronic
954229315 3:49204328-49204350 TCATATATACTAGTTCTGCAGGG + Intronic
955107013 3:55908147-55908169 GTAAACATGCAGGTTCTACATGG + Intronic
955425851 3:58788912-58788934 TCATATATGTGGGTTCTGCATGG - Intronic
956171591 3:66437693-66437715 TGCTACATGCAGCTGCTGCAAGG + Intronic
956677318 3:71748287-71748309 TCATATATATGGGTTCTGCAGGG + Intronic
957518711 3:81290871-81290893 TCACATATGAAGGTTCTGCAGGG - Intergenic
958882695 3:99691057-99691079 TCCTGTATGCAAGTTCTGCAGGG + Intronic
961983609 3:131107615-131107637 GTATATATGAAGGTTCTGCAGGG - Intronic
962347938 3:134634768-134634790 TCCTACATGGGGTTTCTGCAGGG + Intronic
963190028 3:142459709-142459731 TCATACATGCAGGTTCTGCAGGG + Intronic
963836017 3:150058716-150058738 ACATACATGCATGTGCTTCAGGG - Intergenic
964423550 3:156529889-156529911 TCATAGATGCAGTGTCTGCTGGG - Intronic
965604700 3:170486358-170486380 TCATCCACACAGGTGCTGCAAGG - Exonic
968532663 4:1102345-1102367 TCCTGTATGCAGGTTCTACAAGG - Intronic
970173834 4:13316646-13316668 TCAAACAAACACGTTCTGCATGG - Intergenic
970490496 4:16568676-16568698 TCTTATCTGTAGGTTCTGCAGGG - Intronic
974460709 4:62184260-62184282 TCATACCTGCAGGTTTCACAGGG - Intergenic
975464353 4:74692723-74692745 TCATATCTGTGGGTTCTGCATGG - Intergenic
975850476 4:78566764-78566786 TCTTACATGCAGATGGTGCATGG - Intronic
976683989 4:87790095-87790117 GAATACATGAAGGTTTTGCAGGG + Intergenic
978518353 4:109593523-109593545 TCATACATGCAGATACAGAAAGG - Intronic
978566614 4:110089393-110089415 TCATATATGTAGGTTCCTCAGGG + Intronic
980192700 4:129544986-129545008 TCATAGATGAAGATTCTTCATGG + Intergenic
980999734 4:139817350-139817372 TCATCCATGCAAATTCTGCCAGG + Intronic
981312947 4:143314454-143314476 TCATTCCTGAAGGCTCTGCATGG - Intergenic
982704713 4:158694957-158694979 TCATATATGTGAGTTCTGCAGGG - Intronic
982971305 4:161991661-161991683 TCATATATGCAGTTTCCACAGGG + Intronic
984925869 4:184806172-184806194 TCAAACAAGCAAGGTCTGCAAGG + Intronic
985038197 4:185862274-185862296 GCACACAGGCAGATTCTGCAGGG + Intronic
986173300 5:5331251-5331273 TCCTACAGGCAGGTTCTGCATGG + Intergenic
987543251 5:19282108-19282130 TCATGCATTCAGCTTCTTCATGG - Intergenic
987549875 5:19365688-19365710 ACATTCAGGCAGGTTCTGGATGG + Intergenic
990786585 5:59427174-59427196 TGCTACATGCAGTTTCTACAGGG + Intronic
992263879 5:74998047-74998069 TCATATATGTGGGTTCTGCAGGG - Intergenic
992472789 5:77075030-77075052 TCATAGAGGCAGGATGTGCAAGG + Exonic
992754542 5:79891870-79891892 TCCTATATGCTTGTTCTGCAGGG - Intergenic
993277691 5:85882327-85882349 CCATTCATCCAAGTTCTGCAAGG + Intergenic
993970413 5:94412897-94412919 GCATATATGCAGGTTCTGTGGGG + Intronic
994001363 5:94784287-94784309 ACATAAATGCATGTTCTGCTTGG - Intronic
995405530 5:111790930-111790952 TCATATATGTGGGTTCAGCAGGG + Intronic
995506491 5:112866010-112866032 TCAAACATGCAGGCTGGGCATGG - Intronic
996215542 5:120860847-120860869 TTATATATGTGGGTTCTGCAGGG + Intergenic
999408652 5:151329941-151329963 TCATATACTCAGGTTCTGCAGGG + Intronic
999773311 5:154791716-154791738 TCATATATGTAGGTCCTGCAGGG - Intronic
1000921890 5:167147962-167147984 TCATACATCCTCATTCTGCATGG - Intergenic
1001361682 5:171091936-171091958 TCATATATGCAGGTTCCACAGGG + Intronic
1002588955 5:180274627-180274649 TCACAGATGGAGGTTCTGGAAGG - Intronic
1003363349 6:5449978-5450000 TCATACACACAGGTTCCTCAGGG - Intronic
1004486717 6:16073128-16073150 TCATATATGCAGGTTCCTCAGGG - Intergenic
1006421929 6:33940027-33940049 TCAGAGATTCAGGTTCTGGAGGG - Intergenic
1006552126 6:34833205-34833227 TCATATATGCAGGTCCCTCAGGG + Intronic
1007751852 6:44075924-44075946 TCATCCAGGCAGGGTCTGGAAGG - Intergenic
1009305123 6:62079920-62079942 TCAAGCATGGAGGTACTGCAAGG + Intronic
1011667205 6:89646079-89646101 TCATGTATGCGGGTTCTCCAGGG - Intronic
1018162881 6:161064800-161064822 TATTACTTGCAGGTTCTGGAGGG + Intronic
1018291310 6:162294563-162294585 TCATTCCTGCAGTTTCAGCAGGG - Intronic
1020388897 7:7637284-7637306 TTATACAGGCAGTTTCTGCCTGG + Intronic
1021661385 7:22921747-22921769 TTGTATATGCAGGTTCTGCAAGG - Intergenic
1022480530 7:30740512-30740534 TGATTCATGGAGGTTCTGCCAGG - Intronic
1023329433 7:39099070-39099092 TCATAAATGGAGGTTCTACAGGG + Intronic
1024562481 7:50656061-50656083 TTCTACATGCAGGTACTGCCTGG - Intronic
1025173479 7:56782617-56782639 TCATATATCCAGGTTTTGCAGGG + Intergenic
1025698624 7:63795554-63795576 TCATATATCCAGGTTCTGCAGGG - Intergenic
1025830397 7:65044109-65044131 TTTCACATTCAGGTTCTGCAGGG - Intergenic
1025917557 7:65877893-65877915 TTTCACATTCAGGTTCTGCAGGG - Intronic
1025936067 7:66038427-66038449 TCCTAGCTGCTGGTTCTGCAAGG - Intergenic
1025948152 7:66120806-66120828 TCCTAGCTGCTGGTTCTGCAAGG + Intronic
1026073025 7:67139568-67139590 TCATATCTGTGGGTTCTGCAGGG - Intronic
1026703860 7:72672648-72672670 TCATATCTGTGGGTTCTGCAGGG + Intronic
1027305781 7:76895128-76895150 TCTTACAGGCAGGGTCTGGACGG + Intergenic
1029168464 7:98614280-98614302 TCATACATGCAGGATCTTTCAGG + Intergenic
1030087280 7:105827595-105827617 TCATATATTCGGGTTCCGCAAGG + Intronic
1030203090 7:106925558-106925580 TCATGTATCCAGGTTCTGCAAGG + Intergenic
1031458299 7:122011793-122011815 TGATGCATGCACGTTCTTCAGGG + Exonic
1032607701 7:133374474-133374496 TCATACAGGCAGCTTCTCCAAGG - Intronic
1032644468 7:133807092-133807114 TCATATACGCAGGTTCTGCAGGG + Intronic
1034507414 7:151504428-151504450 TCATATATGCAGATTCTGCAGGG - Intronic
1035121038 7:156567295-156567317 CCATACCTTCAGGTTCTGCCAGG + Intergenic
1035308399 7:157948970-157948992 TTATAAATGTGGGTTCTGCAGGG + Intronic
1037181159 8:16007049-16007071 ACAAACCTGCAGGTTCTGAAGGG + Intergenic
1037447908 8:18986203-18986225 TCATTAATGCAGTTTCTCCAGGG - Intronic
1038514860 8:28179112-28179134 TCATAGACGCAGCTTCTGCAGGG + Intronic
1039122190 8:34159482-34159504 CCATGTCTGCAGGTTCTGCATGG - Intergenic
1040045145 8:42955274-42955296 TCACATAGGGAGGTTCTGCAGGG + Intronic
1041887063 8:62822436-62822458 ACATACATGCTGATTTTGCATGG + Intronic
1043352389 8:79376966-79376988 TTTGACATGCAGGTTCTCCAAGG + Intergenic
1044141054 8:88653302-88653324 ACATACATGCAGGTTACGGAAGG - Intergenic
1046548847 8:115686479-115686501 CCACACATCCAGATTCTGCAAGG + Intronic
1048566560 8:135605637-135605659 TCAAATATGTATGTTCTGCAGGG - Intronic
1049050000 8:140187234-140187256 TCATATACACAGGTTCTGCAAGG + Intronic
1049946323 9:599761-599783 TCATATACGCAGGTTCTTCAGGG + Intronic
1050007984 9:1154535-1154557 TCAAATATGTAGGTTCTGCAGGG - Intergenic
1050941701 9:11468850-11468872 TCTTAAATGCAGGTTGTTCATGG + Intergenic
1051546223 9:18279223-18279245 TTATACATGTAGGTTCTGCAGGG - Intergenic
1054791036 9:69256928-69256950 TCATAGATGCAGGTGCCGCTGGG - Intergenic
1055490280 9:76797838-76797860 ACATACAGGCAGGGTCTGAAGGG + Intronic
1058394797 9:104538954-104538976 TCACAAATGTAGGTTTTGCATGG + Intergenic
1059124872 9:111674866-111674888 TCATATACACAGGTTCTGCAGGG - Intergenic
1059176300 9:112172889-112172911 TCATAAAACCAGGTTCTCCAAGG + Intronic
1186925325 X:14327402-14327424 TCATACAGGCAGGTTCTGCAGGG + Intergenic
1187196720 X:17093273-17093295 TCACACACACAGCTTCTGCAAGG - Intronic
1188501143 X:30827790-30827812 TAATACAAGTAGATTCTGCATGG - Exonic
1190390908 X:49930687-49930709 TCCTATATGCAGGTTCTGTAAGG - Intronic
1190838731 X:54126448-54126470 TCATATACACAGGTTCTGCAGGG + Intronic
1192305327 X:69953010-69953032 TCATACACCCAAGTTCTACAAGG - Intronic
1192348239 X:70330911-70330933 TTATACATGTGGATTCTGCAGGG + Intronic
1194536524 X:95111105-95111127 TTGTATATGCAGGTTCTTCAGGG + Intergenic
1195562623 X:106300772-106300794 TCAGTCATGCAGGTGCTACATGG - Intergenic
1196094143 X:111780583-111780605 TTGTATCTGCAGGTTCTGCAGGG - Intronic
1197361463 X:125509052-125509074 TCATGTCTACAGGTTCTGCAGGG + Intergenic
1197964974 X:132050492-132050514 TCATATATGTGGGTTCCGCAGGG - Intergenic
1199533542 X:148876739-148876761 GGATACCTGCAGGTTCTCCAGGG - Intronic
1200935251 Y:8732795-8732817 TCATACAGGCAGAATCTGCATGG + Intergenic