ID: 963195636

View in Genome Browser
Species Human (GRCh38)
Location 3:142525938-142525960
Sequence TAGTAAATTACCCTGAGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 156}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963195636_963195640 19 Left 963195636 3:142525938-142525960 CCCAGCCTCAGGGTAATTTACTA 0: 1
1: 0
2: 2
3: 12
4: 156
Right 963195640 3:142525980-142526002 CAAACAGACTAAAACAGTGATGG 0: 1
1: 0
2: 6
3: 60
4: 455

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963195636 Original CRISPR TAGTAAATTACCCTGAGGCT GGG (reversed) Intronic
903546851 1:24129716-24129738 CAGTAAATTACCCTCAACCTTGG - Intronic
907998219 1:59654410-59654432 CAGTGAATTCCCCTGAGCCTTGG + Intronic
912284817 1:108357916-108357938 ATGTAAATCACCCTGAGGTTAGG - Intergenic
917791933 1:178504517-178504539 TGGTCAGCTACCCTGAGGCTGGG + Intergenic
920694195 1:208169455-208169477 CAGTAATTTGCCCTGGGGCTAGG - Intronic
1066192063 10:33065117-33065139 CAGTAAATGTCCCTGAGCCTTGG + Intergenic
1069606619 10:69742924-69742946 TAGTAAAATACAATGTGGCTGGG + Intergenic
1072260724 10:93669056-93669078 TAGTAAATTATCCACAGGCTAGG + Exonic
1072604659 10:96970100-96970122 TATTAAATTGACTTGAGGCTGGG + Intronic
1073086651 10:100895281-100895303 TAATAAATTACCCTGTGGTCTGG - Intergenic
1077640213 11:3874533-3874555 TAGGAAAGTAACCTGAAGCTAGG - Intronic
1078965331 11:16333410-16333432 TAGTGATGTACCCAGAGGCTAGG + Intronic
1080030353 11:27654228-27654250 AACTAAATTACCCAGCGGCTTGG + Intergenic
1085795229 11:79533207-79533229 TTGTAATTTTCCCTGTGGCTGGG + Intergenic
1087717627 11:101626746-101626768 TAGTAAAATCCCCAGAGCCTGGG + Intronic
1088030051 11:105237590-105237612 AAGTAAAATACTCTGAGCCTTGG - Intergenic
1088741014 11:112766761-112766783 TAGGCAATCCCCCTGAGGCTGGG + Intergenic
1090687031 11:129132957-129132979 TAATAAAATACCCTGAGACTGGG + Intronic
1092023785 12:5223894-5223916 TAGCAAATCACCCAGAAGCTGGG - Intergenic
1093253004 12:16831652-16831674 AAGTAAGCAACCCTGAGGCTAGG - Intergenic
1095600400 12:44006455-44006477 GAGTAAAATTCCCTGAGGCCTGG + Intronic
1096300697 12:50424849-50424871 TATTAAACTACCTTGAGGCCAGG + Intronic
1100353983 12:93811367-93811389 TAGGACATTTCCCTGATGCTTGG + Intronic
1101285093 12:103303092-103303114 CAGTAAATTAACCTAAGACTGGG + Intronic
1101308315 12:103553637-103553659 TCCTAAATTCCCCTGATGCTTGG + Intergenic
1102230589 12:111259195-111259217 TAAGAAATTATCCTGAGGCCAGG - Intronic
1102289841 12:111690311-111690333 TATAAAATTACCATCAGGCTAGG - Intronic
1103222922 12:119260902-119260924 TAGGAAATTGCCCTGAGGGCAGG + Intergenic
1103291140 12:119847296-119847318 TAATAAAGAAGCCTGAGGCTGGG + Intronic
1106687419 13:32075700-32075722 TTTGAAATTATCCTGAGGCTAGG + Intronic
1107087230 13:36438443-36438465 TAGCAAATTAACCTGGGGTTGGG - Intronic
1108952351 13:56111015-56111037 TAGTAAACTAAACTGAGGCCAGG - Intergenic
1109759542 13:66809266-66809288 TAGAAGAGTACCTTGAGGCTAGG + Intronic
1110421539 13:75315009-75315031 TAGAAAAACTCCCTGAGGCTGGG + Intronic
1111486972 13:88915972-88915994 TAGTGCATTACACTGAGGTTTGG - Intergenic
1111906665 13:94263205-94263227 TAGTGAATTCCCCTGATCCTGGG - Intronic
1113045300 13:106148434-106148456 TATTAAAATACCATGAGCCTGGG + Intergenic
1115389969 14:32843071-32843093 GAAGGAATTACCCTGAGGCTGGG - Intergenic
1115479900 14:33850751-33850773 AAAGAAATTACCCTTAGGCTGGG + Intergenic
1115488664 14:33937990-33938012 TAGTTAATGATCCTGAAGCTAGG - Intronic
1116124602 14:40767214-40767236 TAGTAAATTATACTGAAGTTTGG - Intergenic
1116785349 14:49281629-49281651 TAGAAAATGCCCCTGGGGCTGGG - Intergenic
1118365883 14:65095737-65095759 TACTAAATCACCCTGATTCTTGG + Intronic
1120369734 14:83617709-83617731 TAGTGAATTACCATGAGATTTGG - Intergenic
1120484970 14:85101870-85101892 TAAAAAATTAACTTGAGGCTGGG - Intergenic
1125485934 15:40110839-40110861 TATTATTTTACCCAGAGGCTTGG + Intergenic
1128310250 15:66626771-66626793 TAGTAAAAGACTCTGTGGCTGGG + Intronic
1129118022 15:73376063-73376085 TAGCAGGTTACCCTGAGGCATGG - Intergenic
1129358689 15:75010907-75010929 TATTTAATTTCCCTGAGGCTGGG + Intronic
1129453313 15:75662793-75662815 TAGTAGAATCCCCAGAGGCTGGG - Intergenic
1129513450 15:76141532-76141554 TAAAAAAGTACACTGAGGCTAGG - Intronic
1130391770 15:83462577-83462599 TAGTTGATTGCCCTTAGGCTTGG + Intronic
1131291129 15:91107950-91107972 TATTTAATTTCCCTGAGCCTGGG + Intronic
1132020353 15:98356044-98356066 TAGGAAATTACCATGAGGTGTGG - Intergenic
1133933599 16:10251699-10251721 AAGTCACTTAACCTGAGGCTCGG + Intergenic
1135157849 16:20069492-20069514 TAGTAAATAAGCCTGACGCATGG - Intronic
1136031833 16:27508821-27508843 TAGTATATTACTCAGAGGCTTGG - Intronic
1138426889 16:56940664-56940686 TAGTATATCACTCTGTGGCTGGG + Intronic
1143914003 17:10275605-10275627 TAGTCATTTACCGTGAGGCAGGG - Intergenic
1144645276 17:16969516-16969538 GAGTAGATTAGCCTGGGGCTAGG + Intronic
1144956875 17:19023124-19023146 GAGAAAAGTGCCCTGAGGCTGGG + Intronic
1145176391 17:20703973-20703995 TAGGAATGCACCCTGAGGCTGGG - Intergenic
1147293176 17:39460302-39460324 TATTCAACTTCCCTGAGGCTGGG + Intergenic
1147897656 17:43761273-43761295 TAAAAAATTACTCTGAGGCCGGG - Intergenic
1149947756 17:60949168-60949190 TAGAATATTTCCGTGAGGCTGGG - Intronic
1150269116 17:63851030-63851052 TAGAAATTTAAACTGAGGCTGGG - Intergenic
1151138954 17:71973571-71973593 TACAAAATTACCTTCAGGCTAGG + Intergenic
1159280470 18:66278570-66278592 CAGTAAATTACCTTTAGTCTTGG + Intergenic
1159383681 18:67694477-67694499 TAGTAAAATATCCTGAGGAATGG - Intergenic
1161072077 19:2267568-2267590 TAGGAGTTTATCCTGAGGCTGGG - Intronic
1161471897 19:4461744-4461766 TAAAAAATTACCCGGAGGCCGGG - Intergenic
1164973378 19:32551350-32551372 CAGTAAATATCCTTGAGGCTGGG - Intergenic
1168050362 19:53825194-53825216 TAATAATTCTCCCTGAGGCTGGG - Intergenic
926232770 2:11017533-11017555 TTATAAATTACCCTGAAACTGGG + Intergenic
930645064 2:53897467-53897489 TTTAAAAATACCCTGAGGCTGGG - Intronic
932433625 2:71690230-71690252 AAGTAAATTACCTTGAGGAAGGG + Intergenic
933422029 2:82061094-82061116 AATTAAGTTAGCCTGAGGCTGGG + Intergenic
933422033 2:82061133-82061155 TATTAAATTAACCTGAGGCTGGG + Intergenic
933501206 2:83114000-83114022 TAATAAATTTCCCTGAGACATGG - Intergenic
935380713 2:102448502-102448524 TAGTAAATGACTCTGTTGCTTGG + Intronic
937739590 2:125334076-125334098 TAGTGAGTTGCCTTGAGGCTGGG - Intergenic
941250079 2:163150621-163150643 TGGTAAATAATCCTGATGCTGGG - Intergenic
942068196 2:172291638-172291660 TAGTACAGTACCCTGGGGGTGGG - Intergenic
942707851 2:178797119-178797141 TTCTAAATGACCCTTAGGCTTGG + Intronic
943392722 2:187289817-187289839 TAGTAAATCAGCCTCAGACTTGG + Intergenic
943769421 2:191700169-191700191 TATTAGATTACCCTGAGGCATGG - Intergenic
944032488 2:195252363-195252385 TTGCTAAATACCCTGAGGCTAGG - Intergenic
944704625 2:202276542-202276564 TAAAATACTACCCTGAGGCTGGG + Intronic
947066852 2:226236837-226236859 TAAAAGATTACCCTGAGGCCAGG + Intergenic
1168732642 20:99529-99551 TAATAAATTGGGCTGAGGCTTGG + Intergenic
1170317449 20:15057957-15057979 TAGTAAAATACCCTGTCGCTTGG + Intronic
1170874472 20:20237293-20237315 TCGTAAGGTACCCTGAGTCTGGG - Intronic
1171180977 20:23090210-23090232 TAGGAAACTACCCTGTGTCTTGG - Intergenic
1171289082 20:23969929-23969951 TAACAAAATACCCTGAGGCATGG - Intergenic
1172085318 20:32377564-32377586 TAGTAAGGTACCTTGAGGATGGG + Intronic
1177146171 21:17409794-17409816 TTGTAAATTACCCAGTCGCTGGG - Intergenic
1179217437 21:39379760-39379782 TAATAAATTAACCTGAATCTAGG - Intergenic
1182029633 22:27147721-27147743 TATTAAATTACGCTGATGCAGGG - Intergenic
1182738502 22:32548347-32548369 AAATAAAATAACCTGAGGCTAGG - Intronic
950701036 3:14746941-14746963 TAGTTAATTGCCCTTAGGCTTGG - Intronic
951750998 3:26036382-26036404 TAGAGAACTACCCTGAGCCTTGG - Intergenic
952289150 3:31998446-31998468 TTGTAAATAAGCCTGATGCTGGG - Intronic
954583098 3:51713915-51713937 TAGAAATTTTCCCTGAAGCTAGG - Intronic
955271780 3:57506735-57506757 AAGAAAATCACCCTGAGGCTGGG - Intronic
955761705 3:62291789-62291811 TAGTAAATTTCCATCAGGCCAGG - Intronic
956030880 3:65036580-65036602 TAGTAAATTTTCCTGAGTCCTGG - Intergenic
956168219 3:66412510-66412532 TAGGAAAATACCCTCAGGTTTGG + Intronic
957281791 3:78160314-78160336 TAGCAAATTGCCATGGGGCTAGG - Intergenic
958940366 3:100305835-100305857 TAATAAATAACACTGAGCCTAGG - Intronic
960889103 3:122427606-122427628 TTGGAAAATATCCTGAGGCTTGG - Exonic
961945873 3:130687181-130687203 TACAAAATTACCATCAGGCTAGG - Intronic
963195636 3:142525938-142525960 TAGTAAATTACCCTGAGGCTGGG - Intronic
963490895 3:145999055-145999077 TAGCAAATTAACCTGAGGAGGGG + Intergenic
964043152 3:152288379-152288401 TAGTAATTTTCCCTGAGGCGGGG - Intronic
977406360 4:96604300-96604322 TAATAAATCACCCCCAGGCTAGG + Intergenic
977928571 4:102728616-102728638 TAGTAAACTACCCTGTGGGTGGG + Intronic
979291063 4:118979366-118979388 AAGTAAATTACCTTGAGACCCGG - Intronic
979399954 4:120237110-120237132 TACTACAATACGCTGAGGCTGGG - Intergenic
981311542 4:143302680-143302702 TTGTAAATTACCCTGTGGCTTGG - Intergenic
986505552 5:8446747-8446769 TATAAAATTACCTTCAGGCTAGG + Intergenic
989163344 5:38412158-38412180 TAGTGAATGATGCTGAGGCTTGG + Intronic
990575112 5:57116622-57116644 TAGAAAATGAACCTCAGGCTGGG + Intergenic
992392138 5:76338965-76338987 TTCTAAAGTACCCTCAGGCTTGG + Intronic
994747802 5:103700900-103700922 TAACAAATTACCCTGAAACTTGG + Intergenic
996447026 5:123566969-123566991 TGATAAATTGCCCTGAGGCGGGG + Intronic
996728553 5:126694870-126694892 TAGTAAATAAACTGGAGGCTGGG + Intergenic
1007774783 6:44219093-44219115 AAGCAAATTATCCGGAGGCTGGG - Intergenic
1008010006 6:46456453-46456475 TAGGAAATGCCCCTTAGGCTAGG - Intronic
1009580373 6:65525967-65525989 TTACAAATTACCCTGAGACTGGG + Intronic
1009690394 6:67024393-67024415 TAGTTACTTATCCTGAGGCAAGG - Intergenic
1010584812 6:77644492-77644514 GAGAAAATAACCCTGAGGCCAGG + Intergenic
1011668062 6:89654964-89654986 TAGTTAAGTACACTGAGGCCAGG - Intronic
1017332471 6:153215852-153215874 TTATAAATTATTCTGAGGCTGGG + Intergenic
1020376454 7:7492695-7492717 TTTTAAATCACCCTGAGCCTGGG - Intronic
1024351051 7:48364575-48364597 TAGTGAGTTACCCAGATGCTGGG - Intronic
1025943750 7:66091260-66091282 TAGTAAATTCTCCAGTGGCTAGG + Intronic
1026950158 7:74341472-74341494 TATTAAACTTTCCTGAGGCTGGG - Intronic
1027939801 7:84662204-84662226 TCAGAAATTTCCCTGAGGCTGGG + Intergenic
1027956329 7:84883161-84883183 TAGTAGATGACACTGAGGTTTGG + Intergenic
1031608678 7:123799491-123799513 TTTGAAATTACACTGAGGCTGGG + Intergenic
1031608845 7:123800954-123800976 TTTGAAATTACACTGAGGCTGGG - Intergenic
1032953111 7:136938811-136938833 TAGTAAACTCCCCTGCGGGTGGG - Intronic
1033616989 7:143026150-143026172 TAATAATTAACCCTGAGGCTTGG + Exonic
1036659473 8:10698627-10698649 AAGTCAGCTACCCTGAGGCTGGG - Intronic
1038068419 8:23987025-23987047 TAGTAAATTACCCTGTGGAGAGG - Intergenic
1039988166 8:42465396-42465418 TATAAAATTAACCTGTGGCTGGG + Intronic
1040715222 8:50243665-50243687 TAATTAATTACCCTGAGACCTGG - Intronic
1041240664 8:55846437-55846459 TATTAAATTACCTTTTGGCTGGG + Intergenic
1047735840 8:127764352-127764374 TAAAAAATTACTCTGGGGCTGGG + Intergenic
1047796574 8:128262884-128262906 TATTAAATCTCTCTGAGGCTTGG - Intergenic
1049459590 8:142718990-142719012 TATTAAATTATACTGAGGCAAGG + Intergenic
1050840625 9:10143988-10144010 TATTAAATGATGCTGAGGCTTGG - Intronic
1051325696 9:15965353-15965375 TACAAAATAAGCCTGAGGCTAGG + Intronic
1051361533 9:16285629-16285651 TAGGAAATTATCCTGAAACTGGG + Intergenic
1051632050 9:19149532-19149554 TTGCAGATTACCCTGTGGCTTGG - Intergenic
1057190619 9:93084995-93085017 TAGTAAATTACCCTCAGTAGTGG - Exonic
1058222227 9:102316613-102316635 TAGTAGTTTACCTTGAGACTTGG - Intergenic
1058578760 9:106431876-106431898 TGGAAAATTAGTCTGAGGCTAGG - Intergenic
1059148322 9:111922106-111922128 GACAAAATTACCCTGGGGCTGGG - Intronic
1059230908 9:112720765-112720787 TAACAAATTACCCTGAATCTTGG + Intergenic
1059557431 9:115295401-115295423 TAGATAAATACCCAGAGGCTTGG + Intronic
1187881483 X:23851481-23851503 TAGGAAATTACCGTGGGGCGCGG - Intronic
1189136329 X:38554515-38554537 TAGGGATTTACCCTGAGCCTTGG - Intronic
1189765852 X:44371155-44371177 TAGTAATTGACCAGGAGGCTGGG - Intergenic
1190441567 X:50480120-50480142 TAGGAAATTCACCTGAGCCTTGG + Intergenic
1192987101 X:76411801-76411823 TAAGAAATTACCAAGAGGCTGGG + Intergenic
1193818256 X:86128822-86128844 TTGAAAATTATGCTGAGGCTGGG - Intergenic
1196209692 X:112981994-112982016 TAATAAATTACCCAGTGGCCAGG + Intergenic
1197375902 X:125681858-125681880 TAGAAAATTCCCCTCTGGCTAGG - Intergenic
1197480310 X:126975841-126975863 TAGTAGAATCCCCTGAGGCCAGG - Intergenic
1198140384 X:133796878-133796900 TAGGAGATTACCATGAGCCTAGG - Intronic