ID: 963196308

View in Genome Browser
Species Human (GRCh38)
Location 3:142534234-142534256
Sequence ATGCACATCTATAGTCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 94}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963196308 Original CRISPR ATGCACATCTATAGTCAGGA AGG Intronic
900274845 1:1818258-1818280 AAGCCCATCTAGGGTCAGGAAGG + Intronic
900852911 1:5157880-5157902 ATGCCCAGCTAGAGTCAGGCAGG + Intergenic
902711928 1:18246319-18246341 GGGCAAATCTATAGGCAGGAAGG - Intronic
902713266 1:18255123-18255145 ATGCACATCTCTACAGAGGAAGG - Intronic
903550682 1:24155848-24155870 ACGCTCATCTATATTCAGGTGGG + Exonic
905491718 1:38349415-38349437 ATGGAAAGCTAGAGTCAGGAAGG - Intergenic
909197274 1:72643457-72643479 CTGCACTCCTATATTCAGGAGGG - Intergenic
916405040 1:164489794-164489816 ATGGCCATCTCTTGTCAGGATGG + Intergenic
917712660 1:177702679-177702701 ATACACATATATATTCAAGAAGG + Intergenic
918258698 1:182774432-182774454 GTACACATCTATATTGAGGAAGG - Intergenic
1069392311 10:67949532-67949554 TTTCACATCTATAGTCATAAGGG - Intronic
1072941086 10:99764574-99764596 ATGCACATCATTAGTCATTAGGG + Intergenic
1077789301 11:5421247-5421269 TTGCAGATCTCTAGTCTGGAGGG - Intronic
1081148647 11:39598552-39598574 ATGAACTCCCATAGTCAGGATGG - Intergenic
1081359988 11:42164229-42164251 ATGCACAAATTTAATCAGGAAGG - Intergenic
1082566723 11:54689071-54689093 ATGGATACCTATGGTCAGGAAGG + Intergenic
1087449100 11:98295177-98295199 ATGCATAACTATAGTCAGAAAGG - Intergenic
1088076810 11:105859927-105859949 ATGAACATATATATTAAGGAAGG + Intronic
1089417250 11:118302415-118302437 ATGCACATTTACAGACACGAAGG + Intergenic
1089852330 11:121510432-121510454 ATGGAAATCACTAGTCAGGATGG - Intronic
1094310103 12:29070961-29070983 ATGTAAACCTATACTCAGGAAGG + Intergenic
1094390513 12:29944503-29944525 ACGCACATCTACAGTAAGCATGG + Intergenic
1094643887 12:32302304-32302326 AAGCACATCTATAGGCTCGATGG + Intronic
1100347931 12:93750683-93750705 ATGCAAATATATAGTGAGCATGG - Intronic
1100646847 12:96540566-96540588 CTGCACATCTATAGCCATTATGG - Intronic
1103481366 12:121252199-121252221 ATACACATGTATATTTAGGAAGG + Intronic
1111544303 13:89710399-89710421 ATTCACATCAATACTCAGGAAGG - Intergenic
1111658184 13:91177526-91177548 ATGCACATCTACAGAAAAGAGGG - Intergenic
1117251576 14:53944902-53944924 ATGGACAACTATATGCAGGATGG + Intergenic
1122672245 14:103381773-103381795 ATGTGCATCTATGGTCTGGAAGG - Intergenic
1124421168 15:29524272-29524294 CTCAACATCTCTAGTCAGGAGGG + Intronic
1127631386 15:60831013-60831035 ATGCACTTGTATAGTCAGCGAGG + Intronic
1132076099 15:98821879-98821901 AGGCACATGTATATTCATGATGG + Intronic
1134518882 16:14908816-14908838 ATGCCCATCTCTGGTCAGGCTGG - Intronic
1134555046 16:15157408-15157430 ATGCCCATCTCTGGTCAGGCTGG + Intergenic
1134706553 16:16307471-16307493 ATGCCCATCTCTGGTCAGGCTGG - Intergenic
1134960987 16:18404653-18404675 ATGCCCATCTCTGGTCAGGCTGG + Intergenic
1134965289 16:18487256-18487278 ATGCCCATCTCTGGTCAGGCTGG + Intronic
1141236059 16:82217616-82217638 AGGCTCATGTATAGTCTGGAAGG + Intergenic
1150992071 17:70271268-70271290 ATGCAACTCTATTCTCAGGAAGG - Intergenic
1153110965 18:1586862-1586884 ATGCACATCTATACTCTTAAAGG + Intergenic
1153217046 18:2830405-2830427 ATGCACTAGTAAAGTCAGGAAGG - Intergenic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1157425914 18:47584127-47584149 ATGTACAGGTAGAGTCAGGAAGG + Intergenic
1157847520 18:51017629-51017651 ATCTACATCTTTAATCAGGAAGG - Intronic
1159259066 18:65988079-65988101 ATGTAGCTCTATAGCCAGGATGG + Intergenic
928522049 2:32098874-32098896 ATGGACATCTCCAGTCAGGTGGG + Exonic
929945931 2:46371774-46371796 TTTTACATCTAAAGTCAGGAAGG - Intronic
933058987 2:77711654-77711676 ATGCAGGTCTATAGACAAGATGG - Intergenic
934511131 2:94945409-94945431 CTGCAAATCTATAGTAAGCATGG + Intergenic
940256743 2:151739032-151739054 ATTCACATCCATAGTCATGAAGG - Intergenic
943529813 2:189065168-189065190 ATGCATATCTATAGCCATGTTGG - Intronic
945334282 2:208573036-208573058 ATGCACATATATAGTGAAGATGG + Intronic
1169947872 20:11008811-11008833 ATGCACTACAATATTCAGGATGG - Intergenic
1174132287 20:48354231-48354253 ATGCACATCCAGAGTGAGTAAGG - Intergenic
1175274442 20:57758404-57758426 AATCACATCTATATTCATGATGG + Intergenic
954139264 3:48596493-48596515 AAGCACATCTATACTCACCAAGG + Intergenic
955857649 3:63290469-63290491 ATGAACATCCTTAGTCATGAGGG - Intronic
956409253 3:68962038-68962060 GTGCACAGCTTAAGTCAGGATGG + Intergenic
960396070 3:117139071-117139093 ATGGTTATCTATAGGCAGGAGGG + Intronic
960450754 3:117804616-117804638 ATGCCCATCTCTAGCTAGGAAGG - Intergenic
962730519 3:138279467-138279489 TTTCACATCTATATTCATGAGGG + Intronic
963196308 3:142534234-142534256 ATGCACATCTATAGTCAGGAAGG + Intronic
965871484 3:173270329-173270351 ATGCACATCTACTGACAGCAAGG + Intergenic
967997152 3:195175270-195175292 AGGCTCTTCTACAGTCAGGAGGG + Intronic
971047287 4:22818910-22818932 AAGCACATCTGTAGGCAAGATGG + Intergenic
974756320 4:66212799-66212821 ATGCACATGTATAGTTAACAAGG + Intergenic
977773491 4:100888898-100888920 ATTCAAATCTTTAGTCTGGAGGG + Intergenic
979395715 4:120186867-120186889 ATGAAGCTCTGTAGTCAGGAGGG - Intergenic
986745842 5:10744202-10744224 ATGTACATCTATAGCTAAGAAGG + Intronic
986922339 5:12702081-12702103 ACTCACAGCTATAGACAGGAAGG + Intergenic
986981968 5:13458295-13458317 ATGCACGTCTTGAGCCAGGAGGG - Intergenic
987070241 5:14329655-14329677 ATGCACAGCTATAGTATTGAAGG - Intronic
988961260 5:36373825-36373847 ATGCAAAGTTATAATCAGGAGGG + Intergenic
998894191 5:146780803-146780825 ATGCACTTCTATATTCTAGATGG - Intronic
1000355631 5:160391732-160391754 ATGCAATTCTAAAGTTAGGAAGG - Intergenic
1004695104 6:18026122-18026144 ATCCACATTTATAGTCAGACAGG - Intergenic
1008149522 6:47933496-47933518 ATTGAGATTTATAGTCAGGATGG - Intronic
1010591030 6:77712511-77712533 ATTCATATCTATTGTCAGAATGG - Intronic
1015095579 6:129411045-129411067 ATGCACAGCAATATTGAGGAGGG + Intronic
1015425090 6:133055875-133055897 TTGCACATCTCCACTCAGGAGGG + Intergenic
1021428544 7:20532575-20532597 ATGCACATCTATGGACTGGCTGG + Intergenic
1022201735 7:28123714-28123736 ATACACATCTATAGCAATGATGG + Intronic
1023625625 7:42112773-42112795 ATGCACCTCTACAGTGGGGATGG - Intronic
1025105466 7:56168346-56168368 ATGCACATATATACTGAGCATGG + Intergenic
1031644338 7:124204826-124204848 ATGCATATTTAGAGTCAAGAAGG + Intergenic
1034454299 7:151157756-151157778 ATGCCCACCTTTAATCAGGAAGG - Intronic
1038302320 8:26364158-26364180 ATGTACATTTAAAGTGAGGATGG + Intronic
1040991861 8:53360593-53360615 ATGCACATCATTAGTCACTAGGG - Intergenic
1042388589 8:68205803-68205825 ACGCAAATCTTTAGTCAAGAAGG + Intronic
1042809521 8:72808802-72808824 ATGCAGATTTAGGGTCAGGAAGG - Intronic
1044832790 8:96266679-96266701 ATGCTCATCTATAGTGATTATGG + Intronic
1045448840 8:102298538-102298560 ATGAACATTTATAATCAGGAAGG - Intronic
1046793111 8:118342864-118342886 GGGCACAGCTATAGTCAGGATGG + Intronic
1048427127 8:134333099-134333121 ATGCAGATGAAGAGTCAGGAAGG + Intergenic
1048892874 8:138963464-138963486 AGGCAAATCTATAGACAGAAAGG - Intergenic
1052783142 9:32801717-32801739 ATGCACATAAATAGTAAGGAGGG + Intergenic
1055234807 9:74107928-74107950 ATGCAAAGTTAAAGTCAGGAAGG - Intergenic
1059553437 9:115253464-115253486 TTGCACCTCTATAGTCAGTAGGG - Intronic
1186352450 X:8753993-8754015 ATGCACATCGATACTCATAAAGG - Intergenic
1188046481 X:25430955-25430977 CAGCACAACTATAGTCATGAAGG + Intergenic
1188725540 X:33577993-33578015 GTGCACATCTACAGTCATGGTGG + Intergenic
1190692962 X:52927258-52927280 ATGCAAATGTATAATCAGAAAGG + Intronic
1192288924 X:69770928-69770950 TTGAACATCTATAGTCAGAAAGG - Intronic