ID: 963202845

View in Genome Browser
Species Human (GRCh38)
Location 3:142602257-142602279
Sequence GAGTGAGTTGGTGGTCATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 114}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963202839_963202845 5 Left 963202839 3:142602229-142602251 CCTCTTTTGGGGTGGAGCTGTGA 0: 1
1: 0
2: 0
3: 7
4: 175
Right 963202845 3:142602257-142602279 GAGTGAGTTGGTGGTCATCCAGG 0: 1
1: 0
2: 0
3: 5
4: 114
963202831_963202845 26 Left 963202831 3:142602208-142602230 CCACTTCTGATCTGCTCCCACCC 0: 1
1: 0
2: 2
3: 44
4: 376
Right 963202845 3:142602257-142602279 GAGTGAGTTGGTGGTCATCCAGG 0: 1
1: 0
2: 0
3: 5
4: 114
963202836_963202845 10 Left 963202836 3:142602224-142602246 CCCACCCTCTTTTGGGGTGGAGC 0: 1
1: 0
2: 0
3: 7
4: 108
Right 963202845 3:142602257-142602279 GAGTGAGTTGGTGGTCATCCAGG 0: 1
1: 0
2: 0
3: 5
4: 114
963202838_963202845 6 Left 963202838 3:142602228-142602250 CCCTCTTTTGGGGTGGAGCTGTG 0: 1
1: 0
2: 0
3: 19
4: 205
Right 963202845 3:142602257-142602279 GAGTGAGTTGGTGGTCATCCAGG 0: 1
1: 0
2: 0
3: 5
4: 114
963202837_963202845 9 Left 963202837 3:142602225-142602247 CCACCCTCTTTTGGGGTGGAGCT 0: 1
1: 0
2: 3
3: 12
4: 141
Right 963202845 3:142602257-142602279 GAGTGAGTTGGTGGTCATCCAGG 0: 1
1: 0
2: 0
3: 5
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963202845 Original CRISPR GAGTGAGTTGGTGGTCATCC AGG Intronic
900302541 1:1985365-1985387 GAGTGAGTCGGTGTGCAGCCGGG - Exonic
902697371 1:18149379-18149401 GAGGGAGGGGGTGGCCATCCCGG + Intronic
902698527 1:18156158-18156180 GATAGAGTGGGTGGGCATCCAGG + Intronic
907775849 1:57513868-57513890 GAGTGAAATGGTGGTCACCAGGG - Intronic
908723075 1:67147089-67147111 GAGTGAGAAGGTTGTAATCCTGG + Intronic
912625505 1:111202660-111202682 GAGTGATGTGGTGGTGGTCCTGG - Intronic
913178515 1:116297449-116297471 CAGTGAGTTTGTGGTCTTGCTGG + Intergenic
920356986 1:205381048-205381070 GGGTGAGTTAGTTGTCCTCCTGG - Intergenic
922792276 1:228317055-228317077 GAGTGCGTGGGTGACCATCCTGG + Intronic
1064264330 10:13812692-13812714 CAGTGAATTGATGGTCATCTAGG - Intronic
1067524939 10:47032742-47032764 GAGTGGGTTGGTGGTCACCAGGG - Intergenic
1067930274 10:50553996-50554018 GAGTGAGTTGGGTGACATGCTGG - Intronic
1070949314 10:80418432-80418454 GAGTGAGTTGGTGGTGACTTTGG - Intronic
1072334905 10:94389293-94389315 AATTGATCTGGTGGTCATCCTGG - Intergenic
1073494416 10:103878779-103878801 GTGTTAGTTTGTGTTCATCCAGG + Intergenic
1077586194 11:3455272-3455294 GAAGGAGTTGGTGGCCATCGTGG + Intergenic
1079318767 11:19432413-19432435 GACTGAGTTGGTGGTGATTAAGG + Intronic
1080395708 11:31887925-31887947 GAATGAGAAGCTGGTCATCCTGG - Intronic
1081507587 11:43734412-43734434 CAGTGAGTTGGTGATCAGCTCGG - Intronic
1081802160 11:45867637-45867659 GAGGGAGTTGGCGTTCATTCGGG - Exonic
1083897581 11:65627796-65627818 CAGAGAATTGGTGGTCAGCCAGG + Intronic
1084047958 11:66581141-66581163 AAGTGAGTTAGAGGTCATTCTGG - Intergenic
1084119550 11:67060873-67060895 GACTGAGTGGGTGGTCAAGCTGG + Intronic
1085299487 11:75449962-75449984 GATCGGGCTGGTGGTCATCCTGG - Exonic
1087623071 11:100564666-100564688 GAGTGAGTTGGTGCCCTTCTTGG - Intergenic
1092918220 12:13207320-13207342 GAGGGAGTTCGAGATCATCCTGG - Intronic
1095890985 12:47235105-47235127 CAATAAGTTCGTGGTCATCCTGG + Exonic
1096683223 12:53270611-53270633 GAGTGCGGTGGAGGTCATCTTGG + Intronic
1096887082 12:54728822-54728844 GAGTGAGTTCGAGATCAGCCTGG + Intergenic
1100108680 12:91210267-91210289 GAGGAAGTTGTTGATCATCCAGG + Intergenic
1103056997 12:117829198-117829220 GCGTGAGTTGGAAGTCAGCCTGG - Intronic
1106317441 13:28607249-28607271 TAGTGAGCTGGTGCCCATCCCGG + Intergenic
1106585174 13:31050960-31050982 GATGGAGTGGGTGGTCATTCAGG + Intergenic
1114583650 14:23789050-23789072 GAATAACTTGGTGGCCATCCTGG - Intergenic
1114792972 14:25680306-25680328 TAGTGAGTTAGTGGTCTTGCTGG + Intergenic
1118685478 14:68286455-68286477 GAGGGAGTTTGTGGTCAGCCAGG - Intronic
1120073749 14:80132762-80132784 GAGTGAGTTCTTGCTCTTCCAGG + Intergenic
1121113576 14:91328791-91328813 GTGTGAGTTGGTGGTGATGGCGG - Intronic
1123172796 14:106390330-106390352 GGGTGAGTGTGTGGTCATCTGGG - Intergenic
1127048384 15:55052467-55052489 CAGTGAGTTGGTGGTAAACCAGG - Intergenic
1128401861 15:67291420-67291442 GGGTGAGCTGGTGTTTATCCTGG - Intronic
1128505806 15:68271904-68271926 GGGTGAGTGGGTGGCCATGCTGG + Intergenic
1130931280 15:88429944-88429966 GTTTGAGTTGGTGGTCATGATGG - Intergenic
1131449940 15:92530893-92530915 GACTGAGTTGCTGGTTATCATGG + Intergenic
1132070228 15:98770143-98770165 GAGTGACATGGTGGACACCCAGG - Intronic
1133158509 16:3892856-3892878 GAGTGAGTTTGAGACCATCCTGG - Intergenic
1135515092 16:23125345-23125367 GAGGGAGGTGGAGGGCATCCAGG - Intronic
1139733470 16:68967699-68967721 AAGTGAGTAGGTGGTTTTCCGGG + Intronic
1141605394 16:85150212-85150234 GATAGAGTTGGTGGCCAACCTGG - Intergenic
1141745069 16:85920049-85920071 GCGGGAGTTGGAGGTCATCTCGG + Intronic
1143875899 17:9990528-9990550 GAGTGTGTTGGGGGCCATCTTGG + Intronic
1145190914 17:20841830-20841852 GAGGGAGTGGGTGGTCGTCTGGG + Intronic
1146621993 17:34405917-34405939 GAATGTGTGGGTGGTGATCCTGG + Intergenic
1146768587 17:35547125-35547147 GAGAGGGTTGGTGGTGAACCTGG + Intergenic
1149114544 17:53076625-53076647 GAGGTACTTGCTGGTCATCCAGG - Intergenic
1150656638 17:67044086-67044108 CAGTGAGTAGGTTCTCATCCTGG - Intergenic
1153258413 18:3197045-3197067 CAGTGAGTTGGTGGTGAACTGGG + Intronic
1157684483 18:49631308-49631330 GCGGGATTTGGTGGGCATCCAGG - Intergenic
1161498353 19:4599203-4599225 GAGTGAGTTGGAGGTCGCCGTGG - Intergenic
1163604470 19:18266448-18266470 GGGTGGGGTGGTGGTCATCGTGG + Exonic
925077090 2:1025746-1025768 TTGTGAGATGGGGGTCATCCCGG - Intronic
926584324 2:14669476-14669498 GAGTGTGTTGATGGGCAGCCCGG + Intergenic
929000511 2:37343692-37343714 GAGTGAGTGGGTGGGCCTTCTGG + Intergenic
929581580 2:43084853-43084875 GACTGAGGTGGCGGTCAGCCAGG + Intergenic
930570134 2:53076190-53076212 GGGTGACTTCGTAGTCATCCAGG + Intergenic
935207379 2:100908046-100908068 GCGTGCATTTGTGGTCATCCAGG + Intronic
938226602 2:129621977-129621999 GAGTGGGATGGTGGTCACCGGGG + Intergenic
941023303 2:160433070-160433092 GTGAGAGTAGGTGCTCATCCCGG - Intronic
945771858 2:214053556-214053578 GAGTGAATTGGTTGTATTCCAGG - Intronic
1175650472 20:60717032-60717054 AAATGAGTAGGTGGTCAGCCTGG + Intergenic
1183966611 22:41446354-41446376 GAGTGAGTTGGGGGGCGTGCGGG - Intronic
950673393 3:14540324-14540346 GAGGGAGTTGGTGGGCAGCAGGG - Exonic
953183755 3:40619815-40619837 GTGTGATTTGGTGGGGATCCAGG + Intergenic
959158461 3:102695345-102695367 GAGTGATTTTGGGGTCATTCAGG - Intergenic
959937708 3:112046765-112046787 GAGTGAGTTGGTAGTTGTCGAGG - Intronic
963202845 3:142602257-142602279 GAGTGAGTTGGTGGTCATCCAGG + Intronic
963973815 3:151458760-151458782 GAGTGAGTGTGTGGTGGTCCTGG - Intergenic
965984843 3:174738346-174738368 AAGTGTGTTGGTGGTTATACTGG - Intronic
967953011 3:194855185-194855207 GTGTGGTTTGGTGGTAATCCAGG - Intergenic
969752631 4:9123472-9123494 GAAGGAGTTGGTGGCCATCGTGG - Intergenic
971240831 4:24887515-24887537 GAGTGAGTAGGTGGTGATCAGGG - Intronic
971480396 4:27109544-27109566 GACTGTGTTGGTGGTCACCATGG - Intergenic
988181331 5:27797594-27797616 GAGAGATTTGGTGTTCATCTTGG - Intergenic
994269211 5:97756949-97756971 GATTGAGTTGGTGTCCATTCTGG + Intergenic
994926918 5:106127468-106127490 GAGCTGGTTGGTGGTCATCTGGG + Intergenic
999628282 5:153543155-153543177 GATGGAGGTGGTGGTGATCCTGG + Intronic
1001345758 5:170896931-170896953 GACCCAGTTGGTGGTCATACTGG + Intronic
1001995791 5:176156691-176156713 GAGTGAGCTGGTCTTCATCACGG - Intergenic
1006590223 6:35149504-35149526 GAGTGAGTAAGTGGTAAGCCAGG + Intergenic
1007056803 6:38894297-38894319 ACGTGAGTTGGTTGTCATGCAGG - Intronic
1007854257 6:44838434-44838456 GAGGGAGATGGTGGTCATCAAGG + Intronic
1010587150 6:77666920-77666942 GGCTGAGATGGTGGTCATCAGGG + Intergenic
1010984094 6:82402515-82402537 GAGTCAGTTGTTGGCCAGCCTGG - Intergenic
1017564618 6:155670063-155670085 GAGTGAGTTGGGGTTGAGCCAGG - Intergenic
1018035382 6:159877099-159877121 GAGTAAGGTGGTGGTTATACAGG - Intergenic
1020492492 7:8805212-8805234 GAGTGTGGTGGTGGTTAGCCTGG + Intergenic
1021563704 7:21995075-21995097 GAGTGGAATGGTGGTTATCCAGG + Intergenic
1021910339 7:25379517-25379539 TATTGTGTTGGTGGTCATCACGG - Intergenic
1024748044 7:52430473-52430495 CAGTGAGTTCGTGGCCTTCCTGG + Intergenic
1027267314 7:76501516-76501538 GTGTGAGTTGGGGGTCCTGCTGG - Intronic
1027319127 7:77001381-77001403 GTGTGAGTTGGGGGTCCTGCTGG - Intergenic
1030082877 7:105792406-105792428 GTGTGAAGTGGTGGTCTTCCTGG - Intronic
1030385093 7:108858448-108858470 AAATGAGGGGGTGGTCATCCAGG - Intergenic
1034972851 7:155429981-155430003 GAGGGAGGTGGTGGGCATTCTGG - Intergenic
1036375846 8:8198866-8198888 GAAGGAGTTGGTGGCCATCGTGG - Intergenic
1036853682 8:12224277-12224299 GAAGGAGTTGGTGGCCATCGTGG + Intergenic
1036875058 8:12466787-12466809 GAAGGAGTTGGTGGCCATCGTGG + Intergenic
1039922541 8:41903535-41903557 GAGTGAGGTGGTGGCCACCTTGG - Intergenic
1041822148 8:62049048-62049070 GAGTGCATTGGAGGTCATGCAGG + Intergenic
1042860969 8:73313826-73313848 GAGTGAGCTGGTGCCCATGCTGG - Intronic
1049230613 8:141479433-141479455 GAGGGGGTTGGGGCTCATCCAGG + Intergenic
1049753292 8:144296032-144296054 GAGTGAGCTGGAGGTCACCAAGG + Intronic
1049876614 8:145027138-145027160 GAAGGAGTTGGTGGCCATCGTGG + Intergenic
1050096932 9:2076778-2076800 GCGAGAGTTGGTGGTCAACTTGG - Intronic
1051424967 9:16923748-16923770 CAGTGAGTTCGTGGTCTTGCTGG + Intergenic
1053273785 9:36768034-36768056 GGCTGAGTTGATGGTCCTCCAGG + Intergenic
1056365390 9:85899564-85899586 CAGTGAGTTGGTGATCAGCTCGG - Intergenic
1058908911 9:109503257-109503279 GAGCGAGAAGGTGGTCAGCCAGG + Intergenic
1186876179 X:13820356-13820378 GAGTGAGGAGATGGTCATGCTGG + Intronic
1198868700 X:141153384-141153406 GAGTGAGTTAGTGGTCAAGTGGG + Intergenic