ID: 963204263

View in Genome Browser
Species Human (GRCh38)
Location 3:142616327-142616349
Sequence TAGAGAAAAAAGAATGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1180
Summary {0: 1, 1: 0, 2: 3, 3: 103, 4: 1073}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963204261_963204263 -2 Left 963204261 3:142616306-142616328 CCTTTTCTATAAAGGATAAGGTA 0: 1
1: 0
2: 1
3: 34
4: 307
Right 963204263 3:142616327-142616349 TAGAGAAAAAAGAATGATGGAGG 0: 1
1: 0
2: 3
3: 103
4: 1073
963204258_963204263 25 Left 963204258 3:142616279-142616301 CCTTTTCTCATTTGTTAATGTTT 0: 1
1: 1
2: 8
3: 184
4: 4834
Right 963204263 3:142616327-142616349 TAGAGAAAAAAGAATGATGGAGG 0: 1
1: 0
2: 3
3: 103
4: 1073

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963204263 Original CRISPR TAGAGAAAAAAGAATGATGG AGG Intronic
900852157 1:5152537-5152559 TAGAGATAACCGAATCATGGAGG + Intergenic
901356335 1:8652734-8652756 TGGAGATAAATGAATCATGGGGG - Intronic
902727869 1:18349345-18349367 AAGAAAAATAAGGATGATGGGGG + Intronic
902764757 1:18606861-18606883 AAGAGGAACAAGGATGATGGTGG - Intergenic
903334374 1:22615131-22615153 AAGAGAAAAAAGAAATCTGGAGG - Intergenic
903398042 1:23017639-23017661 TGGAGAAAAAAGAAAGTTTGTGG - Intergenic
903799460 1:25955717-25955739 AAGAGAAAAAGGAAGGAAGGAGG + Intergenic
903953299 1:27008966-27008988 AAAAAAAAAAAGAAGGATGGAGG - Intronic
904294820 1:29513342-29513364 TATAGAAATCAGGATGATGGGGG + Intergenic
904338787 1:29818279-29818301 GAAAGAAAAAACAATGTTGGGGG - Intergenic
904569569 1:31452343-31452365 AAAAAAAAAAAAAATGATGGTGG + Intergenic
905840271 1:41170583-41170605 TAGAGCAATAAGAATGCTGGTGG - Intronic
905944065 1:41887198-41887220 CAGGGAAAAAAGTATTATGGAGG + Intronic
906037995 1:42764927-42764949 TAGAGAGTAAAGAAGGCTGGGGG - Intronic
906038722 1:42769540-42769562 AAAAGAAAAAAAAATGGTGGTGG + Intronic
906937034 1:50223443-50223465 TAAAGGAAAAAAAATGAAGGAGG + Intergenic
907173662 1:52497873-52497895 TAAATAAAAGAGAATGATTGTGG - Intronic
907412347 1:54291714-54291736 TAGCAAATAAAGAATGATGTAGG + Intronic
907726020 1:57021421-57021443 TGGAGATAAATGAATCATGGGGG + Intronic
907770105 1:57452995-57453017 AAAAGAAAAAAGAAGGAGGGAGG + Intronic
908374041 1:63515413-63515435 TTGAAAAAAAAGAATGAAGTTGG - Intronic
908770897 1:67594717-67594739 TGGAGAAAATTGAATCATGGGGG - Intergenic
908807685 1:67947898-67947920 TTGAGCAAATAGATTGATGGTGG - Intergenic
909538091 1:76760690-76760712 GAGAGAAATAAGAATCATTGAGG + Intergenic
909594399 1:77389518-77389540 TGCAGAAAAAAGGAAGATGGAGG + Intronic
909814760 1:79977781-79977803 TGGAGACTAAAGAATGATGGTGG - Intergenic
909819410 1:80042288-80042310 TAGATAAAATAGACTGAAGGAGG - Intergenic
909970458 1:81979282-81979304 TAGAAAAAAAAGACTGATGATGG + Intronic
910241667 1:85093273-85093295 AAGAGAAAAAAACATCATGGTGG - Intronic
910977292 1:92920238-92920260 TGGAGATAAATGAATAATGGGGG + Intronic
911275754 1:95855206-95855228 TAGAGATAATTGAATCATGGGGG - Intergenic
911558656 1:99377853-99377875 TAGAGAAAAAGGATAGAAGGAGG - Intergenic
911939328 1:104021435-104021457 TAGAGAAATAAAAATAAGGGTGG - Intergenic
912310396 1:108615020-108615042 AAGAGAAAAAAGAGTCATGGAGG + Intronic
912327683 1:108784475-108784497 TAGAGATAACTGAATCATGGGGG - Intronic
912902049 1:113661724-113661746 CAGAGAAAAGAGAAGGGTGGAGG + Intronic
913088835 1:115462367-115462389 GAGAGAAGAAAGAATAATGGTGG - Intergenic
913453700 1:119009395-119009417 TAGAGAAAGGAGAAAGATGAAGG + Intergenic
913548018 1:119888744-119888766 TAAAGAATAAAGAATGATTAGGG + Intergenic
915017155 1:152744681-152744703 AAGAGAAGAAAGAATGAGAGGGG - Intronic
915038745 1:152949912-152949934 TAGAGGAAAAGGATTGAGGGAGG + Intergenic
915406984 1:155667528-155667550 TAAATAAAAAAGAAGGCTGGGGG + Intronic
915939345 1:160108935-160108957 GAGAGAAAAGACAATGAGGGTGG + Intergenic
916208473 1:162338331-162338353 AGGAGAAAAGAGAATAATGGGGG - Intronic
916270579 1:162937330-162937352 TGGAGAAGAAAGAATGATGAAGG - Intergenic
916319205 1:163484105-163484127 TCGGGAAAAAAGAATGAAAGGGG - Intergenic
916342996 1:163757378-163757400 TAGTGATCAAAGAATGATTGGGG - Intergenic
916461048 1:165024825-165024847 TCTAGGAAAAAGAATGATGCTGG - Intergenic
916568485 1:166004276-166004298 AAAAAAAAAAAGAATGATGCTGG + Intergenic
916897831 1:169184066-169184088 AAGAGAAAAATGAATTTTGGGGG - Intronic
916993746 1:170273668-170273690 TAGGGATGAAAGAATGATGCAGG - Intergenic
917013435 1:170501806-170501828 TAGAAACAAAAGAATGATAAAGG + Intergenic
917659087 1:177160248-177160270 TGGAGAAAACAGAAGAATGGGGG - Intronic
917713002 1:177706395-177706417 TAGAGGAAAAAGAATAGAGGAGG - Intergenic
918054990 1:181013310-181013332 AACAGGAAAAAGGATGATGGGGG - Intronic
918167749 1:181966529-181966551 TAGAGATAATTGAATCATGGGGG - Intergenic
918224580 1:182469964-182469986 TAGAGAAAGAAGTAGAATGGTGG + Intronic
918271840 1:182909164-182909186 GAGAGAAAAAAGTGTGATAGAGG + Intronic
918282426 1:183020417-183020439 GAGAGAAAAAGGAGGGATGGAGG - Intergenic
918736108 1:188065623-188065645 AAGAGAACAATGAATGAAGGAGG - Intergenic
918739176 1:188105262-188105284 TAGACAGAAAAGAATGATCCGGG - Intergenic
919000971 1:191830653-191830675 TGGAGAAAAGAGAATGATTTAGG - Intergenic
919011873 1:191975125-191975147 TAGAGATAATTGAATCATGGAGG - Intergenic
919058868 1:192606057-192606079 GAAAGAAAAAAGAAGGAGGGAGG + Intergenic
919077948 1:192835469-192835491 TAGAAAAAAAAAAATTATGTTGG + Intergenic
919099531 1:193077593-193077615 TAGAGATAATTGAATCATGGGGG - Intronic
919231284 1:194778148-194778170 TAGAGAACCAAGAAAGCTGGAGG - Intergenic
919514392 1:198503711-198503733 TTGAGAAAGAAGAATGAAGCTGG - Intergenic
919675112 1:200374397-200374419 TAGAGAGAGAAGAATGATGGTGG + Intergenic
919959851 1:202455966-202455988 TAGAGAAAAGTGAATGATCTTGG + Intronic
920049528 1:203154926-203154948 CAGAGAAAAAAGAAGGAAGAGGG - Intronic
920350340 1:205333934-205333956 AAGAGAAAAAAGAAAGAAGAGGG - Intergenic
920794486 1:209125401-209125423 TTTGGAAAAAAGAATGGTGGGGG - Intergenic
921006166 1:211095579-211095601 GGTAGAAAAAAGATTGATGGAGG - Intronic
921196011 1:212759064-212759086 TACATACAAAAGAATGAAGGTGG + Intronic
921781298 1:219168179-219168201 TAGAAAAAAAAGTATAATGGTGG - Intergenic
921797700 1:219366575-219366597 CAGAAAGAAAAGAATGATGGTGG + Intergenic
921990574 1:221361539-221361561 TAGTGAAAAAATGAAGATGGTGG + Intergenic
922350733 1:224732946-224732968 AAGAAAAAAAAGAATGAGGAGGG + Intronic
922361503 1:224826665-224826687 TGGAGATAATTGAATGATGGGGG + Intergenic
922888912 1:229045563-229045585 TAGATAAACAAAAATTATGGTGG + Intergenic
923173022 1:231434458-231434480 TAAATAAAAAAGAAAAATGGTGG + Intergenic
923428745 1:233898774-233898796 TTGAGCAAAAACAATGAAGGTGG - Intergenic
923455828 1:234164406-234164428 GAGAGGAAAAAGAAAGAGGGAGG - Intronic
923515073 1:234690282-234690304 GAGAGAAAAGAGAATAATGATGG + Intergenic
923746918 1:236709966-236709988 TGGAGAAAATGGAATGATGAAGG + Intronic
923985576 1:239377979-239378001 AAGAAAGATAAGAATGATGGAGG + Intergenic
924114544 1:240732225-240732247 CAGAGAAAAAAGAATGAGGCAGG - Intergenic
924182088 1:241448951-241448973 TAGAGATAATTGAATCATGGGGG + Intergenic
924354351 1:243154478-243154500 TGGAGAAAAAAGGAGGGTGGTGG - Intronic
924830163 1:247585623-247585645 TGGAGAAAACAGAATGCTGTTGG + Intergenic
924830420 1:247588496-247588518 ACGAGAAACCAGAATGATGGTGG - Exonic
1062781941 10:220185-220207 TATAGAAATAAAATTGATGGTGG + Intronic
1062921293 10:1281799-1281821 TAAAGAAAAAAGGATTATAGAGG - Intronic
1063078772 10:2744510-2744532 TTCAGAGAAAGGAATGATGGAGG - Intergenic
1063284258 10:4666087-4666109 CATAGGAAAAAGAATGAAGGTGG - Intergenic
1063604454 10:7509854-7509876 TAGAGATAACTGAATCATGGGGG + Intergenic
1063757983 10:9037747-9037769 TACAGTACAAAGAATGATAGAGG + Intergenic
1063913173 10:10853356-10853378 TATAAGAAAAAGAAAGATGGTGG + Intergenic
1063925598 10:10973959-10973981 TAGAAAAATTAGAATGATGTGGG - Intergenic
1063975344 10:11410867-11410889 TTGAGAAAAAAAAATGAAGCTGG + Intergenic
1064372813 10:14768584-14768606 TACATGCAAAAGAATGATGGTGG + Intronic
1065081423 10:22133486-22133508 AAGAGAAGGAGGAATGATGGAGG - Intergenic
1065415932 10:25486244-25486266 TACAGACAAAAGAATGAAGAAGG - Intronic
1065438571 10:25726441-25726463 GAAAGAAAAAAGAAAGAGGGAGG - Intergenic
1065640332 10:27775949-27775971 TAGAGAAAACAGAATGTTACAGG + Intergenic
1066007595 10:31160227-31160249 GAGAAAAAAAAGAATGAAGCTGG - Intergenic
1066272799 10:33839942-33839964 TAGAGATAATTGAATCATGGGGG - Intergenic
1066386863 10:34948521-34948543 AAAAGAAAAAAGAAAGATGGAGG + Intergenic
1066627538 10:37423287-37423309 TAAAGAAAGAAGAAAGTTGGAGG - Intergenic
1067427817 10:46222786-46222808 TAGAGAAAGAAGAATGTCAGTGG - Intergenic
1068036396 10:51765208-51765230 GAGGGAAAAAAGAATGCTGAGGG + Intronic
1068094493 10:52473257-52473279 TAGAGAAAAAAGGATATTCGTGG + Intergenic
1068154635 10:53182557-53182579 TTGAGAAAGAAGAATAAAGGTGG + Intergenic
1068233510 10:54202319-54202341 AAGAGAAAAAAAAAAGAGGGAGG + Intronic
1068390721 10:56392778-56392800 TCTAGAAAAATGAATCATGGAGG + Intergenic
1068486967 10:57671570-57671592 TAGTGAGAAAAGTATGCTGGTGG - Intergenic
1068631905 10:59306882-59306904 CAAACAAAAAAGAATAATGGTGG + Intronic
1068687590 10:59885214-59885236 TATTGAAAAAAGAATGAAGATGG - Intronic
1069210745 10:65756605-65756627 TCTTGAAAAAAGAATGATGTTGG - Intergenic
1070050633 10:72886098-72886120 TAAAGAGAAAACAATGCTGGGGG + Exonic
1070146863 10:73780783-73780805 TGGAGAAAACAGGTTGATGGTGG + Intergenic
1070839702 10:79475635-79475657 TGGAGAAAAGACACTGATGGGGG - Intergenic
1071557956 10:86620614-86620636 AAAAAAAAAAAGAATGCTGGAGG - Intergenic
1071778094 10:88811577-88811599 TAGAGAATAGAGAAGGATGAAGG - Intronic
1071905453 10:90169052-90169074 TATAGAAAAAAGTATCAGGGTGG - Intergenic
1071976506 10:90961269-90961291 GAGAGAGAAAAAAATGATGAAGG + Intergenic
1072884416 10:99261144-99261166 GAGAGAAAGAAGAAAGATGTGGG - Intergenic
1073039912 10:100596592-100596614 AAGAGAGAAAAGAAAGATGATGG - Intergenic
1073351767 10:102825006-102825028 TAGACAAACAAGAGTGATGCAGG - Intergenic
1073430910 10:103486299-103486321 GAGAGAAAAGAGGATGCTGGGGG + Intergenic
1073598337 10:104822099-104822121 TAGAGAAATAAGAATCACAGAGG - Intronic
1073704714 10:105970143-105970165 AAGAGAAAGAAGAACGAAGGAGG + Intergenic
1073840547 10:107494396-107494418 AAGGGAAAAGAGAATGAAGGTGG - Intergenic
1073855468 10:107668221-107668243 TATAGAAAAAAAATAGATGGTGG - Intergenic
1074215930 10:111383668-111383690 TGGAGATAATTGAATGATGGGGG + Intergenic
1074726584 10:116316242-116316264 TAGAGATAATTGAATCATGGGGG + Intergenic
1074808311 10:117076434-117076456 TAGAGATAAGTGAATGATGGAGG - Intronic
1074846912 10:117406683-117406705 ACGAAAACAAAGAATGATGGAGG + Intergenic
1075772097 10:124947733-124947755 AAGAGAAAGAAGAATCAAGGAGG - Intronic
1075780951 10:125016756-125016778 TAGAGAAGAAAGAAGAGTGGAGG - Intronic
1076550046 10:131272548-131272570 TAGGGAGGAAAGAATGGTGGGGG - Intronic
1076800071 10:132817563-132817585 TAGAGAAGGAAGAATGAATGAGG - Intronic
1077345982 11:2054119-2054141 TGGAGAAAAAAGAATGGAGAAGG - Intergenic
1077865134 11:6215854-6215876 TTGAGACAGGAGAATGATGGAGG + Intronic
1077957556 11:7037399-7037421 TGGAAAAAAAAGACGGATGGGGG - Intronic
1078532000 11:12143909-12143931 TAGAGTGGAAAGAATAATGGCGG + Intronic
1078581334 11:12541758-12541780 AAGAGAAAGAAGAATCCTGGAGG + Intergenic
1078652794 11:13211502-13211524 TATTAAAAAAAGAATGATGGAGG + Intergenic
1078731166 11:13975277-13975299 TAAAGATAAAAGGATGAGGGAGG + Intronic
1078817175 11:14837346-14837368 GAGAGGAAAAAGAAAGATTGGGG - Intronic
1078912351 11:15744852-15744874 TAGAGACAATTGAATCATGGGGG - Intergenic
1079338347 11:19590741-19590763 TAAAGAAAAAACCATAATGGTGG - Intronic
1079518593 11:21298008-21298030 TACAAAATAAAAAATGATGGAGG - Intronic
1079807134 11:24946621-24946643 TAGAAAAAAAAGAAGGGTTGGGG - Intronic
1080016407 11:27511252-27511274 TAGAGCAAAAAGACAGAGGGAGG - Intergenic
1080077427 11:28167480-28167502 TAGAGAAAAAAGTACTACGGTGG - Intronic
1080123593 11:28705227-28705249 TATAGAAAGAAGAATGAAGAGGG + Intergenic
1080263212 11:30373357-30373379 GAGAGAAAAAAGAACAATTGTGG - Intergenic
1080513632 11:33000156-33000178 TAGAGAAAAAAGAACGAAAAGGG - Intergenic
1081222849 11:40483299-40483321 AAGAGAAAAAAGAATTATCCAGG + Intronic
1081480438 11:43482147-43482169 AAGAGAAAACAAAAAGATGGTGG - Intronic
1082180885 11:49117886-49117908 TAGAGAAAACATAAAGATGTAGG + Intergenic
1082690490 11:56296935-56296957 CAGAAAAAAAAGATTGATGCTGG + Intergenic
1082882914 11:58055800-58055822 TAAAAAAAAAAAAATGCTGGAGG + Intronic
1082960516 11:58914789-58914811 TGGAGAAAAATGCATTATGGGGG + Intronic
1083152288 11:60799396-60799418 TATAGAAAAAAGAATCAGTGTGG - Intronic
1083276797 11:61601483-61601505 AAAAAAAAAAAAAATGATGGAGG + Intergenic
1085190725 11:74619442-74619464 TTGGGAAAGAAGAAGGATGGAGG + Intronic
1085499014 11:77000850-77000872 TTGAAAAAAAAGAATGAAGTGGG - Intronic
1085556378 11:77426235-77426257 CAGAGAAAAAAAGATGGTGGTGG - Intronic
1085814528 11:79723133-79723155 CTGAGCAAAAAGAATGCTGGAGG + Intergenic
1085890313 11:80571884-80571906 AACAGAAAATAGAATGATGGTGG - Intergenic
1086047293 11:82547878-82547900 AAGAGAAAAAAGAAAGAGGAGGG + Intergenic
1086150401 11:83602930-83602952 TATAGAAAATAGAATCATGAAGG - Intronic
1086878700 11:92128960-92128982 TAGACAACCAAGAATGATGCGGG + Intergenic
1087192895 11:95274467-95274489 TGGAGATAACTGAATGATGGTGG + Intergenic
1087220337 11:95540193-95540215 TATAGAAAAAATTATGATGGAGG + Intergenic
1087473632 11:98608618-98608640 TAGAGAAAAAAAAATGACAGGGG + Intergenic
1087495126 11:98881441-98881463 TAGAAAAAAAAGAATGGTAGTGG + Intergenic
1087540075 11:99505431-99505453 TACAGAAACAAGTATGATGTGGG + Intronic
1087719433 11:101645342-101645364 TAGATAATAAAGAATGATAAAGG + Intronic
1088145191 11:106668505-106668527 TAGAGATAATTGAATCATGGGGG + Intergenic
1088187672 11:107191072-107191094 TAGAGACAAAGGAAGGCTGGTGG + Intergenic
1088272309 11:108046636-108046658 TAGCCAAAAAATAATGGTGGTGG - Intronic
1089152124 11:116372299-116372321 TAGAGATAACTGAATCATGGGGG + Intergenic
1089342536 11:117768331-117768353 TTGAGATAAAAACATGATGGTGG + Intronic
1089834083 11:121354868-121354890 CAGACAAAAAACAATGATGAGGG - Intergenic
1089980074 11:122765012-122765034 TAGAAAAAAAAAAATGTAGGGGG + Intronic
1090071669 11:123549541-123549563 CAAAAAAAAAAGAATGATTGTGG + Intronic
1090252250 11:125259852-125259874 TAAAAAAAAAAGAATGGGGGTGG - Intronic
1090525819 11:127534674-127534696 TTGAGAAAAAAGAATAAAGCTGG - Intergenic
1090543447 11:127734670-127734692 TAGAGAGAAAGGAATGAATGAGG + Intergenic
1090941088 11:131389045-131389067 AAAAGGAAAAAGAAAGATGGTGG + Intronic
1091547947 12:1516884-1516906 TACAGAAAGTAGAATGGTGGTGG - Intergenic
1091636628 12:2202074-2202096 TAGAGAAATGATAATGATCGTGG + Intronic
1092055347 12:5504245-5504267 TAAAGAAGAAAAACTGATGGAGG - Intronic
1092143233 12:6198399-6198421 GAGAGAAGAATGAATGAAGGCGG - Intergenic
1092982458 12:13810153-13810175 AAGAGAATAAAGAATATTGGAGG - Intronic
1093039821 12:14365348-14365370 TAGAAAAGAAAGAAGGAAGGAGG - Intergenic
1093180551 12:15962246-15962268 TAAAGAAAAGAGAATGCAGGAGG - Intronic
1093281096 12:17197244-17197266 TATAGAAATAAAAATGATGTGGG - Intergenic
1093688164 12:22079578-22079600 GAGAGAAAAAAAAATGATATAGG + Intronic
1093692275 12:22121871-22121893 CAGAGAAAGAAGGAAGATGGGGG - Intronic
1093784240 12:23174328-23174350 TGGAGATAATTGAATGATGGGGG - Intergenic
1094026883 12:25968825-25968847 TAGAGAAAAAAATAAGGTGGGGG + Intronic
1094027079 12:25970205-25970227 TGGAGTAAAAACAATGAAGGTGG - Intronic
1094213056 12:27912846-27912868 AGGAGAAAAAAGAGAGATGGAGG + Intergenic
1094443285 12:30502891-30502913 TAGAGAAATTAGAATGTTTGGGG + Intergenic
1094589065 12:31804219-31804241 TAGAGAACAAATATTTATGGGGG + Intergenic
1094747866 12:33367195-33367217 AAAAGAAAAAAGAGTGATAGTGG - Intergenic
1095866596 12:46979225-46979247 TGGAGAAAAAAAAAAGATGTCGG + Intergenic
1096188406 12:49599042-49599064 TAGAGCAAAAAGAGAAATGGAGG + Intronic
1096314284 12:50550547-50550569 TAGAGTAAAATGAATCATGAGGG - Intronic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096749426 12:53749263-53749285 TGGAGAAAGAAATATGATGGAGG + Intergenic
1096945511 12:55403936-55403958 GAAAGAAAAAACAAAGATGGAGG + Intergenic
1096967830 12:55642743-55642765 TAGAGAAAGTAGAAAGATGAGGG + Intergenic
1097325365 12:58270528-58270550 TGGAGATAATTGAATGATGGGGG - Intergenic
1097343294 12:58464332-58464354 TAGAAAAGAAAGTTTGATGGAGG + Intergenic
1097533360 12:60834376-60834398 TAGAGAAAGAAGAATCAAGATGG + Intergenic
1097594796 12:61615826-61615848 TAGAGAAGAATCAATGGTGGAGG - Intergenic
1097668632 12:62511307-62511329 TTGAGAAAAAAGAACGAAGTTGG + Intronic
1098178013 12:67814100-67814122 TGGAGAAAATTGAATCATGGGGG - Intergenic
1098464656 12:70772781-70772803 AGGAGAAATAAGAATGATGTTGG + Intronic
1098500292 12:71184434-71184456 TAGAGAAAAGAGGATGAGTGTGG + Intronic
1098710153 12:73747746-73747768 TAGAGATAATCGAATCATGGGGG + Intergenic
1098835729 12:75422294-75422316 AAAAAAAAAAAGAATGATGTAGG - Intronic
1099060859 12:77906519-77906541 TAAAGAAAAAAAAATATTGGTGG + Intronic
1099115368 12:78617722-78617744 AAAAGAAAAAAGAAAGAAGGGGG + Intergenic
1099855342 12:88157541-88157563 TAGAGAAAAAAAGAGGATGAAGG - Intronic
1100555516 12:95689416-95689438 CAAAGAAACAAGAAAGATGGAGG - Intronic
1100673204 12:96838547-96838569 GAGAGAAAAAAAAGTGAGGGGGG + Intronic
1100806640 12:98292466-98292488 AAGAGAGAAAAGAAGAATGGAGG + Intergenic
1100887643 12:99089162-99089184 GTGAAAAAAAAAAATGATGGAGG - Intronic
1101172105 12:102108235-102108257 TAGAAAAAACAGACAGATGGAGG + Intronic
1101264685 12:103071556-103071578 TAGAGATAATTGAATCATGGGGG + Intergenic
1101427615 12:104600836-104600858 GAGGGAAAAAAGAGAGATGGGGG - Intronic
1101537059 12:105628243-105628265 ATGAGAAAAAAGAAAGAGGGGGG + Intergenic
1101887230 12:108676012-108676034 TAGGGAAAAGAAAATGATGAAGG + Intronic
1102052956 12:109876503-109876525 CAGAGAAGAAAGAAAGAGGGAGG + Intronic
1102077283 12:110069704-110069726 ATGAGAACAGAGAATGATGGAGG + Intronic
1102635871 12:114323384-114323406 TGGAGGAGAAAGAATGCTGGAGG - Intergenic
1102646463 12:114407004-114407026 TAGAAAAATCAGTATGATGGGGG - Intronic
1102887356 12:116532210-116532232 TAAAAAAAAAAAAAAGATGGTGG + Intergenic
1102906992 12:116684297-116684319 AAGAAAAAAAAGAATGAAGAAGG + Intergenic
1102972362 12:117179446-117179468 AAGGGAAAAAAAAAAGATGGAGG - Intronic
1103062093 12:117866877-117866899 TATGGCAAAAAGTATGATGGTGG + Intronic
1103076698 12:117989044-117989066 GACAGAAAGTAGAATGATGGTGG + Intergenic
1104208326 12:126661902-126661924 TAGAGATAATTGAATCATGGGGG + Intergenic
1104532948 12:129589602-129589624 TAGAGAAAGAACAGTGATGCAGG + Intronic
1104668887 12:130667100-130667122 GAGAAAAAAAGGAATGAGGGAGG + Intronic
1105208442 13:18242692-18242714 AAGAGAAAAAAATATGATGCCGG + Intergenic
1105289372 13:19039144-19039166 AATAGAAAGAAGAAAGATGGAGG - Intergenic
1106214371 13:27681667-27681689 TAGAGAGAGGAGAATGATGAGGG + Intergenic
1106397163 13:29392247-29392269 GACAGAAAATAGAATGGTGGTGG - Intronic
1106738224 13:32609959-32609981 TAGAGGAAAAAAGTTGATGGAGG + Intronic
1106947956 13:34849565-34849587 TGGAGAATAAAGCATAATGGAGG - Intergenic
1106980000 13:35268314-35268336 GACAGAAAATAGAATGGTGGTGG + Intronic
1107165123 13:37274694-37274716 CAGAGAAAATAAATTGATGGTGG + Intergenic
1107370283 13:39737959-39737981 GGGAGAAAAAAGAGTGATTGTGG - Intronic
1107514837 13:41119140-41119162 AAAAAAAAAAAGAATGAAGGTGG - Intergenic
1107828750 13:44354975-44354997 TAGAGAAAAAAAAATAAACGGGG + Intergenic
1109014460 13:56991928-56991950 TAGAGAAAAAAGAACATTTGTGG + Intergenic
1109397485 13:61779047-61779069 TAAAGAAAAAAGATTTTTGGTGG + Intergenic
1109599100 13:64599423-64599445 TAAAGAATAAAGAATGAAAGAGG - Intergenic
1109832734 13:67813244-67813266 TAGAGATAATTGAATCATGGGGG - Intergenic
1109846443 13:67997149-67997171 TAGAGAAAAAATAATGACTTAGG + Intergenic
1109935751 13:69282059-69282081 TATACAGAAAATAATGATGGTGG + Intergenic
1110572718 13:77024041-77024063 GAGAGAAAATAGAATGACAGAGG + Intronic
1110593959 13:77297442-77297464 TAAAGAAAAAAGGATGAAGTCGG + Intronic
1110665136 13:78107940-78107962 TATAGAATAAAGATTAATGGTGG + Intergenic
1110817222 13:79875610-79875632 AAGACAAAAAACAATTATGGAGG - Intergenic
1111015402 13:82373603-82373625 GGGAGATAAAAGAATCATGGAGG + Intergenic
1111077579 13:83258226-83258248 TACATGAAAAAGAATGATAGTGG + Intergenic
1111120911 13:83847720-83847742 AAGACAAAAAAGACTGATGAAGG + Intergenic
1111469625 13:88661424-88661446 TAGAGAAGAAAGAATGAAAAGGG - Intergenic
1111477044 13:88762978-88763000 TAGAGAAGAAAGCCTAATGGTGG + Intergenic
1111652204 13:91105502-91105524 TACAGAAAGAAAAATGATTGTGG + Intergenic
1111809084 13:93075639-93075661 TAGAGCAAAAGGAACCATGGAGG - Intergenic
1111860497 13:93698821-93698843 GAGAGAAAAAAGGAAGAAGGAGG - Intronic
1111907003 13:94266542-94266564 TAGAGAAGAAAGACTGAGGGAGG - Intronic
1112031488 13:95460588-95460610 TAGAGATAATTGAATCATGGGGG - Intronic
1112582936 13:100691919-100691941 CAGAGATAAATGAATCATGGGGG + Intergenic
1112820285 13:103326362-103326384 GAGAGAAAAAGAAAAGATGGTGG - Intergenic
1112843920 13:103614392-103614414 AAGAGAAAAAAGAAACATAGGGG + Intergenic
1112975398 13:105311597-105311619 TAGAGAGAATTGAATCATGGGGG - Intergenic
1113041841 13:106111976-106111998 TAGAAAAAAAAGAAAGAATGAGG - Intergenic
1113159272 13:107361577-107361599 TAGAGAAGAAATAATGCAGGAGG + Intronic
1113309602 13:109118164-109118186 TAGAGAAAAAAGAGTGATCAAGG - Intronic
1113653128 13:112051817-112051839 TTGAGAAAAAAGAATGGGGCAGG + Intergenic
1114307715 14:21438536-21438558 GAAAGAAAAAAGAAAGATGCCGG + Intronic
1114691796 14:24589726-24589748 AAGAAAAAAAAGAATGGTGATGG + Intergenic
1114722654 14:24898768-24898790 TAAAGAAAAAAGAATGCTTTTGG - Intronic
1114798425 14:25743076-25743098 TAGAGGAAAAGGAAAGATGAAGG + Intergenic
1114869966 14:26644505-26644527 TAGAGAAAAAAGAATAAAAAGGG - Intergenic
1115229624 14:31145978-31146000 TAAAAAAAAAAAAATTATGGAGG - Intronic
1115305884 14:31933038-31933060 AAGGGAAAGGAGAATGATGGAGG - Intergenic
1115340336 14:32287082-32287104 TGGAGATAAATGAATCATGGGGG + Intergenic
1115355426 14:32441620-32441642 TATAGAAAAATTAATGTTGGTGG + Intronic
1115375226 14:32667815-32667837 TAGAGAGAAAAGAATGAAGCAGG - Intronic
1116096170 14:40371825-40371847 AAGAGTAAAGAAAATGATGGAGG - Intergenic
1116197043 14:41741252-41741274 TTGAGCAAAAAGAATGAAGTAGG + Intronic
1116237675 14:42300185-42300207 TAGAGAATAAAGAAGGAGAGAGG + Intergenic
1116464251 14:45213329-45213351 AAGATAAACAAGAATGATGGGGG + Intronic
1116562958 14:46405214-46405236 TAATGAAAAAAAAATAATGGAGG - Intergenic
1116705571 14:48294371-48294393 TTGAGAAAAAAGAATAAAGCTGG - Intergenic
1116850804 14:49907076-49907098 TAAATAAAGAAGAATGATTGGGG - Intergenic
1117375015 14:55111928-55111950 TAGATAAAATATAATGATGCCGG - Intergenic
1117652803 14:57924393-57924415 GAGAGAGAAAAGGGTGATGGGGG + Intronic
1117742078 14:58828729-58828751 TAGGCAAAAAAGAATTGTGGTGG + Intergenic
1118121113 14:62844233-62844255 TAGAGAAAAAAGTAAGATATTGG + Intronic
1118147492 14:63156416-63156438 TGGGGAAAAAAGAACGATGGGGG - Intergenic
1118166522 14:63341609-63341631 TAGTTACAAAAGGATGATGGAGG + Intergenic
1118491120 14:66261380-66261402 TTGAGAAAGAAGAATAAAGGTGG - Intergenic
1118720316 14:68589358-68589380 TAAAGAAAAAAAAGTGAAGGCGG - Intronic
1119007497 14:70944757-70944779 TGGAGATAATTGAATGATGGGGG + Intronic
1119072442 14:71600536-71600558 CAGAGCAAAAAGAATGAAGCTGG - Intronic
1119250606 14:73150326-73150348 AAGAGGAAAAAGAATGGGGGAGG - Intronic
1119560440 14:75585185-75585207 GAGAGAAAGAAGAAAGATGTGGG + Intronic
1120005859 14:79357226-79357248 CAGAAAGAAAATAATGATGGAGG - Intronic
1120181087 14:81342866-81342888 CAGAGGAAAAAGAGTGGTGGTGG + Intronic
1120286707 14:82511571-82511593 TAGAGAAGAAAGGCAGATGGTGG - Intergenic
1120317227 14:82910958-82910980 AAGAGAAAAAAAAGTAATGGAGG + Intergenic
1120407776 14:84110289-84110311 TAGAGAGAGGAGAATGATTGAGG + Intergenic
1120442464 14:84558136-84558158 GGGAGAAAATAGAATCATGGGGG - Intergenic
1120629748 14:86875200-86875222 TAAAGAAAAAAGAAAGAGGCCGG - Intergenic
1120716354 14:87845127-87845149 AACAGAAAAATAAATGATGGGGG + Intronic
1120801464 14:88693479-88693501 TAGAGATAATTGAATCATGGGGG - Intronic
1120883821 14:89435987-89436009 TAAAGAAAAATGAGTGATGAAGG - Intronic
1121032758 14:90673430-90673452 AAGAGAAAAAAGAAGGAGCGCGG + Intronic
1122366958 14:101200032-101200054 CAAAGAAAAAAAAAAGATGGCGG + Intergenic
1122487881 14:102093970-102093992 AAAAGAAAAAAGAAGGAAGGTGG + Intronic
1123497576 15:20843585-20843607 TTGAGGAAAAACAATGCTGGAGG + Intronic
1123554808 15:21417225-21417247 TTGAGGAAAAACAATGCTGGAGG + Intronic
1123591054 15:21854540-21854562 TTGAGGAAAAACAATGCTGGAGG + Intergenic
1124228808 15:27922775-27922797 TATTAAAAAAAAAATGATGGTGG - Intronic
1124430050 15:29599247-29599269 AAGAGAAATAATAATGATGCAGG + Intergenic
1125181543 15:36885337-36885359 TAGAGAAAAAGGAAGGCAGGTGG + Intergenic
1125692612 15:41608585-41608607 GTGAGAACAAAGAATGATGAAGG - Intergenic
1125717743 15:41828637-41828659 AATAGAAAAAAGAAGGAAGGAGG - Intronic
1125834775 15:42739435-42739457 TAGGGAAAAAAGAGGGAGGGGGG - Exonic
1126024633 15:44434032-44434054 TAGAGAAAACAGATTGATAATGG + Intronic
1126347567 15:47712336-47712358 TAGAAAAAAAATAAGGATTGAGG + Intronic
1126551890 15:49940590-49940612 TAGACAAAGAAAAATGAGGGTGG + Intronic
1126747813 15:51844346-51844368 TAGATGTAAATGAATGATGGGGG + Intronic
1126820069 15:52494062-52494084 TAGACAGAAAAGAATGAGGCAGG + Intronic
1126838707 15:52694893-52694915 AAAAAAAAAAAGAATAATGGGGG - Intronic
1127006900 15:54581055-54581077 AAGAGAAAAAAGAATCATCCAGG + Intronic
1127226123 15:56931162-56931184 TACAGAAAAAAAAATTGTGGTGG + Intronic
1128102810 15:65017793-65017815 TAAAAAAAAAAGAAAGAAGGAGG + Intronic
1128763980 15:70239763-70239785 AAGAAAAACAAGAATGATAGGGG - Intergenic
1129943027 15:79514857-79514879 TAAAGAAAAAAAAAAGAAGGAGG - Intergenic
1130030244 15:80307458-80307480 TAGAGAAAAAAGAATGAAAAGGG - Intergenic
1130313289 15:82772836-82772858 GAGAAAAAAAAGAATTATGGAGG - Intronic
1130790739 15:87153276-87153298 TAAAGTAAAAAGAAAGATCGAGG - Intergenic
1130987229 15:88852405-88852427 TAGAGGAGAAAGAATCAGGGAGG + Intronic
1131646451 15:94350134-94350156 TAGAGTATAAAGAAAGATGCTGG + Intronic
1131744591 15:95433347-95433369 TATAGAAAAAAAAATGAAGGAGG - Intergenic
1131911665 15:97212075-97212097 AAGAGAAAGAACACTGATGGTGG + Intergenic
1131923385 15:97354658-97354680 TAAAGGCAAGAGAATGATGGTGG - Intergenic
1132005481 15:98222718-98222740 TAAAGAAAAAAGAAAGACAGAGG - Intergenic
1202963155 15_KI270727v1_random:144422-144444 TTGAGGAAAAACAATGCTGGAGG + Intergenic
1133542055 16:6765527-6765549 TAAGAAAAAAAGAATGCTGGTGG + Intronic
1133671855 16:8030546-8030568 AAGAGAAAAATGAGTGATGCTGG + Intergenic
1134215597 16:12314713-12314735 TAAATCAAAAAGAATGTTGGGGG + Intronic
1134423653 16:14117619-14117641 TAGACAAATAAGAATGCTTGTGG + Intronic
1135387826 16:22059725-22059747 TAGAGGAAACTGAATCATGGGGG - Intronic
1135507225 16:23049492-23049514 TGGAGAAAACTGAATCATGGGGG + Intergenic
1135521429 16:23181686-23181708 GAGAGAAAGAAGAAAGAGGGAGG + Intergenic
1135956406 16:26959924-26959946 GAGAGACAGAAGAATGATCGGGG - Intergenic
1136074799 16:27809657-27809679 GAGAGAAAAGAGAGGGATGGAGG - Intronic
1137243889 16:46687298-46687320 GAGAGAAATAAGGATGATGAGGG + Intronic
1137548528 16:49420707-49420729 TTAAGAAAAAAGTATGATGGGGG - Intergenic
1137837611 16:51608107-51608129 TAGAAAAGAAAGGATGAAGGTGG - Intergenic
1137998659 16:53249766-53249788 TAGAGAAAACATAATGCTGCAGG + Intronic
1138436900 16:57006284-57006306 TAAAGAAAAAATAAATATGGTGG - Intronic
1138742840 16:59330900-59330922 TAGAGATAATTGAATCATGGGGG - Intergenic
1138810330 16:60141471-60141493 TTGAAAAAAAAGAAGGATGGAGG + Intergenic
1139073044 16:63406848-63406870 TAGAAAAAAAAAAAGGATTGTGG + Intergenic
1139216946 16:65135301-65135323 TTGAGAAAAAAAAATGAAGATGG - Intergenic
1139518046 16:67463536-67463558 GAAAGAAAAAAGAAAGAGGGAGG + Intronic
1139554089 16:67695295-67695317 AAGAGAAAAGAGAGAGATGGTGG - Intronic
1139618043 16:68112782-68112804 TAGAGAAAAAAAAAAAATGTCGG - Intronic
1139633388 16:68244212-68244234 AAAAGAAAAAAGAAAGAGGGAGG + Intergenic
1140036505 16:71375553-71375575 TAAATAAATAAGAATGATGATGG + Intronic
1140556372 16:75926045-75926067 TTAAGAAAGAAGAATGATGAAGG + Intergenic
1142345301 16:89550162-89550184 CAAACAAAAAAGAATGACGGGGG - Intronic
1142723101 17:1790828-1790850 TAAAGAAAAAAGATTCATGCCGG + Intronic
1143760783 17:9102448-9102470 TAGAGATAATTGAATCATGGGGG - Intronic
1143915180 17:10286426-10286448 TAGGGAGAAAAGAGGGATGGAGG - Intergenic
1143982527 17:10882287-10882309 TAGAGAAAAGAGCATCCTGGAGG + Intergenic
1144553175 17:16259528-16259550 GAAAGAAAAAAGAATGAAGCTGG + Intronic
1146629956 17:34462734-34462756 AAGAGCAAACAGGATGATGGGGG + Intergenic
1147497669 17:40933235-40933257 AAGAGGAAAAAGAATGAGGCAGG - Intronic
1147497781 17:40934296-40934318 TAGAGAAAACACAATGTTAGAGG + Intronic
1148771352 17:50068800-50068822 TAAATAAAAAAGACTGATTGAGG - Intronic
1148883478 17:50752421-50752443 TAAAGAAAAAAGTATGATACAGG - Exonic
1148952325 17:51324343-51324365 AAGAAAAAAAAGAGGGATGGAGG - Intergenic
1149089944 17:52765550-52765572 CAGAGAAAAAAAAATGCTGATGG + Intergenic
1149159327 17:53671981-53672003 TAGAGAAAGAAGAAGTGTGGTGG + Intergenic
1149267296 17:54940771-54940793 TAAAGAAACAAGAATGATACAGG + Intronic
1149402872 17:56316685-56316707 GAGAGAAAAATAAATGAGGGTGG + Intronic
1149478031 17:56979825-56979847 TACAAAAGAAACAATGATGGAGG - Intronic
1149558333 17:57590130-57590152 TGGAGAAAAAAAAATGAGGGAGG - Intronic
1149751656 17:59151959-59151981 CAAAGAGAAAATAATGATGGGGG + Intronic
1149952990 17:61011531-61011553 TATAGAAAAAATAATTCTGGAGG - Intronic
1150502032 17:65660286-65660308 GAGAGAAAAGAGAAGGAGGGAGG - Intronic
1150554347 17:66240314-66240336 GAAAGAAAAAAAAAGGATGGAGG + Intronic
1150638897 17:66936220-66936242 TAGAGACAAAAGTAGAATGGTGG - Intergenic
1150870115 17:68898372-68898394 TAAAGAATAAAAAATGATGAAGG + Intronic
1151258772 17:72900454-72900476 AAGAGAAAGAGGAATGAAGGGGG + Intronic
1151504294 17:74516429-74516451 CTGAGACAAAAGGATGATGGTGG + Intergenic
1152351979 17:79789405-79789427 CAGAGAAAGAAGACTGCTGGTGG + Intergenic
1153567091 18:6429553-6429575 CAGAGAGAAAAAAATGAAGGAGG - Intergenic
1154078454 18:11229421-11229443 TAGAGAAAACAGAGAGAAGGAGG - Intergenic
1154285457 18:13051924-13051946 TGTACAAAAAAGAAAGATGGTGG + Intronic
1154395277 18:13981887-13981909 AAAAGAAAAAAGAAAGAAGGTGG - Intergenic
1155304736 18:24467879-24467901 TTGGGAAGAAAGAATGATGTTGG + Intronic
1155346043 18:24858028-24858050 AAGAGAAAAAAAAAAGATAGCGG + Intergenic
1155406170 18:25490256-25490278 TACAGCAAAAAGAATACTGGGGG - Intergenic
1155444574 18:25897719-25897741 CAGATAAAAAAGAATGAAAGAGG - Intergenic
1155530989 18:26766076-26766098 TAAAAAAAAGAAAATGATGGTGG + Intergenic
1156105282 18:33652053-33652075 TAGAGATCAAAGAATGATTTAGG + Intronic
1156608453 18:38697410-38697432 AAAATAAAAAAGAATGGTGGTGG - Intergenic
1156806470 18:41188680-41188702 TAGAGAAAAAAGAGTGAACAAGG + Intergenic
1157448224 18:47764332-47764354 CAGAGAAAACAGAATGCTGTTGG + Intergenic
1157565960 18:48679574-48679596 TAGACAGAAAAGACTGTTGGGGG + Intronic
1157698883 18:49746857-49746879 GAGAGAAAACAGAATGAATGTGG - Intergenic
1158036146 18:53033122-53033144 TATAGAAATAAGAATGTTGTGGG + Intronic
1158760322 18:60377590-60377612 TAGAGAAATATGAACCATGGCGG - Intergenic
1158854754 18:61531717-61531739 TAGAGATAACTGAATCATGGGGG + Intronic
1159212795 18:65348884-65348906 TAGAGATAATTGAATCATGGGGG + Intergenic
1159215698 18:65387807-65387829 TGGAGACAATTGAATGATGGGGG + Intergenic
1159248033 18:65835441-65835463 TAGAGGAGAAAGGATGATGAGGG - Intronic
1159523557 18:69558089-69558111 TGGAGAAAAAAGAATAATAAAGG - Intronic
1161829050 19:6589715-6589737 AAGAGAAAAAAGACAGATAGAGG - Intronic
1161918771 19:7250559-7250581 TAAAGAAAAAGGAAGGAAGGAGG + Intronic
1162719005 19:12650656-12650678 AAAAGAAAAAAGAATTATGTGGG - Intronic
1163116266 19:15190571-15190593 GAGAGAAAAAAAGATGATGCTGG - Intronic
1164015314 19:21251301-21251323 AAAAAAAAAAAGAATGATGCTGG + Intronic
1164780838 19:30890792-30890814 TAGAGACAAAAGAAAGACAGTGG - Intergenic
1165370187 19:35400504-35400526 GAAAGAAAAAAGAAGGAAGGAGG + Intergenic
1166776896 19:45318503-45318525 GAGAGAAGAAAGAGTGCTGGGGG + Intronic
1167242457 19:48352472-48352494 TAAAAAAAAAAAAATTATGGAGG + Intronic
1167921009 19:52783347-52783369 AACAAAAAAAGGAATGATGGAGG - Intronic
1168389633 19:55995531-55995553 TTGAGCAAAAAGAAAGCTGGAGG - Intergenic
1168427632 19:56252037-56252059 TAAAGAAAAAAGAATTCTGAAGG + Intronic
1202671142 1_KI270709v1_random:53783-53805 TAGAGAAAAGACAATTATGTAGG - Intergenic
924968470 2:100739-100761 TAGAGGGAACAGAAAGATGGAGG + Intergenic
925433112 2:3814218-3814240 TAGAGAAAAAAGAATGAAAAGGG - Intronic
926280442 2:11441870-11441892 TGGAGAAAATTGAATCATGGGGG - Intergenic
926442781 2:12907582-12907604 TACAGTAGAAAGAATGGTGGGGG - Intergenic
926508731 2:13746607-13746629 TAGAGAAAAAAGAACGAAAAAGG + Intergenic
926540284 2:14169019-14169041 GAGAGATAATATAATGATGGTGG - Intergenic
926627444 2:15104073-15104095 TAGAGATAATTGAATCATGGGGG + Intergenic
927127179 2:20022587-20022609 TAGAGATAATTGAATCATGGGGG - Intergenic
928589351 2:32798248-32798270 TACAAAAAAATGAATGGTGGCGG + Intronic
929021156 2:37554605-37554627 TTGAGAAATAAGATTGTTGGTGG + Intergenic
929113056 2:38421579-38421601 TGGAGATAAATGAATCATGGGGG - Intergenic
929251153 2:39757074-39757096 TAGAGACCAAAGAATCATGACGG + Intronic
929667392 2:43843652-43843674 CAAAGAAAAAGAAATGATGGGGG + Intronic
930371320 2:50504881-50504903 CAGACAAGAAAGAATGATGCTGG - Intronic
930476875 2:51892761-51892783 TAGAGAAAAAAGAATGAAAACGG + Intergenic
930493127 2:52102052-52102074 TGGAGATAACAGAATCATGGGGG - Intergenic
930654710 2:53996344-53996366 GAGATAAAAAAGGAGGATGGAGG + Intronic
930666545 2:54104855-54104877 TAGACAAAAAAGGCTGATAGGGG + Intronic
930876250 2:56220870-56220892 TAGAGGAAAAAGTATGCAGGTGG + Intronic
931567971 2:63636402-63636424 TTGAGAAAAAACAAAGCTGGTGG + Intronic
931834756 2:66086524-66086546 AAGAGAAAAAAAAATGATACAGG + Intergenic
932061473 2:68504247-68504269 TTGAGAAAAAAGAATAATATTGG - Intronic
932093586 2:68827726-68827748 GAGAGAAAAAGGAATGACAGAGG - Intergenic
932285359 2:70526844-70526866 TACAGAAAGAAGAATGAAGGTGG + Intronic
932306461 2:70706996-70707018 AAAAGAAAAAAAAATTATGGTGG + Intronic
932517204 2:72364213-72364235 TAAAGAAAAAAAAATGAGGGGGG + Intronic
932805084 2:74776749-74776771 TAAAGAAAAAAGAATTATCTTGG - Intergenic
933086188 2:78057470-78057492 CATAGAAAAAAGAACCATGGAGG - Intergenic
933102940 2:78282943-78282965 TAGAGATAATTGAATCATGGTGG + Intergenic
933221541 2:79695734-79695756 TAGAGAAGAAAGGTTAATGGAGG + Intronic
933453154 2:82483092-82483114 GAAAGAAAAAAGAAAGAGGGAGG - Intergenic
933946416 2:87289780-87289802 TTTTGAAAAAAGAATGATTGAGG + Intergenic
934756703 2:96829221-96829243 GAGAGAAAAAAGACAGAGGGTGG - Intronic
934797012 2:97110098-97110120 CTTAGAAAAAGGAATGATGGAGG - Intergenic
934836402 2:97593329-97593351 CTTAGAAAAAGGAATGATGGAGG + Intergenic
934870843 2:97863756-97863778 TGGAGAAAAGGGAATGTTGGTGG + Intronic
935822315 2:106906545-106906567 CAGAGAAACAAAAATCATGGAGG - Intergenic
936333779 2:111571761-111571783 TTTTGAAAAAAGAATGATTGAGG - Intergenic
936654489 2:114469132-114469154 GAGAGACAAAACAATGCTGGTGG + Intronic
936721172 2:115254351-115254373 TGGAGAAAATTGAATCATGGGGG - Intronic
937142286 2:119612517-119612539 TAGAGATAACTGAATCATGGGGG - Intronic
937491189 2:122370316-122370338 TGGAGAAAAAGGAATGAGGTTGG + Intergenic
937586317 2:123555908-123555930 AAGAGAAAAAACAATAATGAAGG + Intergenic
937624010 2:124023984-124024006 TAGAGAAGAAAGAATTCTGAGGG - Intergenic
937872366 2:126795316-126795338 TGGAAAAACAAAAATGATGGAGG + Intergenic
938032848 2:128010204-128010226 GAAAGAAAAAAGAGTGAAGGAGG + Intronic
938224144 2:129601280-129601302 TAGAGAAAAAAGAGTGAAAATGG - Intergenic
938284427 2:130097223-130097245 TTGAGGAAAAACAATGTTGGAGG + Intronic
938335066 2:130485789-130485811 TTGAGGAAAAACAATGTTGGAGG + Intronic
938354759 2:130634880-130634902 TTGAGGAAAAACAATGTTGGAGG - Intronic
938431180 2:131241668-131241690 TTGAGGAAAAACAATGTTGGAGG - Intronic
938621558 2:133059932-133059954 CAGAAAAAAAAAAATGAGGGAGG + Intronic
938686625 2:133744112-133744134 TGGAGATAAATGAATCATGGGGG - Intergenic
938787954 2:134650015-134650037 AAAAAAAAAAAGAATGATGTAGG + Intronic
938928043 2:136062196-136062218 GAGGGAAAAAATAATGATGTGGG - Intergenic
939352937 2:141064107-141064129 TAGAGAAATAAGAGTAAAGGAGG + Intronic
939468180 2:142585018-142585040 TAGAGATAATTGAATCATGGGGG + Intergenic
940182015 2:150944628-150944650 TAGTCAAAAAAGAATGTTGCTGG - Intergenic
940350184 2:152675949-152675971 TGTAGAAAAATGAATTATGGGGG - Intronic
940596316 2:155796981-155797003 TGGAGATAATAGAATCATGGGGG - Intergenic
940610540 2:155985673-155985695 TAGAGAATAAAGAATGGCTGTGG + Intergenic
940780560 2:157929303-157929325 AAGAGAAAAAAAAATTGTGGTGG - Intronic
940807578 2:158205318-158205340 TACAGAAAAGGGAATGCTGGAGG + Intronic
941430681 2:165409980-165410002 AAAAGAAAAAAAAATGATGGAGG + Intergenic
942022499 2:171880740-171880762 TAGAGAAAATAGAATAATGATGG - Intronic
942411193 2:175710557-175710579 TAGAGAAAAAAGAATAAAAAAGG + Intergenic
942710008 2:178823168-178823190 CAGAGAAAAAATAATCATGGTGG - Intronic
943031841 2:182694808-182694830 TAGAGGAAAAAAAAAGGTGGGGG + Intergenic
943408616 2:187518839-187518861 TAGAGAAAAAAGAATGAAAAAGG - Intronic
943635537 2:190302623-190302645 TAGGGAAGAAAGACTAATGGTGG + Intronic
943765055 2:191651777-191651799 AACAAAAAAAAAAATGATGGAGG + Intergenic
944321104 2:198343478-198343500 GAGAGAAAAAATACTAATGGGGG - Intronic
944349406 2:198709188-198709210 GAGAGAAAAAAGAAGGGAGGAGG - Intergenic
944395311 2:199259852-199259874 TATAGAAGAATGATTGATGGAGG + Intergenic
944494685 2:200294889-200294911 TTGGGAAAAGAGAATGCTGGTGG + Intergenic
944855383 2:203762242-203762264 TAGAAGGAAAAGAATGAAGGGGG - Intergenic
945162699 2:206908917-206908939 TAGATAAAACACAAAGATGGGGG + Intergenic
945225817 2:207530296-207530318 CAGCGAACAAAGAATAATGGCGG + Intronic
945600556 2:211858109-211858131 TAGGGAAATAAGACTGAAGGAGG + Intronic
945637193 2:212370120-212370142 TAGAGATAATTGAATCATGGGGG + Intronic
946550403 2:220795074-220795096 AAGAGAAAAAAGAATTTTTGTGG + Intergenic
947249616 2:228087090-228087112 CAGCCAAAAAAGAAAGATGGAGG + Intronic
947264955 2:228268301-228268323 TAGGGAAATAAAAATGATAGTGG + Intergenic
947282497 2:228470931-228470953 GAGAGAATAGAGAAAGATGGGGG - Intergenic
947394371 2:229672589-229672611 GAGAGGAAAAAGGATGAGGGAGG + Intronic
947491495 2:230599289-230599311 TTGAGAAAGAAGAATGAAGATGG + Intergenic
1169176790 20:3523360-3523382 TAGAGAAAAAAGAATGAAAAAGG + Intronic
1169529875 20:6473599-6473621 TAAAGAAGAAATGATGATGGAGG + Intergenic
1169709870 20:8549519-8549541 TGGAGATAAATGAATCATGGGGG + Intronic
1169859617 20:10137544-10137566 TAGATAAAAAAAATTGAAGGGGG + Intergenic
1170253159 20:14308830-14308852 GAAAGAAAAAATAAAGATGGAGG + Intronic
1170274517 20:14569566-14569588 AAGAGAAAAAAAAAAGGTGGGGG - Intronic
1170451107 20:16484903-16484925 TAGAGAAAAAAGGATGCTCGTGG + Intronic
1170496347 20:16929059-16929081 GAGAGAGAGAAGAATGAAGGAGG - Intergenic
1170544369 20:17422042-17422064 TAAAGAAAACTAAATGATGGTGG + Intronic
1170986163 20:21261053-21261075 TGGAGATAATAGAATCATGGGGG - Intergenic
1171335353 20:24380634-24380656 CAGAAAACAAAGAATGATGAAGG - Intergenic
1171498407 20:25574348-25574370 TAGAAAAAAAAAAAAGACGGTGG - Intronic
1171565115 20:26176017-26176039 TATAGTAAAAAGAAAAATGGTGG + Intergenic
1172127404 20:32633064-32633086 TAGAGATAATTGAATAATGGTGG - Intergenic
1172371432 20:34395397-34395419 GAGAGAAAGAAGATTGAGGGAGG + Intronic
1172452586 20:35038028-35038050 CAGAGAAAAAAGCAGAATGGTGG + Intronic
1172536374 20:35676653-35676675 TGGATAAAAAAGAAAGCTGGAGG + Intronic
1172822430 20:37749271-37749293 AATAGAAAAAAGAATGAGAGTGG - Intronic
1173069535 20:39749182-39749204 AAGAGAAAATAGAAAGATGAAGG - Intergenic
1173112740 20:40208719-40208741 TAACGAAAACAGCATGATGGTGG + Intergenic
1173708297 20:45131146-45131168 TTAAGCAAAAAGTATGATGGTGG - Intergenic
1173772793 20:45678005-45678027 GAGAAAAAAAAGAATGAAGAAGG - Intergenic
1173780179 20:45749411-45749433 GAGAGGAAATAGACTGATGGAGG + Intronic
1174207041 20:48847805-48847827 TATAGAAATCAGAAGGATGGGGG - Intergenic
1174892849 20:54416181-54416203 TTAAAAAAAAAGAATAATGGTGG - Intergenic
1174985587 20:55448093-55448115 TACAGAAAAAAGAAAGAGAGAGG - Intergenic
1175038722 20:56025279-56025301 TATAAAAAATAGAATGATGGAGG + Intergenic
1175082566 20:56433329-56433351 TAGAGAGAACAGCATGATGGAGG + Intronic
1176051665 20:63123056-63123078 TACATAAAAAAGAATGAAGCTGG - Intergenic
1176694706 21:9960095-9960117 TTGAGAAAAAAAAATACTGGAGG + Intergenic
1176972623 21:15284624-15284646 TAGAGATAATTGAATCATGGGGG - Intergenic
1177035670 21:16039460-16039482 TAGAGAAAATTGAATCATGGGGG - Intergenic
1177063131 21:16397532-16397554 AAGAGAAAGAAGAAAGATGTGGG + Intergenic
1177145884 21:17406641-17406663 TGGAGATAATAGAATCATGGGGG - Intergenic
1177642253 21:23858509-23858531 TAGAGAATAATGAATGAGAGTGG + Intergenic
1177755317 21:25340197-25340219 GAAAGAAAAAAGAATGAAAGTGG + Intergenic
1177907214 21:26986571-26986593 AACTGAAAAAAGAATGATAGGGG - Intergenic
1177909038 21:27008069-27008091 TAGAGATAATTGAATCATGGGGG + Intergenic
1177932003 21:27296797-27296819 TGGAGATAAATGAATTATGGGGG + Intergenic
1178173860 21:30074785-30074807 TGGAGATAATAGAATCATGGGGG + Intergenic
1178183581 21:30193168-30193190 TGAAGACAAAAAAATGATGGTGG - Intergenic
1178273026 21:31210940-31210962 TTGAAAAAAAAAAATGATTGGGG - Intronic
1178327339 21:31656645-31656667 AAGAGAAAGAAGAAGGAAGGAGG - Intergenic
1178587036 21:33879350-33879372 CAGAAAAAAAAGAAAGATTGAGG + Intronic
1178682145 21:34681306-34681328 TAGAGATAATTGAATCATGGAGG - Intronic
1178940703 21:36902648-36902670 AAGAGAGAAAAGAAGGAAGGAGG + Intronic
1179409591 21:41152443-41152465 TAGAGAAAACTGAATCATGGGGG - Intergenic
1180252638 21:46599163-46599185 TATAGCAGAAAGAATGATGCAGG + Exonic
1180414770 22:12698682-12698704 TAGAGAGAAAAGAATAAGGCCGG + Intergenic
1181867092 22:25867308-25867330 TGGAGAATAAAGAATTATGGTGG - Intronic
1182934199 22:34205736-34205758 TAGAAAAAAAGGAATGGTGGAGG + Intergenic
1183182572 22:36270624-36270646 TAGAGAAAAAAGAATGACAATGG - Intergenic
1184216724 22:43072452-43072474 AAGAGAGAAAATAAAGATGGTGG - Intronic
1184360553 22:44015286-44015308 TAGAAAAAAAATAATTTTGGGGG - Intronic
1185006820 22:48282870-48282892 GAGGGAAAAAAGAAGGAGGGAGG + Intergenic
949124973 3:436323-436345 AAGATAGAAAAGAATGATGCTGG + Intergenic
949453922 3:4218043-4218065 GAGAGAAACAAGAATGAGGAGGG + Intronic
949462766 3:4311309-4311331 TGGAGACAAAATAATAATGGAGG + Intronic
949464276 3:4328586-4328608 TGGAGAAAATTGAATCATGGAGG - Intronic
949637712 3:6001812-6001834 TTGAGAAAAATGAATCAAGGAGG - Intergenic
949994560 3:9606272-9606294 AAGAATAAAAAGAATGAGGGAGG - Intergenic
950263410 3:11558467-11558489 TAAAAAAAAAAAAATCATGGGGG - Exonic
950295776 3:11829006-11829028 TATAGTAAAAAGATAGATGGGGG + Intronic
950383078 3:12634133-12634155 AAGAGAGAAAGGAATCATGGAGG - Intronic
950403878 3:12792452-12792474 AAAAGAAAAAAGAATGAGGGTGG - Intergenic
950856150 3:16107272-16107294 TAGAGATAATGGAATCATGGGGG - Intergenic
951659606 3:25047909-25047931 TAGAGATAATTGAATCATGGGGG + Intergenic
951676290 3:25246015-25246037 TAGAGAAAAAAGAATGGAAAGGG - Intronic
951744344 3:25960819-25960841 TAGAGAGAAAAAAATGATGAAGG + Intergenic
951760230 3:26139440-26139462 TTGAGCAAGAAGAATGATGGTGG + Intergenic
951993078 3:28697730-28697752 TACACAAAAAAGAAAAATGGAGG - Intergenic
952017350 3:28973649-28973671 TAGATAAAAAAGAATAATTTGGG + Intergenic
952022278 3:29038574-29038596 GAAACAAAAAAGAAAGATGGTGG - Intergenic
952287583 3:31982972-31982994 TAAGGAAAAGAGAAAGATGGTGG - Intronic
952583322 3:34861503-34861525 TACAGTTAACAGAATGATGGCGG - Intergenic
952589207 3:34931165-34931187 TAGAGACAAATGAATTATGGGGG + Intergenic
952973017 3:38666880-38666902 TTGAGCAAAAAGAATGAAGCTGG + Intergenic
953176418 3:40557407-40557429 TGGAGAAAAAGGAATGTTGGTGG - Intronic
953181029 3:40595529-40595551 AGGAGAGAAAAGAATGAAGGAGG - Intergenic
953483075 3:43269046-43269068 TAAAGAAAAAAGAAAAAAGGAGG + Intergenic
953988223 3:47462203-47462225 AAGATAAAAAAGATGGATGGTGG - Intronic
954187521 3:48929713-48929735 TAGTGTGACAAGAATGATGGAGG - Intronic
954730905 3:52660980-52661002 AAGAGAAAAAAGAATAGTAGAGG - Intronic
955122429 3:56073918-56073940 TGTAGAAAAAAGAAAGATTGTGG - Intronic
955537043 3:59934833-59934855 TGGAGAAAATTGAATCATGGGGG - Intronic
955644373 3:61121039-61121061 TAGAGAAAAAAGAATGAAAAGGG + Intronic
955763486 3:62315195-62315217 TAGAGAGAATTGAATCATGGTGG - Intergenic
955775777 3:62431393-62431415 TAAAAAAAAAAGATTGAGGGGGG - Intronic
956148111 3:66212669-66212691 TAGAGATAAAAGTAGCATGGTGG - Intronic
956181511 3:66522183-66522205 TAGAGATAATTGAATCATGGGGG - Intergenic
956245727 3:67180860-67180882 TAGAGAAAAAGGAATGAGATGGG - Intergenic
956486124 3:69723683-69723705 GAGAGAAAAAAGAATGAAAAAGG - Intergenic
956654952 3:71540371-71540393 TAGAAAAGAAAGAGTGAAGGGGG + Intronic
957005273 3:74938312-74938334 AAGCAAAAAAAGAATGAAGGGGG - Intergenic
957126788 3:76171730-76171752 TTGTGCAAAAAGAATGAGGGTGG + Intronic
957293196 3:78304389-78304411 GAGAGGAAAAAGAATGATTCAGG + Intergenic
957541247 3:81572031-81572053 TGGAGATAACAGAATCATGGGGG + Intronic
957682726 3:83458514-83458536 TGGAGAAAAAAGACTGAAGTGGG - Intergenic
957782769 3:84841132-84841154 TGGAGATAATTGAATGATGGGGG - Intergenic
957785770 3:84880628-84880650 TAAAGGAAAAATAATGTTGGTGG - Intergenic
957791658 3:84949627-84949649 TAGAGAACAAAGAACGCTGGTGG + Intergenic
958001648 3:87757778-87757800 TACGGAAAGAAGAATGATAGGGG + Intergenic
958060780 3:88477003-88477025 TAAAAAAAAAAGAATGAAAGTGG + Intergenic
958065220 3:88536151-88536173 TGGAGAAAATTGAATCATGGGGG + Intergenic
958117167 3:89234980-89235002 AAGAGAAAAAAGAAAGGAGGAGG - Intronic
958141563 3:89569645-89569667 TTGAGAAAAAAGAATGAAACTGG + Intergenic
958160724 3:89814585-89814607 TGGAGAAAATTGAATCATGGGGG - Intergenic
958608922 3:96399093-96399115 TAGAGATAAAATAATGAAGAAGG - Intergenic
958728369 3:97933707-97933729 CAGAGCAAAAAGGCTGATGGAGG - Exonic
958992709 3:100865756-100865778 AAGAGAAAAAAGTATAATTGGGG + Intronic
959258317 3:104042896-104042918 TGGAGATAATAGAATTATGGGGG - Intergenic
959266307 3:104144253-104144275 TAGATTAAAAAGAATTATAGAGG - Intergenic
959320970 3:104875355-104875377 TTGACAAAAAAGAATGATGTAGG - Intergenic
959434274 3:106294840-106294862 AAGAGAAAAAAGAAAGATGTGGG - Intergenic
960089015 3:113620269-113620291 AAGAGGAAGAAGAATGATGTAGG - Intronic
960226759 3:115178305-115178327 TAGAGAACAAAGAATGAAAAAGG - Intergenic
961719527 3:128883654-128883676 TAGAAAAAAAAAAAGGTTGGAGG - Intronic
961924277 3:130460781-130460803 TGGAGATAAAAGTATGAAGGTGG + Intronic
962113495 3:132475511-132475533 AGGAGAAACAAGAAAGATGGTGG + Intronic
962236699 3:133713029-133713051 GGGAGAAGCAAGAATGATGGCGG + Intergenic
962360573 3:134739278-134739300 TATAGAAAAAAGAATTATTGAGG + Intronic
962377790 3:134873160-134873182 GAGAGAAAAAGGAAGGAGGGAGG + Intronic
962937845 3:140097620-140097642 TTTAGAAAAGAAAATGATGGGGG + Intronic
963131090 3:141858501-141858523 TAGAAAGAAAAGAAAGATGATGG + Intergenic
963204263 3:142616327-142616349 TAGAGAAAAAAGAATGATGGAGG + Intronic
963253997 3:143126528-143126550 TAGGGAAGAAAGAAAGTTGGAGG - Intergenic
963526083 3:146415172-146415194 TAGAGTAAAAATAAAGAAGGTGG + Intronic
964095460 3:152926480-152926502 TGGATAATAAAGAATGGTGGGGG - Intergenic
964212919 3:154247922-154247944 GAGGGAAAAAAGAATGACAGTGG - Intronic
964229977 3:154454539-154454561 AAAAGAAAAAAAAATGTTGGAGG - Intergenic
964270843 3:154954752-154954774 TAGAGAGAAAAGAATTATGAAGG + Intergenic
964750598 3:160050670-160050692 AAAAAAAAAAAGAATGCTGGTGG - Intergenic
964930589 3:162017107-162017129 TAGAGGTAACTGAATGATGGGGG + Intergenic
965107978 3:164382940-164382962 TGGAGTAAAAAGAAAAATGGGGG + Intergenic
965305424 3:167058510-167058532 TAGAGATAACTGAATCATGGTGG - Intergenic
965309372 3:167110342-167110364 TAGAGACAAAAGAATAAGGAAGG - Intergenic
965503530 3:169484278-169484300 AAGAGAAAAAAGAAAGAAAGAGG + Intronic
966072815 3:175900085-175900107 TAGAGATAATTGAATCATGGGGG - Intergenic
966539488 3:181074046-181074068 TAGAGAAAAAAGAATGAAAAAGG - Intergenic
966818002 3:183904958-183904980 TAAAAAAAAAAGCATTATGGAGG + Intergenic
967070804 3:185960959-185960981 TGGAGATAAATGAATGCTGGGGG + Intergenic
967216108 3:187211954-187211976 TAGAGATACAAGAATGAAAGAGG + Intergenic
967292743 3:187937069-187937091 TAGAGTAAAAATAAAGAGGGAGG - Intergenic
967612841 3:191528240-191528262 TAGATAGAACAGAAAGATGGAGG + Intergenic
968182415 3:196605932-196605954 AAAAAAAAAAAGAATTATGGAGG + Intergenic
968686739 4:1964727-1964749 AAGAGAAAAATGAAAGAGGGGGG - Intronic
970739486 4:19217793-19217815 TGGAGAAAACTGAATCATGGGGG + Intergenic
971072595 4:23111457-23111479 AGGAGAGAAAAGAATGAAGGAGG + Intergenic
971072986 4:23115565-23115587 TAAAGAAAAAAACATGAGGGTGG + Intergenic
971084502 4:23256182-23256204 TTGAGAAAAAAGAAACCTGGAGG - Intergenic
971384297 4:26128776-26128798 GAGAGATAATAGAATCATGGGGG + Intergenic
971445758 4:26746451-26746473 TAGTAAAATGAGAATGATGGAGG - Intronic
971819757 4:31536582-31536604 TACAGCAAAAACAATGCTGGGGG - Intergenic
972063564 4:34910942-34910964 GAGAGAAAAATGAATCATGGGGG + Intergenic
972065005 4:34931123-34931145 TAGAGAAAAGAGTAGAATGGTGG + Intergenic
972640245 4:40918737-40918759 CAGAGAAAAAATAAGGAAGGAGG - Intronic
972744043 4:41915956-41915978 TAGGGAAAAAAGTATCATAGAGG - Intergenic
973083345 4:46023481-46023503 TAGAGAAAAATGAATTATGGAGG + Intergenic
973103414 4:46300745-46300767 TATAGAAAAAAGAATAATTTAGG - Intronic
973636521 4:52866203-52866225 AAGAGAAAAAAGAAAAAAGGGGG - Exonic
973656712 4:53055658-53055680 GAGAGAAAAAAGAATGAAACAGG + Intronic
973848075 4:54933457-54933479 GAGAGAAAAAATAATAATGCAGG - Intergenic
974109913 4:57512988-57513010 AGGGGAAAAAAGAATCATGGGGG - Intergenic
974521734 4:62989587-62989609 TAGAATAAAAAGTATGATGTTGG + Intergenic
975009698 4:69334474-69334496 TGTAGAAAAAAAAATGATGAGGG - Intronic
975146371 4:70971930-70971952 TAGAGAAAGAAGAAAGAAGGAGG - Intronic
975519534 4:75285230-75285252 CTGAGAACAAAGAATGATCGTGG + Intergenic
975804449 4:78097686-78097708 TGGAGATAACTGAATGATGGGGG - Intronic
975912624 4:79284895-79284917 AAAAAAAAAAAGAATGATTGAGG + Intronic
975925179 4:79442308-79442330 TGGAGATAATAGAATCATGGGGG + Intergenic
976006948 4:80441001-80441023 GAGAGAAAAAAGAATGAAAAGGG + Intronic
976066864 4:81197774-81197796 TAGTGAAAAAAAAATGAAGGAGG + Intronic
976263802 4:83171473-83171495 CTGAGTAAAAAGAAAGATGGTGG - Intergenic
976278966 4:83307801-83307823 GAGAGAAAAAAGAATGAAGATGG + Intronic
976286662 4:83377077-83377099 TAGGGAAAAAAGTCTAATGGTGG - Intergenic
976306137 4:83561129-83561151 TAGAGAAAACAGCACAATGGGGG + Intronic
976324924 4:83760459-83760481 TAGAGATAGAAAAATCATGGGGG + Intergenic
976398349 4:84582110-84582132 AAGAGAAAAAAGAAAAAAGGCGG - Intergenic
976554210 4:86432095-86432117 TAGAGAAGAAAGCCTAATGGTGG + Intronic
976579973 4:86724806-86724828 TAAAAAAAAAAGAATGAAAGTGG - Intronic
976580578 4:86730935-86730957 TAGAGTAGAAAGAATGAAAGTGG - Intronic
976626366 4:87187983-87188005 TAGTGAAAAAAGACTGAGGAAGG - Intronic
976838103 4:89398989-89399011 TAGAGGAAAAGGAATGCAGGAGG + Intergenic
977077769 4:92479138-92479160 TTCAGAAAAAATAATAATGGTGG + Intronic
977422772 4:96824125-96824147 TAGAGAGAAAGGAAGGAGGGAGG - Intergenic
977862851 4:101987065-101987087 TAGAGACAAAAGTATGAGGCTGG + Intronic
977925158 4:102692315-102692337 TAGGGAAAGAAGAAAGATGAGGG + Intronic
978414041 4:108456934-108456956 TAGGGAAAATGGACTGATGGTGG - Intergenic
978686979 4:111457580-111457602 TAGAGATAATTGAATCATGGGGG + Intergenic
978734685 4:112072651-112072673 AGGAGAAAGAAGAATGAAGGAGG + Intergenic
979013993 4:115408552-115408574 AAGAAAAAAAAGAATGAGAGTGG - Intergenic
979038242 4:115753439-115753461 TAGAGATAATCGAATCATGGAGG + Intergenic
979141332 4:117179568-117179590 AACAGAAAAAAAAATGATGATGG + Intergenic
979247453 4:118525167-118525189 TGGAGAAAAAAGGAGGGTGGTGG + Intergenic
979265725 4:118700583-118700605 CAGAGAAAAATAAATGATCGAGG - Exonic
979362472 4:119781117-119781139 TAGAGCAAATAAAAAGATGGGGG + Intergenic
979472327 4:121114114-121114136 TAGAACAAAAAGAATGACTGTGG - Intergenic
979490123 4:121316445-121316467 TAGTGAAAAAAGATTTCTGGAGG - Intergenic
979678909 4:123438112-123438134 TAGAGAAAGAAGCATGATTTTGG - Intergenic
979828826 4:125275245-125275267 AAGAGAAGAAAGAATGATCTTGG + Intergenic
980042362 4:127953910-127953932 GAGAGAAAACAGGATGATTGGGG + Intronic
980096712 4:128499149-128499171 CCGAGGAAAAAGAATGAAGGTGG - Intergenic
980233946 4:130079276-130079298 TAGAGATAAGTGAATCATGGGGG - Intergenic
980289230 4:130824359-130824381 TAGAGAAAAGAGAGGGAGGGAGG - Intergenic
980367330 4:131820318-131820340 TTGAGAAAAAAAAATACTGGAGG + Intergenic
980641703 4:135588423-135588445 TATAGAAAAGACAATGATTGTGG - Intergenic
981152596 4:141396439-141396461 TAGAGAGAGAAGACTGAGGGTGG + Intergenic
981198328 4:141946519-141946541 TGGAGAAAAAGGATTGCTGGTGG + Intergenic
981488591 4:145315130-145315152 TTGAGAAAAATGAGTGCTGGAGG + Intergenic
981795509 4:148590381-148590403 GAGAGATAAATGAATCATGGGGG + Intergenic
981860385 4:149348594-149348616 TAGACAAAAAAGAGAGATTGTGG - Intergenic
982132322 4:152240983-152241005 AAGAGAAAAAAAAATGAAGGGGG + Intergenic
982262532 4:153507396-153507418 TAGAGAAAAAGCAAGCATGGGGG - Intronic
982916058 4:161210913-161210935 TTGAGCAAGAAGAATAATGGTGG - Intergenic
983086181 4:163447344-163447366 TAGAAAAAAACAAATGCTGGCGG - Intergenic
983139255 4:164127909-164127931 AAAAGAAAAAAAAATGAAGGGGG + Intronic
983315917 4:166133218-166133240 TAGAGAAAAAAGAATGAAAAAGG - Intergenic
983393777 4:167167920-167167942 TGGAGAAAACTGAATCATGGGGG + Intronic
983455002 4:167952717-167952739 TTGAGAAAAATGATTTATGGTGG + Intergenic
983689142 4:170446788-170446810 TAGAGATAATTGAATAATGGAGG - Intergenic
983864811 4:172753108-172753130 TAGAGATAACTGAATCATGGGGG + Intronic
984198104 4:176684494-176684516 TAGAGACACAAGAGTGAGGGTGG - Intronic
984342052 4:178469884-178469906 AAGAGAAATGACAATGATGGGGG - Intergenic
984436470 4:179716815-179716837 TAGATAAAGAAGAGTGAGGGAGG + Intergenic
984565766 4:181328454-181328476 TAGAGAAAATTGAATCACGGAGG + Intergenic
984602540 4:181745073-181745095 TAGAGAAGAAAGGAAGATCGAGG + Intergenic
984661664 4:182381418-182381440 TAAAGAAAAAATAATGATTTTGG + Intronic
984837111 4:184032486-184032508 GAAAGAAAAAAGAATGAAGAAGG - Intergenic
985004327 4:185518657-185518679 TGGAGAAAAAAGGATGATGAGGG - Intronic
985171450 4:187154335-187154357 TGGAGAACAGAAAATGATGGTGG + Intergenic
985851855 5:2394271-2394293 TAGAGAAAAAAAAATAAAGGAGG + Intergenic
986251896 5:6067555-6067577 AAGTGAAAAAAAAATGATGTGGG - Intergenic
986372849 5:7098086-7098108 CAGAAAAAAAAAATTGATGGTGG - Intergenic
986922717 5:12707329-12707351 AAGAGAAACAAGAATGGTGGTGG - Intergenic
987212538 5:15697604-15697626 GAGTGAGAACAGAATGATGGAGG + Intronic
987226089 5:15842651-15842673 TGGAGATAATAGAATCATGGAGG + Intronic
987453761 5:18118906-18118928 AAGAGGAAAAAGAGTGATGGAGG - Intergenic
987457443 5:18164869-18164891 TAGAGATAATTGAATCATGGGGG - Intergenic
987512216 5:18855196-18855218 GAGAGAAAATTGAATCATGGGGG + Intergenic
987528863 5:19088984-19089006 TAGAGAACAAAAAATGATCATGG - Intergenic
987595858 5:19998263-19998285 TAGAGAAACAAGTATGAAGACGG + Intronic
987617705 5:20298006-20298028 AAGTGAAAATAGAATAATGGGGG - Intronic
987734699 5:21825547-21825569 AAGGGAAAAGAAAATGATGGGGG - Intronic
987885936 5:23812230-23812252 TAGAGATAAAACATTGAAGGGGG + Intergenic
988053181 5:26056644-26056666 TAGAAGAAAAACAATGCTGGTGG + Intergenic
988053885 5:26066802-26066824 TAGAGGAAAAGAAATGATGGGGG - Intergenic
988095395 5:26601970-26601992 GAGAGAAAAAAGAAGGAAGTGGG - Intergenic
988111525 5:26828459-26828481 TAGAGAAAAAACAATGACAATGG - Intergenic
988295755 5:29359536-29359558 TAGATAAAATAAAATGAAGGTGG + Intergenic
989112804 5:37923603-37923625 TAGAGATAATTGAATCATGGGGG - Intergenic
989142325 5:38213879-38213901 TAGAGAAAAGAGAATGAGGAGGG + Intergenic
989437306 5:41429733-41429755 AAGAGAAAAAGGAATGACGAAGG + Intronic
989659817 5:43787666-43787688 GAGAGAAAGAAGAAAGATGTGGG - Intergenic
990900788 5:60746828-60746850 TATAGGAAAAAGAAAGATGAGGG + Intergenic
991025575 5:62025960-62025982 TAGAGAAAAAAGAATAAAGAGGG - Intergenic
991059675 5:62360288-62360310 TACACTAAAAAGTATGATGGAGG - Intronic
992253112 5:74895356-74895378 TAGAGAAAAATGGATGATTTAGG - Intergenic
992288523 5:75261058-75261080 AAGAAAAAAAAGAATGTTGAAGG - Intergenic
992735377 5:79714026-79714048 TAGGAAAGACAGAATGATGGTGG + Intronic
992751525 5:79867148-79867170 GAGACCAAAAAGAAAGATGGAGG - Intergenic
992836655 5:80648349-80648371 TGGAGATAAATGAATTATGGGGG + Intronic
992899835 5:81283048-81283070 AAGAATAAAAAGAATGAAGGAGG - Intergenic
993820764 5:92613510-92613532 TAGAATAAAAAGAATGAGTGGGG + Intergenic
993824692 5:92668467-92668489 AAGAAATAAAAGAATGATTGTGG - Intergenic
994046540 5:95316744-95316766 TAGAGATAATTGAATCATGGTGG - Intergenic
994310220 5:98260394-98260416 TAAAAAAAAAAAAATGATAGGGG - Intergenic
994690685 5:103015912-103015934 TAGGAAAAATATAATGATGGGGG - Intronic
995110869 5:108427546-108427568 TAAAGAAAAAAGAATGAAAAGGG - Intergenic
995132578 5:108646303-108646325 TAGAAAAAAAAAAACCATGGAGG - Intergenic
995691520 5:114831017-114831039 TAGAGAAAAAAGAATGAAAAAGG + Intergenic
995752551 5:115469512-115469534 TAGAGAAAAAAAAAGGATCTTGG - Intergenic
995777227 5:115737055-115737077 TAAACAAAAAAGAATGAAAGGGG - Intergenic
995812554 5:116123919-116123941 TAGATAAAAAAAAATGATAAAGG - Intronic
996255312 5:121394770-121394792 AAAATAAAAAAGAATGATGTGGG + Intergenic
996270684 5:121601301-121601323 TTGAGAAAGAAGAAAGCTGGAGG - Intergenic
996351898 5:122553117-122553139 TAGTGAAATAATAATCATGGTGG - Intergenic
996614897 5:125429554-125429576 GAGAGAAGAAAGAATGCTGATGG + Intergenic
996706162 5:126500975-126500997 TACAGAAATAAGAATTATAGTGG - Intergenic
998270364 5:140700894-140700916 GAGAGAGAAAAGAAAGATGGTGG + Exonic
998533985 5:142912061-142912083 TAGATAAAAAAGATTGACAGAGG + Intronic
998635892 5:143954325-143954347 TAGAAAGAAAAGAGTTATGGAGG - Intergenic
998754367 5:145359965-145359987 TAGAGAAAAAAGAATTCCTGAGG + Intergenic
998758887 5:145410666-145410688 TAGAGATAACTGAATCATGGGGG - Intergenic
998955049 5:147430193-147430215 GGAAGAAAAAAGAAGGATGGGGG + Intronic
999341498 5:150777600-150777622 TAGTAAAAAAAGATTGAAGGAGG - Intergenic
999647274 5:153730483-153730505 TGGAGAAATAAGAATAATGATGG + Intronic
999655098 5:153803545-153803567 TAGAGAAGAAAGATTGAAGAAGG + Intronic
999822723 5:155244376-155244398 TAGAGATAATTGAATCATGGGGG - Intergenic
999881179 5:155866213-155866235 TAGAGAAAAGAGATGGAGGGAGG - Intergenic
1000139281 5:158385821-158385843 TAGAGATAACTGAATCATGGGGG - Intergenic
1000270496 5:159679101-159679123 TAGAGATAATTGAATAATGGAGG + Intergenic
1001054196 5:168435833-168435855 AAAAGAAAAAAGAAAGATGAGGG - Intronic
1001363866 5:171117320-171117342 AAGAGCAAAAAAAATGCTGGTGG - Intronic
1001591955 5:172871737-172871759 TGGGGAACAAAGAATGTTGGCGG + Intronic
1002038868 5:176495910-176495932 AAGAGAAAAAAAAATGATGATGG + Intronic
1002527657 5:179823855-179823877 TAGAGAAAAAAGAGTGCCGGCGG + Exonic
1002628739 5:180553166-180553188 TAGAGAAAATGAAATAATGGGGG - Intronic
1003061307 6:2864923-2864945 TGGAGAAACAAGAAAGATTGTGG - Intergenic
1003126654 6:3361285-3361307 AAAAAAAAAAAGAATGATGTAGG - Intronic
1003591180 6:7438138-7438160 TAAAGAAAAAAGAAAAAGGGAGG + Intergenic
1003704715 6:8512400-8512422 TAGAAAAAGAAGAGTGATGAGGG - Intergenic
1004731280 6:18361659-18361681 AAGATAAAAAAAAATAATGGGGG - Intergenic
1004795209 6:19075114-19075136 AAGAGAGAAAAAAATGAAGGAGG - Intergenic
1004962345 6:20804323-20804345 GAGAGAAAATAGAATGAGAGAGG + Intronic
1005062087 6:21786051-21786073 TACAGGAAAGAGAATGAAGGAGG - Intergenic
1005258588 6:24032111-24032133 TGGAGAAAATTGAATCATGGAGG - Intergenic
1005436845 6:25821228-25821250 GAGAGAAAAAAGAAGAATGGAGG - Intronic
1006096284 6:31658757-31658779 AAAAAAAAAAAGTATGATGGTGG - Exonic
1006251941 6:32795011-32795033 TAGAGAAAAGTGAAAGATCGAGG - Intergenic
1007017878 6:38487696-38487718 AAAAGAAAAAAGAAAGGTGGAGG + Intronic
1007166816 6:39834305-39834327 GAGTGAAAAAAGAAGGATGTAGG - Intronic
1007436646 6:41817610-41817632 AAAAGAAAAAAGAAAAATGGTGG - Intronic
1007573961 6:42912774-42912796 TATAGAAAGTAGAATGTTGGTGG + Intergenic
1007642391 6:43352510-43352532 AATAGAAAAGAGAATGTTGGAGG - Intronic
1007681122 6:43634192-43634214 AAGAAAAAAAAAAAGGATGGAGG - Intronic
1008071135 6:47100304-47100326 CAGAGAACAAAGGAAGATGGAGG - Intergenic
1008159470 6:48059777-48059799 TAGAGGTTAAAGAGTGATGGTGG - Intronic
1008209858 6:48707734-48707756 CACAGAAAAAAAAATCATGGAGG - Intergenic
1008265886 6:49425790-49425812 CAGAGAAAAAAGTAGAATGGTGG - Intergenic
1008367849 6:50703774-50703796 TAGAGGAAGAAGAAAGAGGGAGG - Intergenic
1008383079 6:50855695-50855717 TAGAGAAAACTGAATCATGGGGG + Intergenic
1008527551 6:52421099-52421121 TGGAGAAAAAAGAATGGGGTTGG - Intronic
1008752115 6:54747504-54747526 AAGAGAAAAAAAAAGGATGAAGG - Intergenic
1008770766 6:54976756-54976778 GATAGAAAAAATAAAGATGGTGG + Intergenic
1008796976 6:55314636-55314658 TTGAGAAAAAATAATGCTGCAGG - Intergenic
1008902582 6:56638505-56638527 CAGAGGAAAAAAAATGATGCTGG - Intronic
1009060169 6:58388740-58388762 TAGAGAAAAAGGAATGAAAAGGG + Intergenic
1009230745 6:61058653-61058675 TAGAGGAAAAAGAATGAAAAGGG - Intergenic
1009300039 6:62006815-62006837 TAGATATCAAAGGATGATGGTGG + Intronic
1009440937 6:63677287-63677309 TAGATAAAGAAGAAAGATGGGGG + Intronic
1009482942 6:64183020-64183042 TAGAGATAACTGAATCATGGGGG + Intronic
1010104613 6:72151954-72151976 TTGAGAACAAAGAGAGATGGGGG + Intronic
1010515054 6:76762411-76762433 TAGAGACAATTGAATCATGGGGG - Intergenic
1010566209 6:77417485-77417507 TAGTAAAAACAGAAAGATGGAGG - Intergenic
1010816251 6:80361131-80361153 CAGAGAGAAAAGAATGAAGCTGG - Intergenic
1010835498 6:80582880-80582902 TAGAGAAAAAAGAAAGAGCAGGG + Intergenic
1010846518 6:80715831-80715853 TAGATGAGAAAAAATGATGGAGG + Intergenic
1010933685 6:81834956-81834978 TAAAGGAAGAAGAATGAGGGAGG + Intergenic
1011240897 6:85270365-85270387 CAGAGGAAAAGGAATGATGATGG - Intergenic
1011273916 6:85609145-85609167 TAGAGAGAAAATGATCATGGTGG + Intronic
1011287504 6:85740653-85740675 GAGAGAAAAAAAAATGTAGGAGG - Intergenic
1011302500 6:85891371-85891393 TAGAGAAAAAAGAATAAAAAGGG - Intergenic
1011868411 6:91861275-91861297 CACAGAAAAAAGTTTGATGGAGG + Intergenic
1012356865 6:98324970-98324992 TAAAGAAAAAAGAATAAAGAAGG - Intergenic
1012666104 6:101972256-101972278 CAGACAAAAAACAATGATGCTGG - Intronic
1012732698 6:102902045-102902067 AAGGGAATAAAGAATGAAGGAGG + Intergenic
1012876246 6:104731417-104731439 TAGAAAAAAAAGAACAAAGGTGG + Intronic
1012931957 6:105326785-105326807 CAGAGAAAAGAGAAAAATGGAGG + Intronic
1012974305 6:105763557-105763579 AAGAGAAAAAAGGGTAATGGAGG - Intergenic
1013066331 6:106687593-106687615 TAGAGAAAACAGAAATATTGGGG - Intergenic
1013169190 6:107620769-107620791 CACAGAAAAAAGAAATATGGTGG - Intronic
1013175140 6:107670130-107670152 TAAAAAAAAAAGAGAGATGGGGG + Intergenic
1013571864 6:111435361-111435383 TTGAGCAAAAAGAAAGCTGGAGG + Intronic
1013743787 6:113320510-113320532 TGGAGAAAATTGAATCATGGGGG + Intergenic
1014213296 6:118729407-118729429 AAGAGGAAAAAGGATGCTGGAGG + Intergenic
1014215962 6:118753002-118753024 GAGAGAGAAAAGAAGGATTGAGG - Intergenic
1014229558 6:118888142-118888164 TGGAGAAATTAGAATGCTGGTGG + Intronic
1014321697 6:119937613-119937635 CAGAGAAAAGGGAATGCTGGTGG - Intergenic
1014365667 6:120538185-120538207 GAGAGAAACAACAATGTTGGAGG + Intergenic
1014411057 6:121121705-121121727 AATGGATAAAAGAATGATGGAGG - Intronic
1014810821 6:125883677-125883699 TAGGGGAAAGAGAAGGATGGGGG - Intronic
1015187131 6:130430564-130430586 TAGAAAAAAAAGGAAGATGGTGG - Intronic
1015195607 6:130521970-130521992 GAGAGAAAATTGAATCATGGGGG - Intergenic
1015361991 6:132350649-132350671 CTGTGAAGAAAGAATGATGGTGG + Intronic
1015870953 6:137775885-137775907 TAGAACAAAAAGAATAATAGGGG - Intergenic
1016137707 6:140566417-140566439 TAGAGAAAAGAGAATCAGGTAGG + Intergenic
1016139597 6:140592941-140592963 TGGAGAAAACTGAATCATGGCGG + Intergenic
1016242008 6:141941533-141941555 TAGAGAAAAAAGAATGAAAAGGG + Intergenic
1016297281 6:142586876-142586898 TAGAGAAGAAAGCCTAATGGTGG - Intergenic
1016537985 6:145130048-145130070 TAAAGAAAAAAAAAGGCTGGAGG - Intergenic
1016914448 6:149232108-149232130 TAGAAAGAGAAGAATGATTGGGG + Intronic
1017092335 6:150771114-150771136 AAGAAAAATAAGAATGAGGGTGG + Intronic
1017200469 6:151748416-151748438 AAGAGTAAAAAGAATGAGGCAGG - Intronic
1017379752 6:153814289-153814311 TAGAGCACAAATAATGATGGTGG + Intergenic
1017429887 6:154360709-154360731 TAGAGGAAATTGAATCATGGGGG - Intronic
1017656245 6:156632721-156632743 TAATGAAAAAATAAGGATGGAGG - Intergenic
1018008631 6:159647677-159647699 GAGAGAAGGAAGAAGGATGGAGG + Intergenic
1018209720 6:161469178-161469200 TGGAGATAAATGAATCATGGGGG + Intronic
1018581796 6:165314287-165314309 AAGAGAAAAAAGCAAGGTGGAGG - Intergenic
1019762473 7:2823971-2823993 GTGAGCAAAAAGAATGGTGGTGG - Intronic
1020594178 7:10183507-10183529 TAGAGCAAGGAGAATGATTGTGG + Intergenic
1020621938 7:10529054-10529076 TAGAGAAAAAAGAATGAAAAAGG + Intergenic
1020917378 7:14212749-14212771 TAGAAAAAAAAGTATTTTGGTGG - Intronic
1020952934 7:14704049-14704071 AGAAGAAAAAATAATGATGGGGG - Intronic
1020962858 7:14827696-14827718 TGGAGAAGAAAGACTTATGGGGG + Intronic
1021037683 7:15820871-15820893 CAGAGAAGAAAGAGTGATTGAGG + Intergenic
1021226445 7:18033581-18033603 TAAAATAAAAAGAATGAGGGTGG - Intergenic
1022054951 7:26720817-26720839 TGGAGATAATTGAATGATGGGGG - Intronic
1022090350 7:27103924-27103946 TAGAAAAAAAAGAGAGAGGGAGG - Intergenic
1023278093 7:38542046-38542068 AAGAGAAAAAAAAATATTGGTGG + Intronic
1023676050 7:42631520-42631542 TGGAGAAAATTGAATCATGGGGG - Intergenic
1024361501 7:48473556-48473578 TAAAGAAAAAAGAATGAATCAGG + Intronic
1024438789 7:49390422-49390444 AAGAGAAAAGGGAATGTTGGTGG - Intergenic
1024635478 7:51285792-51285814 TTGAAAAATAAGAATGTTGGAGG + Intronic
1024654322 7:51436486-51436508 TAGAGAAAACATTATTATGGAGG - Intergenic
1024737171 7:52318206-52318228 AAGAGAAAAAAAAATGAAGCAGG - Intergenic
1024778218 7:52813875-52813897 TTGAGAAAGAAGAATGAAGCAGG - Intergenic
1024846275 7:53646450-53646472 AAGAAAAAGAAGAAAGATGGTGG - Intergenic
1024988730 7:55218524-55218546 AAGAGAAAAAGGAATGATAGAGG + Intronic
1024990419 7:55230779-55230801 TAGAGAAAAAAGAATGAAAAGGG - Intronic
1026131836 7:67627380-67627402 TTGAGAAAACAGAAGTATGGAGG + Intergenic
1026159694 7:67857790-67857812 TGGAGAAAGCAGACTGATGGTGG + Intergenic
1026250791 7:68668691-68668713 GAGAGAGAAAAGAATTAGGGAGG + Intergenic
1026389668 7:69887862-69887884 AAGAGAAAAAAAAATGAAAGAGG - Intronic
1026406524 7:70071798-70071820 TAGACAAAAAAGAAATATTGTGG + Intronic
1026407335 7:70080155-70080177 TACACTTAAAAGAATGATGGAGG + Intronic
1026527730 7:71169965-71169987 TAAAAAAAAAAAAATGATGAAGG - Intronic
1026544063 7:71306412-71306434 CAGAGAAAGAAGAATAGTGGGGG - Intronic
1027591494 7:80124757-80124779 GGGAGAAAAAAGAAAGAAGGAGG + Intergenic
1027608646 7:80331752-80331774 TAAGGAAATAGGAATGATGGAGG + Intergenic
1027647030 7:80814468-80814490 TAAAAAGAAAAGAATGACGGTGG - Intronic
1027850924 7:83451002-83451024 TAGAGATAATTGAATCATGGGGG + Intronic
1028055820 7:86241293-86241315 GAGAGAAAAAATAAAGAGGGAGG + Intergenic
1028202193 7:87974908-87974930 CAGAGAAGAAGGTATGATGGTGG - Intronic
1028391197 7:90319755-90319777 TACAGAAAAAAAAATGAGAGAGG + Intergenic
1028576574 7:92358583-92358605 AAAAAAAAAAAGAATCATGGGGG - Intronic
1028718350 7:94000487-94000509 TACAGTAAGGAGAATGATGGAGG + Intronic
1028727629 7:94106100-94106122 TAGAGAAAAATGAATTCAGGAGG + Intergenic
1029118879 7:98253032-98253054 AGGAGAAAAAAGAAAGATGTCGG + Intronic
1029320694 7:99756824-99756846 TAGAGAAGAGAGAGTCATGGTGG - Intergenic
1029584867 7:101463841-101463863 AAGAGAAAAAAGAGGGAGGGAGG - Intronic
1029634135 7:101772729-101772751 AAGAGAAGAAAGAAAGAGGGAGG + Intergenic
1029848850 7:103442127-103442149 TAAAAAAAAAAGAGTGATGAAGG - Intronic
1029939136 7:104461256-104461278 TAGAGATAATTGAATCATGGAGG - Intronic
1030486686 7:110177530-110177552 TAGAGATAATTGAATCATGGGGG + Intergenic
1030507252 7:110440644-110440666 TAAAGAAAAAAGAAAGATCAGGG + Intergenic
1030784636 7:113644908-113644930 TGGAGATAAATGAATCATGGGGG - Intergenic
1031250944 7:119379698-119379720 AAGAGAAAAGAGAAAGATTGTGG - Intergenic
1031289628 7:119916714-119916736 AAAAGAACAAAGAATGATGATGG - Intergenic
1031318227 7:120284810-120284832 TAGAGAAAGAAATATAATGGGGG - Intronic
1031360145 7:120839634-120839656 TTGAGAAAAAAAAATCATTGTGG + Intronic
1031390427 7:121207011-121207033 TGGAGAAAAAAGAAAGTTGCAGG - Intronic
1031543281 7:123022418-123022440 TAAAGAAAAAAAATAGATGGGGG + Intergenic
1031627886 7:124011169-124011191 TAAAGAGAAAAGAATTATTGTGG + Intergenic
1031789826 7:126087992-126088014 TAGAGATAATTGAATTATGGCGG - Intergenic
1031834546 7:126667649-126667671 AAAAGGAAAAAGAATGATGTAGG + Intronic
1032116296 7:129120512-129120534 TTGAGCAAAAAGAAAGCTGGAGG - Intergenic
1032312433 7:130801225-130801247 TAGAGAAAAAGGAATGAAAAAGG - Intergenic
1032362077 7:131265368-131265390 GAGAGAAGAAAGAAAGAAGGGGG - Intronic
1032858324 7:135855406-135855428 CAAAGAAAAAAAACTGATGGAGG - Intergenic
1032928402 7:136636777-136636799 GAGAGAGAAAAGAATGAAGAGGG + Intergenic
1032932768 7:136693383-136693405 AAGAGAAATAACAATGATGCTGG - Intergenic
1033467763 7:141611540-141611562 AACAGAAGAAAAAATGATGGTGG + Intronic
1033622469 7:143074591-143074613 GAGAAACAAAAGAGTGATGGGGG - Intergenic
1033788343 7:144761160-144761182 TAGAGAAATAAGAATGAAAAAGG + Intronic
1033924898 7:146445729-146445751 TAGAGCAAGATGAATGAGGGAGG + Intronic
1033934958 7:146572975-146572997 TGGAAAAAGATGAATGATGGAGG + Intronic
1034026452 7:147709316-147709338 TAAAGAAAAAAGTAAGATGCGGG - Intronic
1034044294 7:147911633-147911655 GACAGAAAATAGAACGATGGTGG - Intronic
1034046288 7:147931851-147931873 TAAAGAAAAAAGAATGTTATTGG - Intronic
1034610050 7:152358391-152358413 TAGGGAAAAAAGAGAGATAGAGG + Intronic
1034867557 7:154655419-154655441 TAGTTAAAAAAAAATGATGAAGG - Intronic
1035673458 8:1437631-1437653 TACAGAAAAAAAGCTGATGGAGG - Intergenic
1036048065 8:5166113-5166135 GAGAGGAAAAAAAATGATGGAGG + Intergenic
1036199980 8:6762555-6762577 TTGAGGAAAAAGAATAAAGGTGG - Intergenic
1036530800 8:9584748-9584770 TAGAGAATAAGGAGAGATGGAGG - Intronic
1036911866 8:12764237-12764259 TAGAGACAGAAGAATATTGGGGG - Intergenic
1037166181 8:15831738-15831760 TAGAGAAAAAAGAATGAAAAGGG + Intergenic
1037193610 8:16158621-16158643 TAGAGAAAAAAAAAAGAAGCAGG - Intronic
1037331106 8:17744571-17744593 AAAAGTAAAAAGATTGATGGTGG - Intronic
1037446867 8:18974119-18974141 CATAGAAAAATAAATGATGGTGG - Intronic
1037525711 8:19722282-19722304 TAAATAAAAAATACTGATGGAGG - Intronic
1037933108 8:22895710-22895732 AAGAGAGAAAAGAAGGCTGGGGG - Intronic
1038254752 8:25941203-25941225 TCGAAAAAAAAAAAAGATGGGGG - Intronic
1038318856 8:26510779-26510801 TTGAGAAAAAAGAAAAAAGGAGG + Intronic
1038432153 8:27509056-27509078 TAGAGAAAAAAGCAGGATGGGGG - Intronic
1038669357 8:29570077-29570099 TGGAGATAAATGAATCATGGGGG - Intergenic
1038703494 8:29872993-29873015 TAGAGATAATTGAATCATGGTGG + Intergenic
1038788796 8:30648176-30648198 GAGAGAATAAAGCATGTTGGAGG + Intronic
1038928354 8:32165564-32165586 TAGAGAAACAAGACTGTTAGAGG + Intronic
1039118222 8:34116161-34116183 GTGAGATAAAAGAATCATGGGGG + Intergenic
1039295603 8:36148747-36148769 TAATCAAAAAAGTATGATGGTGG - Intergenic
1039432316 8:37534585-37534607 GAGAGTAACAAGAATGGTGGAGG + Intergenic
1040629532 8:49194336-49194358 AAAAGAAAAAAAAATCATGGTGG + Intergenic
1041133908 8:54735503-54735525 TAGAGAATAGAGAATGATTGAGG + Intergenic
1041146909 8:54885967-54885989 TTGAGAAAGAAGAATAAAGGTGG - Intergenic
1041453371 8:58031841-58031863 GAGAGAAGAAAGAAGGAAGGAGG - Intronic
1041894089 8:62903920-62903942 TAGAGATAATTGAATCATGGGGG - Intronic
1041985413 8:63916741-63916763 GAGAGAAAAAAGAAAGATGTAGG - Intergenic
1042122102 8:65499250-65499272 TAGAGATAATTGAATCATGGGGG - Intergenic
1042424024 8:68625049-68625071 AACAGAATAAAGAATGATAGAGG + Intronic
1042636098 8:70877225-70877247 TGGAGATAAATGAATCATGGGGG - Intergenic
1042832319 8:73044727-73044749 AACAGAAAGTAGAATGATGGTGG - Intronic
1042916051 8:73877577-73877599 TAAAGAAAAAAAAATGGAGGAGG + Intronic
1043080728 8:75761529-75761551 GAGAGAAAACTGAATCATGGAGG + Intergenic
1043088607 8:75869641-75869663 GAGAGATAAATGAATCATGGGGG - Intergenic
1043110535 8:76174527-76174549 TAGAGAAAAAGGAAAGAATGGGG + Intergenic
1043206050 8:77442097-77442119 TAGAGCATAAAGAATAAAGGTGG - Intergenic
1043321308 8:78989969-78989991 TAGACAAAAGAGAATGGAGGTGG - Intergenic
1043775411 8:84261344-84261366 TGGAGATAATAGAATCATGGGGG + Intronic
1044431816 8:92116433-92116455 CTGAGAAAAAAGAATAAAGGTGG - Intergenic
1044769332 8:95613539-95613561 TAGAGAAAAAAGTACAATGCTGG - Intergenic
1044867377 8:96585520-96585542 AAGAGAAATGAGAAGGATGGGGG + Intronic
1044962756 8:97546905-97546927 TAGAAAAAAAAAAAAGATAGTGG + Intergenic
1045021236 8:98046001-98046023 AGGAAAAAAAAGAATGACGGCGG + Intronic
1045441872 8:102221868-102221890 TAGAGAAAAAAGAAGGGAAGAGG - Intronic
1045463854 8:102451184-102451206 TAAAGAAAAAAAAATTATGCCGG + Intergenic
1045669956 8:104539779-104539801 AAGATAAAAAAAAATGAGGGAGG + Intronic
1045888669 8:107128539-107128561 TAGAGAAAATTGAATCATGGGGG - Intergenic
1046137359 8:110045967-110045989 CAGAGAAAAAAGAATGGTTCTGG + Intergenic
1046161366 8:110370146-110370168 GAGAGAAAAAAAAAAGATGGAGG - Intergenic
1046869070 8:119184652-119184674 AAGAGAGAGAAGAATGCTGGTGG + Intronic
1046895293 8:119464957-119464979 TAGAGAAAAAAGAATAAAAAGGG + Intergenic
1047380236 8:124355027-124355049 AAAAGAAAAAAGTATGATGGAGG + Intronic
1047489136 8:125360002-125360024 TAGAGATACAAGAGTGATTGTGG + Intronic
1047632303 8:126721632-126721654 TGGGGAAAAAAGATGGATGGTGG - Intergenic
1047703377 8:127472826-127472848 GATAGAAAAAAAAATGCTGGTGG + Intergenic
1048245751 8:132797007-132797029 GATAGAATAAAGAATGAGGGTGG - Intronic
1048376950 8:133831245-133831267 TAGAGGAAAAAGAAAGAAGGGGG + Intergenic
1048784123 8:138032606-138032628 TAGAGGAAACTGAATCATGGGGG - Intergenic
1048883540 8:138889741-138889763 TTGTGAAATAAGAAAGATGGTGG + Intronic
1050016224 9:1237064-1237086 TGGAGATAAATGAATGATGGGGG - Intergenic
1050163728 9:2743445-2743467 TAGACAAAAACAGATGATGGTGG + Intronic
1050496059 9:6243744-6243766 TGGAGGATAAGGAATGATGGTGG + Intronic
1050702652 9:8358269-8358291 AAGAAAAAAAAAAATGATGGGGG - Intronic
1050957443 9:11682443-11682465 GAAAGAAAAAAGAAGGAAGGAGG + Intergenic
1051173485 9:14342497-14342519 AAGAGAAAAAAGAAATAGGGAGG + Intronic
1051216452 9:14803195-14803217 AAGAGAAAGAAGAAAGAGGGAGG - Intronic
1051267673 9:15324175-15324197 TAGAGAAAATTGAATGCTGGGGG + Intergenic
1051577956 9:18638861-18638883 TAGAGCAAAAAGAAAACTGGAGG + Intronic
1052152872 9:25140908-25140930 TTGAGAAAGAAGAATGAAGTTGG + Intergenic
1052301640 9:26958837-26958859 GAGAGAAAAGAAAAAGATGGTGG + Intronic
1052658552 9:31398281-31398303 GGTAGAAAGAAGAATGATGGGGG - Intergenic
1052933522 9:34074970-34074992 TAAAAAAAAAAGAATGAGGCTGG - Intergenic
1053279257 9:36806866-36806888 TAGAAAAAAAAAATTGATGGAGG + Intergenic
1053491048 9:38502792-38502814 TAGAGAAGAGAAGATGATGGTGG - Intergenic
1053631673 9:39946034-39946056 TTGAGAAAAAAAAATACTGGAGG + Intergenic
1053774089 9:41517496-41517518 TTGAGAAAAAAAAATACTGGAGG - Intergenic
1054212214 9:62304664-62304686 TTGAGAAAAAAAAATACTGGAGG - Intergenic
1054312771 9:63544168-63544190 TTGAGAAAAAAAAATACTGGAGG + Intergenic
1054727347 9:68665730-68665752 AAGAAACAAATGAATGATGGAGG - Intergenic
1054799876 9:69336675-69336697 TAGAGAAAAAAGAATATGAGAGG - Intronic
1054822880 9:69541255-69541277 TATAGAAAACAGAATGGGGGGGG - Intronic
1056000731 9:82213669-82213691 GAGACAAAAAAGTATGTTGGTGG + Intergenic
1056068977 9:82966268-82966290 AAAAGAAAAAAGAGTGATTGAGG - Intergenic
1056220522 9:84446913-84446935 GGGATAAAAAAGAATGAAGGAGG + Intergenic
1056414564 9:86364011-86364033 TGGGGAAAAAAAAAGGATGGGGG - Intergenic
1056561822 9:87736822-87736844 TAAACAAAAAAGAATGATTTTGG + Intergenic
1056684112 9:88745498-88745520 TACAGTAAAAAGAATGTTGATGG - Intergenic
1057015458 9:91647168-91647190 TGGAGAAAAGAGACTGATTGGGG + Intronic
1057092769 9:92274642-92274664 TAGAAAAGAAAGAATAATGCAGG + Intronic
1057127383 9:92629092-92629114 CTGAAAAAAAAGAATGATGTCGG + Intronic
1057300854 9:93880877-93880899 TGGAGATAATAGAATTATGGGGG - Intergenic
1057341305 9:94204314-94204336 AATAGAGAATAGAATGATGGGGG + Intergenic
1057553469 9:96068933-96068955 TAGAAAAAAAGGAATCAGGGAGG - Intergenic
1057671364 9:97091995-97092017 TAGAGAAGAGAAGATGATGGTGG - Intergenic
1057916134 9:99056519-99056541 TAAAAAAAAAAGAAAGAAGGCGG - Intronic
1058059899 9:100484221-100484243 TAGAAAAAAGATGATGATGGAGG - Intronic
1058171938 9:101692363-101692385 GAGAGAACAAAGACTGATGAGGG - Intronic
1058309095 9:103478588-103478610 TAGGAAAAAAAGAAGGAAGGAGG - Intergenic
1058884200 9:109310996-109311018 TAGACAAAAAAGTAGAATGGTGG + Intronic
1059514149 9:114877160-114877182 TAGAGATAATTGAATCATGGGGG - Intergenic
1059710350 9:116862281-116862303 TAAAGAAAAAAGAAAGAAGAAGG - Intronic
1059721161 9:116961144-116961166 AAGAGAAAAAAGAATGGTTTTGG - Intronic
1059915746 9:119097924-119097946 TTGAGAAAAAATAAAGCTGGAGG - Intergenic
1060140803 9:121208402-121208424 AAGAGACTAAAGAATGATAGTGG + Intronic
1060453893 9:123771809-123771831 TAGATAAAAAGGAAAGCTGGTGG - Intronic
1060613584 9:124990711-124990733 AAAAGAAAAAAGAAAAATGGTGG + Intronic
1060632996 9:125176670-125176692 AAGAGAAAATGGATTGATGGTGG + Intronic
1060760382 9:126242460-126242482 TAAAAAAAGAAGAATGAAGGGGG - Intergenic
1060812500 9:126617836-126617858 TGGAAAAAATAGAATGAGGGTGG - Intronic
1060997193 9:127881403-127881425 TAGAAAAAAAAGTAGAATGGTGG + Intergenic
1185766839 X:2732498-2732520 AAGAGAGAAAAGAAGGAGGGAGG - Intronic
1185778454 X:2824963-2824985 TAGATAATAAATAATGATGATGG - Intergenic
1185818855 X:3182532-3182554 TAAGGAAAAAAAAAGGATGGGGG + Intergenic
1185939636 X:4301449-4301471 TGGAGAAAAAATTATGTTGGGGG - Intergenic
1186067060 X:5777531-5777553 TAGAGATAATTGAATCATGGAGG + Intergenic
1186093488 X:6074999-6075021 TAGGGAAAAAAGGATGATAAAGG + Intronic
1186104019 X:6186898-6186920 TAGAGACAAAATACTGATGAAGG - Intronic
1186643782 X:11484502-11484524 AAGAGAAAAAAGGAAGAAGGAGG + Intronic
1186679171 X:11854218-11854240 TAGAGATAAATGAATCATGGGGG - Intergenic
1188137129 X:26504568-26504590 TAGAGAAAACAGAGTGTTCGTGG - Intergenic
1188220047 X:27530360-27530382 TATAGAAAACAGAAGAATGGCGG - Intergenic
1188380618 X:29487334-29487356 TAGAGATGAAAGAAGGTTGGGGG - Intronic
1188430597 X:30102445-30102467 TAGAGAAAAAAATATGAAGTAGG - Intergenic
1188460583 X:30422436-30422458 TAGAGATAAAACACTGAGGGAGG - Intergenic
1188543777 X:31279077-31279099 TACTGAAAAAAGAAAGATTGTGG - Intronic
1188609611 X:32079631-32079653 AAGAAAAAAAAGAAAGAGGGAGG + Intronic
1188889818 X:35595911-35595933 TAGAGATAAGTGAATCATGGAGG + Intergenic
1188997344 X:36902062-36902084 TGGAGCAAGAGGAATGATGGAGG + Intergenic
1189262023 X:39686180-39686202 AAGAAAAAAAAGAAGGAAGGAGG + Intergenic
1189397275 X:40634181-40634203 TTGAGAAAAATGATTGATGGTGG - Intronic
1189536317 X:41938793-41938815 TAGACAAATAGGAATGATGCTGG - Intergenic
1190255051 X:48756102-48756124 CAGAGTGAAATGAATGATGGAGG + Intergenic
1190401082 X:50035593-50035615 TACTGAAAAAAGAATGGAGGTGG + Intronic
1190514049 X:51204785-51204807 TATAAATAAAAGGATGATGGTGG + Intergenic
1190631410 X:52390550-52390572 TAAAGAACAAAGAATATTGGAGG + Intergenic
1190639481 X:52469014-52469036 TAAAGAACAAAGAATATTGGAGG - Intergenic
1190954384 X:55178219-55178241 TAGTGAAAAAAGAGTCATTGTGG + Intronic
1191209499 X:57870502-57870524 TAGAGAAAAAACAATGAAAAGGG - Intergenic
1191637747 X:63395841-63395863 TACATACAAAAGAATAATGGTGG - Intergenic
1192197341 X:69037240-69037262 AAGAGAAAAAAGAAAGAGAGAGG - Intergenic
1192379528 X:70601523-70601545 AAAAAAAAAAAGAATGATGCTGG - Intronic
1192454475 X:71265734-71265756 GAGAGAAAAAAGAAAGATTTGGG - Intergenic
1192799789 X:74454826-74454848 TACTGAATAAAGAATCATGGAGG - Intronic
1193062511 X:77221385-77221407 TAGAGAAAAAAGAATGAAAAGGG + Intergenic
1193141648 X:78034045-78034067 TAGTGACAAAAGAATGATCATGG - Intronic
1193292991 X:79799392-79799414 TAGAGGCATAAGAATGATAGTGG - Intergenic
1193351899 X:80473852-80473874 TAGAGAAAAAAGAATAAAAAGGG - Intergenic
1193467015 X:81861817-81861839 TAGAGAAAAGAGAATGCTGATGG + Intergenic
1193990897 X:88305787-88305809 TAGAGATAAAAAAATAATGAGGG - Intergenic
1194018196 X:88652526-88652548 TAGAGAGAATTGAATCATGGCGG - Intergenic
1194336090 X:92647860-92647882 GAGAGAAAAAGAAATGGTGGTGG + Intergenic
1194344048 X:92740555-92740577 TATAGAAAAAATAAAGATAGAGG + Intergenic
1194353498 X:92852298-92852320 AAAGAAAAAAAGAATGATGGTGG - Intergenic
1194882031 X:99265357-99265379 CAGAGAAAAAAAAATGCTCGAGG - Intergenic
1194939322 X:99990285-99990307 AAGAGAAGAAGGAATAATGGTGG + Intergenic
1195429817 X:104776171-104776193 TGGGGAACAAAGAATGTTGGGGG + Intronic
1195493604 X:105503457-105503479 AAGAGAAAAAAGAAGGAAGCTGG + Intronic
1195565313 X:106333233-106333255 GAGAGAGAGAAGAATGAAGGAGG - Intergenic
1195749610 X:108150753-108150775 TAGAGATAACTGAATCATGGGGG - Intronic
1195759526 X:108230910-108230932 TAAAAAAGAAAGAATGCTGGTGG + Intronic
1196194711 X:112827565-112827587 TAGGAAAAAAAGAATAATTGCGG + Intronic
1196547125 X:116975393-116975415 AAGAGAAAATTGAATCATGGGGG + Intergenic
1196640825 X:118058295-118058317 AAGAGAAATAAAAATGAGGGGGG - Intronic
1196834495 X:119801932-119801954 GAAAGAAAAAAGAAAGAAGGAGG - Intergenic
1197072679 X:122319305-122319327 GAGAAAAAAAAGAAAGCTGGAGG - Intergenic
1197224317 X:123941277-123941299 CAGAGAAAAAGGAATAAAGGTGG + Intergenic
1197314053 X:124942016-124942038 GAGAGAAAATTGAATCATGGGGG - Intronic
1197583594 X:128315363-128315385 TATTAAAAAAAGAAAGATGGTGG + Intergenic
1197739524 X:129879265-129879287 TAAAAAAAAAAAAATGTTGGAGG - Intergenic
1197843937 X:130780575-130780597 TAGAGAAAATACAAAGAAGGGGG + Intronic
1197888384 X:131241355-131241377 TAGAGAAAAAAAAATTAAGATGG + Intergenic
1197966543 X:132069061-132069083 AAGAGAATAATGAATCATGGGGG - Intergenic
1198021411 X:132661987-132662009 GAAAGAAAAAAGAATGAAGTTGG + Intronic
1198383359 X:136105001-136105023 AAGGAAAAAAAGAAAGATGGAGG + Intergenic
1198736522 X:139791758-139791780 CAGAGACAAAGGAATGAAGGGGG + Intronic
1198746027 X:139891516-139891538 TAGAGAATAAACAATCATGATGG - Intronic
1198947185 X:142028132-142028154 TAGAAATAATTGAATGATGGGGG - Intergenic
1199048269 X:143203581-143203603 TAGAGATAATTGAATCATGGGGG - Intergenic
1199288360 X:146078536-146078558 TAGAGAAAGGAGAAAGAAGGTGG + Intergenic
1199308094 X:146291577-146291599 TAGAGAAAAAAGAATAAAAAGGG - Intergenic
1200292995 X:154889213-154889235 GAGAGAAAGAGGAATGATGGTGG - Intronic
1200339843 X:155384945-155384967 GAGAGAAAGAGGAATGATGGTGG - Intergenic
1200346627 X:155455743-155455765 GAGAGAAAGAGGAATGATGGTGG + Intergenic
1200506678 Y:4019288-4019310 CACAGAAAAATGTATGATGGAGG - Intergenic
1200644522 Y:5764603-5764625 GAGAGAAAAAGAAATGGTGGTGG + Intergenic
1200652396 Y:5857211-5857233 TATAGAAAAAATAAAGATAGAGG + Intergenic
1200661858 Y:5969372-5969394 AAAGAAAAAAAGAATGATGGTGG - Intergenic
1201343312 Y:12956691-12956713 TAGAGGAAAAAGAATGTCAGTGG + Intergenic
1201632623 Y:16085925-16085947 TAGAGATAATAGAATCATGGGGG - Intergenic
1201979820 Y:19894313-19894335 TAGAGAAAAAAGAATGAAAAGGG + Intergenic
1202017161 Y:20422168-20422190 TTGAGATAAAAGAATGAAGCAGG + Intergenic