ID: 963205935

View in Genome Browser
Species Human (GRCh38)
Location 3:142634562-142634584
Sequence TAGTATAGATAAGATAGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 183}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963205935 Original CRISPR TAGTATAGATAAGATAGTGG AGG Intronic
904958052 1:34305129-34305151 TAGTATAGATAAAATAATCTTGG - Intergenic
905297714 1:36964617-36964639 TTGGATAGATAAGAAAATGGAGG + Intronic
907270147 1:53286338-53286360 TATTATAGATCAGAAAATGGAGG - Intronic
908186586 1:61658170-61658192 TAGGCTAGATAAGATGGTGGTGG + Intergenic
909413349 1:75378812-75378834 CAGTATTGATAAGCTACTGGCGG - Intronic
910532752 1:88258970-88258992 TAGTATGTATATGACAGTGGGGG - Intergenic
911035782 1:93545667-93545689 TAGTATAGGAAAGAGATTGGAGG + Intronic
912943360 1:114064749-114064771 TAGAGTAGAAAACATAGTGGAGG + Intergenic
913384249 1:118242129-118242151 TGGTAAAGATAAGAAAGTGAAGG - Intergenic
922158152 1:223056196-223056218 TAGTAAAGATAAGAAAGTATGGG - Intergenic
922636061 1:227172652-227172674 TAGGATAGATAGTATAGTTGGGG + Intronic
922751085 1:228070325-228070347 TAGTGTAGAAAGGATAGTGTAGG + Intergenic
922751116 1:228070455-228070477 TAGCATAGAGAGGATAGTGTAGG + Intergenic
923089898 1:230732069-230732091 CACTATAGAGAAGATAGGGGTGG - Intergenic
923823199 1:237470418-237470440 TTGTAGAGTTTAGATAGTGGAGG + Intronic
1065413943 10:25463891-25463913 TAGTACCAATAAGACAGTGGAGG + Intronic
1065716108 10:28570217-28570239 TTGTACAGATAATAGAGTGGAGG + Intronic
1066137224 10:32461577-32461599 TTGTATTGAGAAGATAGTGTTGG + Intronic
1066316823 10:34255895-34255917 TAGTATAAATAAGATTTTAGGGG + Intronic
1068246670 10:54380356-54380378 AAGTATAGATCAGATATTGATGG + Intronic
1069586108 10:69603683-69603705 TAGTTCAGATAAGATAGTACTGG - Intergenic
1071315639 10:84393847-84393869 TAGCATAGATGTGGTAGTGGAGG + Intronic
1071803103 10:89086802-89086824 TTGTGTATATAAGATGGTGGAGG - Intergenic
1072352030 10:94566337-94566359 AAGTACAGGTAAGATAGTGGGGG + Intronic
1072868076 10:99085807-99085829 TAGTGGAGATAAAATAGTTGAGG - Intronic
1072947934 10:99827178-99827200 CAGTATTGATAAGCTACTGGCGG + Intronic
1073201101 10:101736603-101736625 TAGGAGAGGTAAAATAGTGGGGG - Intergenic
1073907722 10:108303487-108303509 TAGTATAGATATGTTAGAGCTGG + Intergenic
1074402050 10:113149890-113149912 TACTATAGAAAAAATAGTGAGGG - Intronic
1077643944 11:3906873-3906895 TCGTATAGATAAGAAAATTGAGG + Intronic
1078381352 11:10844244-10844266 TAGTATCGATATGTTAGTGGTGG - Intronic
1078503345 11:11907130-11907152 TAATATACTTAAGAGAGTGGTGG - Intronic
1079934631 11:26601579-26601601 TAGTATATATAAGATAGTATAGG + Intronic
1081255806 11:40892844-40892866 TTGTATATACAAGATAGTAGTGG + Intronic
1081789357 11:45771909-45771931 TGGTACAAACAAGATAGTGGTGG - Intronic
1086158133 11:83691312-83691334 GAGTACAGAGAAGACAGTGGAGG - Intronic
1087384536 11:97453646-97453668 AAGAATAGATAAGATAATTGAGG + Intergenic
1087723890 11:101696789-101696811 CAGTATTGATAAGCTACTGGCGG - Intronic
1088269048 11:108015199-108015221 TATTTTTGATAAGATAGTGAGGG + Intronic
1089471946 11:118728426-118728448 CAGTATTGATAAGCTACTGGTGG + Intergenic
1090236793 11:125154332-125154354 TAGGATAGATAAGCTGGTGGAGG - Intergenic
1090301032 11:125639773-125639795 TAGTATGGAGGAGATGGTGGTGG - Intronic
1090840161 11:130480483-130480505 TAGAATACATGAGAGAGTGGTGG + Intergenic
1093194058 12:16109408-16109430 GAGAAGAGATAAGGTAGTGGAGG + Intergenic
1093204230 12:16227828-16227850 TAGAATAGGAAAGATATTGGAGG + Intronic
1095146276 12:38731549-38731571 TAGTATATACAAGATAGTTTAGG - Intronic
1097331291 12:58335167-58335189 CAGTATTGATAAGCTACTGGTGG + Intergenic
1098678179 12:73317004-73317026 TAGTATAGATATGATATTCCTGG + Intergenic
1099200651 12:79672858-79672880 TAATATAGGACAGATAGTGGTGG - Intronic
1099923057 12:88983011-88983033 TAGTTTAGATCAGATAGAGTGGG - Intergenic
1101024572 12:100588176-100588198 TAGAACAGATAAAATATTGGGGG + Intronic
1101553894 12:105788812-105788834 TAGTATAGCAAAGATAATGGTGG + Intergenic
1101769538 12:107736318-107736340 TATTTTAGATAAGATAGTCAAGG + Intronic
1103531388 12:121604666-121604688 TAGAATAGATATAATGGTGGTGG + Intergenic
1104599952 12:130146062-130146084 TAGGATAGATATCATAGCGGGGG - Intergenic
1108150251 13:47526155-47526177 TAATATAAATATTATAGTGGAGG - Intergenic
1109358454 13:61265156-61265178 TAGTATAGACAGGTTAGAGGGGG + Intergenic
1111667506 13:91287908-91287930 TGGGATATATAAAATAGTGGAGG + Intergenic
1112065833 13:95791786-95791808 AAGTTCAGATAAAATAGTGGTGG + Exonic
1113521314 13:110943459-110943481 TAGTAGAAATAGGATAGTGTTGG + Intergenic
1115517954 14:34205112-34205134 TGGTAGAAGTAAGATAGTGGCGG - Intronic
1118672026 14:68139284-68139306 TTGTATAGATGAGAAAGTTGAGG + Intronic
1118997872 14:70853708-70853730 TTTTATAGATAAGGGAGTGGAGG - Intergenic
1119219640 14:72895322-72895344 TCAAATAGCTAAGATAGTGGGGG + Intergenic
1119888801 14:78166971-78166993 TTTTATAGATGAGAAAGTGGAGG + Intergenic
1120132859 14:80827295-80827317 TAGTATAGGTAAGACTGTGTGGG + Intronic
1122139364 14:99653184-99653206 TTTTACAGATAAGAAAGTGGAGG + Intronic
1126029397 15:44481413-44481435 TAGTATCAATAACATAGTAGGGG + Intronic
1128164930 15:65455562-65455584 TAATATAGACAAGGTGGTGGTGG - Intronic
1128947285 15:71835857-71835879 TAGGGTAAATAAAATAGTGGTGG + Intronic
1130546335 15:84859523-84859545 TAGTAGAGATGAGAAAATGGAGG + Intronic
1131632963 15:94198955-94198977 TAGTATAGCTAAGAAAGCTGTGG - Intergenic
1131634280 15:94213541-94213563 TACTGTACATCAGATAGTGGGGG - Intergenic
1133013343 16:2927021-2927043 CAGTATTGATAAGCTAATGGCGG - Intronic
1133462379 16:5998408-5998430 TAGTTTAAATCAGATATTGGGGG + Intergenic
1137817996 16:51417458-51417480 TAGGCAAGATAAGAAAGTGGTGG - Intergenic
1138140654 16:54565659-54565681 TAGTATAGAAAAGAAAGTATTGG - Intergenic
1139793856 16:69465429-69465451 TTGTAAAGATAACAGAGTGGTGG + Exonic
1141813058 16:86389298-86389320 TAGAATAGATAATATAGTATCGG - Intergenic
1142841588 17:2635738-2635760 TAATATACATAATATAGTGGGGG + Intronic
1144145161 17:12390141-12390163 TAGTATAGAAAAGTTGTTGGAGG - Intergenic
1147434627 17:40402044-40402066 TAGTTTAGATGAGATGGGGGTGG + Intronic
1149238407 17:54619506-54619528 TAGTATAGTGGAGATAATGGAGG + Intergenic
1149274833 17:55021717-55021739 TAGTACAGAAAAGATCCTGGAGG - Intronic
1152045526 17:77932610-77932632 TAGTATAGAAAAGATAATGTTGG - Intergenic
1152271567 17:79327996-79328018 TTGTATAGATAAGAGAGAGAAGG - Intronic
1154387928 18:13912298-13912320 TATTATAGATAAGAAAACGGAGG + Intronic
1155539243 18:26849924-26849946 TAGTTTAGAAAAGACAGTTGAGG - Intergenic
1156172782 18:34506318-34506340 TACTATTGACAACATAGTGGGGG + Intronic
1158282860 18:55846653-55846675 TAATGTAGGTAAGAGAGTGGAGG - Intergenic
1158740975 18:60141808-60141830 AAGTGTAGATGAGAAAGTGGAGG + Intergenic
1159356137 18:67338586-67338608 AAGACTAGATAAAATAGTGGGGG - Intergenic
1166938288 19:46348053-46348075 TACTTTAGATAGGGTAGTGGGGG + Intronic
927649504 2:24903509-24903531 TTTTATAGAAAAGAAAGTGGAGG - Intronic
928561086 2:32486146-32486168 TAGGATAGAGAATATAGTGTAGG + Intronic
929193638 2:39163331-39163353 TAGTTTATATAAAATAGTGCTGG + Intergenic
929906872 2:46054207-46054229 TATTACAGATAAGAAAATGGAGG + Intronic
930486934 2:52022487-52022509 CAGTATAGAGAATATAATGGAGG - Intergenic
936332198 2:111557285-111557307 GAGTATAGAATAGATAGGGGTGG - Intergenic
940540249 2:155006331-155006353 TACTATAAATAACATAGTGTTGG - Intergenic
941495356 2:166194473-166194495 TTTTATAGATAAGAAAGTTGAGG + Intergenic
941624541 2:167816779-167816801 TAATATTGATAAAATAATGGAGG - Intergenic
942179576 2:173367082-173367104 TAATGTAGATAAGTTGGTGGGGG + Intronic
942773660 2:179554015-179554037 AATTATAGAAAAGACAGTGGAGG - Intronic
944356794 2:198799598-198799620 TTGTATATATAAGATAGTAGTGG - Intergenic
944357054 2:198802762-198802784 TTGTATATATAAGATAGTAGTGG - Intergenic
944615460 2:201454448-201454470 CAGTATAGAAAAGATAGGGAAGG + Intronic
945602166 2:211881686-211881708 TTTTATAGATGAGCTAGTGGAGG - Intronic
947677534 2:231996768-231996790 TACTATACATAAGACTGTGGAGG + Intronic
947981562 2:234414745-234414767 TAGCATAGATAAGATGGGTGAGG - Intergenic
1174277296 20:49413360-49413382 TAGTACAGAGCAGGTAGTGGGGG - Intronic
1174737697 20:52981379-52981401 TTTTATAGATTAGAAAGTGGAGG - Intronic
1177248977 21:18568060-18568082 TAGTATTGATAAGCTACTGGCGG + Intergenic
1180101146 21:45586985-45587007 TAATATAGATAAAATAATGAAGG - Intergenic
1181008858 22:20028624-20028646 TATTATACAAAAGCTAGTGGAGG + Intronic
1181933925 22:26426645-26426667 CAGTACAGATAAGATGGTGCAGG + Intergenic
1182245766 22:28956246-28956268 TAGTATGGATAAGGTAGAGAGGG + Intronic
950030926 3:9852854-9852876 CAGTATTGATAAGCTACTGGTGG + Intronic
950627424 3:14258391-14258413 TTGAATAGAAATGATAGTGGCGG + Intergenic
951807806 3:26665555-26665577 AAGTATAGAAAAGAGAGTTGAGG + Intronic
952118286 3:30210988-30211010 TAGAATAGATATGATAATTGTGG + Intergenic
953221724 3:40977816-40977838 GAGAACAAATAAGATAGTGGGGG + Intergenic
955259830 3:57376448-57376470 TAGTACAGATTAGATAGTTTTGG - Intronic
955948152 3:64214935-64214957 TAGGATAGTAAAGATAGAGGTGG - Intronic
956969176 3:74502252-74502274 TAGTAGAGATAAGAAAGCAGTGG + Intronic
957515993 3:81251654-81251676 TAGGATAGATAAGGGTGTGGAGG - Intergenic
958060856 3:88478031-88478053 TGCTATAGACAAGATTGTGGGGG - Intergenic
959029129 3:101277495-101277517 TAGTACAGACAAGAAAGTAGTGG + Intronic
959070034 3:101693620-101693642 CAGTATTGATAAGCTACTGGCGG - Intergenic
959085340 3:101846683-101846705 TATTATACATAAAATATTGGTGG + Intronic
959350874 3:105261228-105261250 TCTTATAGATAATTTAGTGGTGG - Intergenic
963205935 3:142634562-142634584 TAGTATAGATAAGATAGTGGAGG + Intronic
963696044 3:148566829-148566851 CAGTATTGATAAGCTACTGGCGG + Intergenic
963778034 3:149459704-149459726 TATTGTAGATAAGATAATGGGGG - Intergenic
963844063 3:150137116-150137138 TAGTCTAGTTGAGATAGTAGGGG - Intergenic
964271581 3:154962011-154962033 AAGTATTTATGAGATAGTGGAGG - Intergenic
964716975 3:159732708-159732730 AATTATAGATAAGACCGTGGAGG + Intronic
967182215 3:186915918-186915940 AGGTTTAGATAAGATAGTGCGGG + Intergenic
967321200 3:188197102-188197124 TTGTATAGATAAGACATTGTGGG + Intronic
970627232 4:17900499-17900521 TATTTTAGATAAGATCGTTGAGG - Intronic
970808205 4:20060876-20060898 AAGTTTAGATAAGACAGAGGAGG + Intergenic
971033836 4:22670663-22670685 TATTATAGATAAGAAAATGGAGG - Intergenic
972007120 4:34123520-34123542 TATTCTAGATAAGATAGTCAAGG - Intergenic
972906381 4:43752871-43752893 TAGTTCAGATAATATTGTGGTGG - Intergenic
973614813 4:52667851-52667873 TAATATATAGAAGATAATGGAGG + Intergenic
974749996 4:66127120-66127142 TATTAAAGATAAGATAATTGAGG - Intergenic
975293122 4:72700641-72700663 TAGATTAGATTAGACAGTGGGGG + Intergenic
976220928 4:82756413-82756435 TTTTATAGATAAGAAAGTTGAGG - Intronic
978065401 4:104393334-104393356 TATTATAGTTAAGGTAGTGTAGG + Intergenic
981401672 4:144321151-144321173 TTGTTTAGATATGATACTGGGGG - Intergenic
982876744 4:160660345-160660367 CAGTATTGATAAGCTACTGGCGG - Intergenic
983215340 4:164997399-164997421 CAGTATTGATAAGCTACTGGTGG - Intergenic
983288437 4:165769645-165769667 TAGTTAAGATAAGGTAGTGCAGG + Intergenic
984005488 4:174301376-174301398 CAGTATAGATCAGAAAGTTGAGG + Intronic
984444742 4:179822456-179822478 TAGTCTAGATAAAATAGAGATGG + Intergenic
984643773 4:182199041-182199063 CAGTATAGTTTAGATAGTGTTGG + Intronic
985192130 4:187386097-187386119 TAGTAAAGATAATATGGTGCTGG + Intergenic
986563021 5:9082591-9082613 TTTTATAGATGAGAAAGTGGAGG - Intronic
987545756 5:19308752-19308774 AAGTTAAGATAAGATAGTGTGGG - Intergenic
994682916 5:102911823-102911845 TAGTATAAAAAAGATACTGTTGG + Intronic
994763314 5:103884252-103884274 TAGTAGAGTTTAGACAGTGGTGG + Intergenic
998462276 5:142318656-142318678 TAATATAAATAAGAGAGAGGAGG + Intronic
998894470 5:146784481-146784503 TAGGATAAATAAGATTGTAGTGG - Intronic
999486493 5:152002234-152002256 GAGTGGAGAAAAGATAGTGGTGG + Intergenic
1001320385 5:170675769-170675791 TTTTATAGATAAGAAAATGGGGG - Intronic
1003820746 6:9894116-9894138 TAGTATAGAAAACATTTTGGAGG - Intronic
1005769211 6:29049191-29049213 TATTATAGATAAGAAATCGGAGG - Intergenic
1007052184 6:38843584-38843606 TAGTATAGATAAAATAATATTGG - Intronic
1008275645 6:49540764-49540786 AAGTATATATAAGATAATGAAGG + Intergenic
1008774509 6:55020478-55020500 TAGTATTGATAACATAGTATTGG - Intergenic
1010097275 6:72061591-72061613 GGGTATAGATAAGGCAGTGGTGG + Intronic
1011826367 6:91310143-91310165 AAGTATGCATCAGATAGTGGTGG + Intergenic
1012632043 6:101482695-101482717 TAATATAGATAAGAAATAGGAGG + Intronic
1016576699 6:145576137-145576159 TGGTAAAGATAAGAAGGTGGTGG - Intronic
1018559230 6:165084194-165084216 TAGTACAGATGAGTTAGCGGTGG - Intergenic
1027345551 7:77255824-77255846 TAATATCAATAAGAAAGTGGGGG + Intronic
1027940472 7:84672226-84672248 GAGTATAGAAAATTTAGTGGAGG - Intergenic
1027973119 7:85112653-85112675 TTTTATAGATAAGATACTTGAGG - Intronic
1028254301 7:88574838-88574860 TAGAATAGATATTTTAGTGGTGG + Intergenic
1030148652 7:106381027-106381049 TACTATATATAAGTTAGTGGGGG + Intergenic
1031842233 7:126757838-126757860 TAGGATAGATAAGAAGGTGGAGG - Intronic
1034961189 7:155365603-155365625 AAGCATAGATAAGAGAGAGGCGG - Intronic
1036005446 8:4656876-4656898 TAGGACAGATAAGATGTTGGGGG - Intronic
1036118484 8:5987615-5987637 TAGAATAGATAAGACTGTTGCGG - Intergenic
1037110302 8:15157778-15157800 TAGCATAGTTCAGCTAGTGGAGG - Intronic
1041135572 8:54754415-54754437 TCTTATAGATAAGAAAATGGAGG - Intergenic
1043472185 8:80574003-80574025 TAGTAATGATTAGTTAGTGGGGG - Intergenic
1045611802 8:103852242-103852264 TAGTATAGATATAATAGTGATGG + Intronic
1046001715 8:108428291-108428313 TAGTATAGATTATACAGTGATGG + Intronic
1050715101 9:8515399-8515421 GGGTATAGATTAGATAATGGAGG - Intronic
1052229754 9:26135102-26135124 TTTTATAGATAAGAAAATGGAGG - Intergenic
1056069019 9:82966792-82966814 TAATATAGATAAGATAGATATGG + Intergenic
1056748290 9:89324138-89324160 TAGTTGAGAAAAGCTAGTGGGGG - Intronic
1058424479 9:104864554-104864576 TTTTATAGATAAGGCAGTGGAGG - Intronic
1059602059 9:115789569-115789591 TTTTATAGATAAGAAAGTTGAGG + Intergenic
1186644548 X:11492603-11492625 TAATATAGTTAATATAGTTGTGG + Intronic
1189161259 X:38811417-38811439 AAGGATTGATAAGATAGTCGTGG - Intergenic
1190111469 X:47591737-47591759 TAGTATATATATGACAGAGGTGG + Intronic
1192576388 X:72246412-72246434 GGGTAGAGATCAGATAGTGGGGG - Intronic
1198810551 X:140531701-140531723 TAGTATACATAAGGTGGTGTGGG - Intergenic