ID: 963206548

View in Genome Browser
Species Human (GRCh38)
Location 3:142642123-142642145
Sequence CAGGTTAGACAGAGGTGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 248}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963206548_963206552 19 Left 963206548 3:142642123-142642145 CCTTGTCACCTCTGTCTAACCTG 0: 1
1: 0
2: 2
3: 23
4: 248
Right 963206552 3:142642165-142642187 GTGTATACTTTAAACAAAGTTGG 0: 1
1: 0
2: 4
3: 74
4: 267
963206548_963206553 20 Left 963206548 3:142642123-142642145 CCTTGTCACCTCTGTCTAACCTG 0: 1
1: 0
2: 2
3: 23
4: 248
Right 963206553 3:142642166-142642188 TGTATACTTTAAACAAAGTTGGG 0: 1
1: 0
2: 1
3: 26
4: 351
963206548_963206551 -3 Left 963206548 3:142642123-142642145 CCTTGTCACCTCTGTCTAACCTG 0: 1
1: 0
2: 2
3: 23
4: 248
Right 963206551 3:142642143-142642165 CTGTCTTTTTTTCTTTGCACAGG 0: 1
1: 0
2: 4
3: 68
4: 970

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963206548 Original CRISPR CAGGTTAGACAGAGGTGACA AGG (reversed) Intronic
900084630 1:886002-886024 CAGGAGAGACTGAGGTGACTAGG - Intergenic
900281353 1:1871525-1871547 GAGGTTAGATCGAGGAGACACGG - Intronic
905084597 1:35360863-35360885 TAGGATAGACAGAGGGGACTTGG + Intronic
906428087 1:45731138-45731160 CAGGCTAGAAAGAAGTGGCAAGG + Intronic
906943200 1:50273706-50273728 AAGCTAAGACAGAGTTGACAGGG + Intergenic
907592867 1:55692397-55692419 CATATTAGACACAGCTGACAAGG - Intergenic
910321286 1:85947378-85947400 CAGGTTAGTTATAGGTGACATGG + Intronic
910669123 1:89755698-89755720 CAAGTTAAACTGAGGTGAAAAGG + Intronic
911030431 1:93481708-93481730 CAGTTTATTCAGAGGTGGCAAGG - Intronic
913341070 1:117758729-117758751 GCGGGGAGACAGAGGTGACAAGG + Intergenic
914220750 1:145679854-145679876 TAGGTTGGAGAGAGGTGACAAGG - Intronic
914473326 1:148002727-148002749 TAGGTTGGAGAGAAGTGACAAGG - Intergenic
915582711 1:156824702-156824724 CATGTTTGTCAGAGATGACATGG + Intronic
915653579 1:157338445-157338467 CAGGTTTGTCAAAGGTCACATGG + Intergenic
915900023 1:159840196-159840218 CTGGTTAGACAGAGTTTAAATGG - Intronic
915964428 1:160294103-160294125 CAGGATAGATGGAAGTGACAAGG + Intronic
916445329 1:164866863-164866885 CAGCTTAGAAAGAGGAGAAATGG - Intronic
917628281 1:176867798-176867820 CAGTTTAGTCAGAGGTCAGATGG + Intronic
919459027 1:197854806-197854828 CATGTTGGACAGAAATGACAAGG + Intergenic
920491457 1:206418767-206418789 TAGGTTTGACTGAGGTGGCAAGG - Intronic
921378079 1:214494625-214494647 AAGGGTAGAAAGAGATGACACGG + Intronic
922320570 1:224482874-224482896 CACGTTAGCCTGCGGTGACAAGG + Intronic
922596318 1:226816162-226816184 CAGGTGAGACAGAGGTGAAGTGG + Intergenic
922702415 1:227769637-227769659 CAGGACAGGCAGGGGTGACACGG + Intronic
1063957517 10:11280690-11280712 CAGGATGGACAGAGGACACATGG + Intronic
1064219776 10:13430939-13430961 CAGGGGAGACAGAGGCGCCAAGG - Intergenic
1064247136 10:13677940-13677962 GAGGTTAGGCAGGGGTGAAAGGG - Intronic
1065602727 10:27386356-27386378 TATCTTACACAGAGGTGACAAGG - Intergenic
1066501546 10:36000030-36000052 CAGGTCACACAGATGTGACGTGG + Intergenic
1067986482 10:51152339-51152361 CAGCTTAGACTGAGGTAACCAGG - Intronic
1068039003 10:51799333-51799355 GAGGTGAGACAGAAGTGATAAGG - Intronic
1069459401 10:68580363-68580385 CAGGTTGGAGTGAGGTGGCATGG + Intronic
1071341416 10:84652194-84652216 CTGGTTAGACAGTGGGTACAAGG - Intergenic
1071391063 10:85175803-85175825 GAGGAGAGACAGAGGAGACAGGG + Intergenic
1073291020 10:102413346-102413368 CTGATTAGGCAGGGGTGACATGG + Intronic
1073476475 10:103756983-103757005 CAGGGTTGATAGAGGTGAGAGGG - Intronic
1074901783 10:117823103-117823125 TAGTTTAGACAGATGTGTCATGG + Intergenic
1075957554 10:126536894-126536916 CAGGTTCCACAGAGTTGGCAGGG - Intronic
1078101857 11:8334699-8334721 CAGGGAAGACAGAGGGTACAGGG - Intergenic
1078370011 11:10736584-10736606 GAGGTTAGCCAGAGGGGGCAGGG + Intergenic
1079128395 11:17734489-17734511 CGGGTCAGACTGAGGTGAGAAGG - Intergenic
1080077297 11:28165930-28165952 CACTTTAGACAAAGGTGCCAAGG - Intronic
1080418957 11:32093493-32093515 CAGGTTAGAGAGAGGGGATTGGG + Intronic
1080621282 11:33989194-33989216 CAGGTGAGAAAGAGAAGACAGGG + Intergenic
1081047158 11:38290304-38290326 CAGGATAGAAAGTGTTGACAAGG - Intergenic
1083206631 11:61153760-61153782 CAGGGTAGCCAGAGTTCACAGGG + Intronic
1084649097 11:70477994-70478016 CAGGGTAGACAGTGGTGACCTGG - Intronic
1086805559 11:91237381-91237403 CAGTTTTGACAGATGTGCCATGG - Intergenic
1089753889 11:120671909-120671931 CAGGTTTGTCAAAGGTGAGATGG + Intronic
1090145161 11:124313528-124313550 CAGGTTATAAAGAAGTGACAAGG + Intergenic
1091041722 11:132287133-132287155 CTGGTTAGACAGATCTGACAAGG - Intronic
1091787314 12:3250895-3250917 GAGGTTGGACCGGGGTGACAGGG + Intronic
1092335948 12:7633795-7633817 CAAGTTAGACTTAGATGACATGG + Intergenic
1093880236 12:24395895-24395917 CAGGCCAGACAGAGATGTCAGGG - Intergenic
1093923594 12:24887294-24887316 AAGTATAGACAGAGATGACATGG - Intronic
1094294299 12:28886938-28886960 CAGGTTAACAAGAGTTGACAAGG - Intergenic
1094414034 12:30199658-30199680 CAGGTAAGAAAGGGGTGAAAGGG + Intergenic
1097010791 12:55952281-55952303 CAGGTTACACAGTGCTGGCAGGG - Intronic
1097145083 12:56934499-56934521 CAGGGCTGTCAGAGGTGACAAGG - Intergenic
1097307151 12:58081754-58081776 CTGGTGACACAGAGGTAACAAGG + Intergenic
1099068264 12:78011890-78011912 CAGGTGAGAAAGAGAGGACATGG + Intronic
1102405764 12:112672895-112672917 CAGGTCAGCCAGAAGTGTCAAGG + Intronic
1103873853 12:124112042-124112064 CAGTTTAGACAGAGGGGAGAAGG - Intronic
1108027891 13:46197532-46197554 CAGGTTGCACAGATGTCACAGGG + Intronic
1108281634 13:48867700-48867722 CAGGTTATATAGAGGTGGGAAGG + Intergenic
1109304246 13:60621100-60621122 AAGGTTAGACACAGGTTAGAAGG - Intergenic
1110264357 13:73521056-73521078 CAGGTAAGTCAGAGATGAAAGGG - Intergenic
1111107167 13:83661867-83661889 AAGGTTATACAGAGTTGAAAAGG - Intergenic
1111431241 13:88150687-88150709 CAGGTTTGACAGAGCTGATATGG + Intergenic
1113066362 13:106377094-106377116 CAGGGGAGACACATGTGACACGG - Intergenic
1117729342 14:58705848-58705870 CAGGTTCCAAAGAGGTGTCATGG - Intergenic
1119535274 14:75397793-75397815 CAGTTCAGACAGAGGGGACAAGG + Intergenic
1120060221 14:79973937-79973959 CAGGTGAGACAGAGCTGTGAGGG - Intergenic
1120630132 14:86880539-86880561 ATGGTTAGACAGAAGTGACATGG - Intergenic
1121797821 14:96750130-96750152 CACGTTACACACTGGTGACATGG + Intergenic
1121908764 14:97770257-97770279 CAGGGCAGACAGAGCTGACAGGG - Intergenic
1202862605 14_GL000225v1_random:92054-92076 CAGTGTAGACATATGTGACAAGG - Intergenic
1123721974 15:23068207-23068229 CAGGCTGGACAGCGGTGGCAAGG + Intergenic
1124095316 15:26643684-26643706 GAGGTCAGACTGAGGTCACACGG - Intronic
1124258808 15:28167945-28167967 CAGATTTTACAGAGGTAACATGG + Intronic
1124566916 15:30824516-30824538 CAGATTTTACAGAGGTAACATGG - Intergenic
1124721841 15:32117335-32117357 CAGGCAAGCCAGAGGTGCCAGGG - Intronic
1126621696 15:50646324-50646346 CAGGCTAGACTTTGGTGACATGG + Intronic
1127062362 15:55199997-55200019 CAGGTTTGACAGAGTTGAAGAGG - Intergenic
1129032513 15:72629248-72629270 GAGATCAGACAGAGGTGACCCGG + Intergenic
1129217379 15:74107991-74108013 GAGATCAGACAGAGGTGACCCGG - Intronic
1129407283 15:75327996-75328018 GAGATGAGACAGAGGTGACCCGG + Intergenic
1129681226 15:77659595-77659617 GAACTCAGACAGAGGTGACATGG - Intronic
1129734535 15:77952278-77952300 GAGATCAGACAGAGGTGACCCGG - Intergenic
1129814939 15:78543497-78543519 CTGGCTTGACAGAGGTGACAGGG - Intronic
1129841055 15:78743713-78743735 GAGATCAGACAGAGGTGACCCGG + Intergenic
1129886317 15:79040309-79040331 CAGTCTAGGCAGAGGTGACAGGG - Intronic
1130800333 15:87255932-87255954 CAGGGTAGAAAGAGGGGAAAAGG + Intergenic
1131081864 15:89543358-89543380 CAGGCTTGACAGCTGTGACAAGG + Intergenic
1132130058 15:99268382-99268404 CAGTTTAGAAAGAGGTGGCAGGG + Intronic
1132353674 15:101156131-101156153 CAGGTGAGACAAAGGGGAGAAGG + Intergenic
1132784886 16:1651237-1651259 CAGGTTACACAGAGGTCACACGG + Intronic
1132784999 16:1652015-1652037 TAGGTCACACAGAGGTCACAGGG + Intronic
1135201806 16:20444042-20444064 CAGGTTGGAGTGAAGTGACATGG + Intergenic
1135217298 16:20583824-20583846 CAGGTTGGAGTGAAGTGACATGG - Intergenic
1136063063 16:27740103-27740125 CAAGTTAGACAAAGGAGATAGGG + Exonic
1138387706 16:56647693-56647715 CAGGTGAGGCAAAGGTCACATGG + Intronic
1139465509 16:67151808-67151830 CAGGTCAGACAGGGCTGGCAAGG + Intergenic
1139668128 16:68472508-68472530 CAGCCTGGACACAGGTGACATGG + Intergenic
1139681866 16:68571275-68571297 TAGGTTAGTCAGAAGTCACATGG + Intronic
1140149805 16:72351310-72351332 CAGGGAAGACAGAGGTGATAAGG - Intergenic
1141427999 16:83956037-83956059 CCTGCAAGACAGAGGTGACAGGG + Intronic
1141588169 16:85049075-85049097 GAGCTAAGACAGAGGGGACATGG - Intronic
1143585815 17:7849612-7849634 CAAGGTAGAGAGTGGTGACAAGG + Exonic
1143842427 17:9743448-9743470 GAGGTTAAACAAAGGTTACAGGG + Intergenic
1144390469 17:14788945-14788967 CAGGGGAGACAGAAGTGAGATGG - Intergenic
1145373859 17:22329720-22329742 CAGGTCAGACAAAAGTTACAAGG - Intergenic
1145750957 17:27354475-27354497 CAGGGAAGGCAGAGGGGACAGGG - Intergenic
1146085082 17:29820866-29820888 CTGGGAAGAGAGAGGTGACAAGG - Intronic
1146568864 17:33936266-33936288 CAGGATAAAGAGAGTTGACAGGG + Intronic
1146658871 17:34651527-34651549 CAGGGGAGAGAGTGGTGACAGGG - Intergenic
1148053269 17:44779579-44779601 GAGGTCAGACAGTGGTGATATGG - Intronic
1148329245 17:46803624-46803646 CACGCTAGACAATGGTGACATGG + Intronic
1150204403 17:63391238-63391260 CAGGTTTGGCAGAGGTGAAAGGG - Intronic
1157443164 18:47725462-47725484 CATCTTAGAGAGAGGGGACAAGG + Intergenic
1158106566 18:53891344-53891366 CAGGAAAGACAGAGGAAACAAGG + Intergenic
1158625327 18:59066328-59066350 CAGGTTAGGCAGAGCTTTCAAGG + Intergenic
1159007870 18:63029058-63029080 CAGGTAATAAAGAGGTGAAAAGG + Intergenic
1159159423 18:64624024-64624046 CAGGATAATCAGAGGTGACAAGG - Intergenic
1160440890 18:78891549-78891571 CAGGACAGACAGATGTGACATGG - Intergenic
1160993030 19:1868411-1868433 GAGGTCACACTGAGGTGACAGGG - Intergenic
1161156862 19:2736321-2736343 CATGTCATGCAGAGGTGACAGGG - Intronic
1161577749 19:5064220-5064242 CAGGTTGGACAGAGGCCACCTGG - Intronic
1164102136 19:22065711-22065733 CAGGACAAACACAGGTGACATGG + Intronic
1164605073 19:29592026-29592048 CCAGAGAGACAGAGGTGACAAGG + Intergenic
1165569595 19:36764306-36764328 CAGGTCAGACAAAAGTTACAGGG + Intronic
1166670767 19:44708324-44708346 CAAGTTAGGCGGAGGAGACAAGG - Intronic
1166863745 19:45823973-45823995 AGGGTGAGACTGAGGTGACAGGG + Intronic
1167343002 19:48927198-48927220 CGGGTTAGTCAGAAGTCACACGG + Intergenic
925401698 2:3578078-3578100 CATGCTAGACACAGTTGACATGG + Intronic
926107402 2:10160850-10160872 CAGGGCAGACAGAGGTGGCCAGG - Intronic
927155622 2:20219638-20219660 CAGCTGAGAGAGAAGTGACAGGG + Intronic
927270794 2:21208303-21208325 CAGGTTATTCAGAGGCAACATGG + Intergenic
929050280 2:37830607-37830629 CAGGCTAGATAGCTGTGACATGG - Intergenic
929418301 2:41766364-41766386 CAGGTTAGTTAGTGGTGAAAAGG - Intergenic
931268409 2:60680785-60680807 CAGGTAAGAGAGGGGTGACTTGG + Intergenic
931741406 2:65248666-65248688 GAGGGTAGACAGTGGTGAAAAGG + Intronic
933312806 2:80681939-80681961 CAGGGTAAAGAGAGGTGAGAAGG + Intergenic
933348140 2:81116775-81116797 CAGGCAACACAGAGCTGACAAGG - Intergenic
936155254 2:110042828-110042850 CAGGTTACACTGCAGTGACAAGG - Intergenic
936189426 2:110328585-110328607 CAGGTTACACTGCAGTGACAAGG + Intergenic
936946467 2:117935442-117935464 CAGGTTTTATAGTGGTGACAGGG - Intronic
937233063 2:120411993-120412015 CAGGTTTGTCAGAGGTCAGATGG + Intergenic
940047025 2:149420735-149420757 CAGGATAGAGAGAGGAGACCTGG + Intronic
940342267 2:152593816-152593838 AAGTTTAAACAGAGGTGACTAGG + Intronic
943066401 2:183091033-183091055 CAGGCTATACAGAGGGGACTAGG - Intronic
943139877 2:183969016-183969038 GAGGTGAGTCAGAGGTGAAATGG + Intergenic
943171037 2:184400539-184400561 CTGGTTTGACAGAGTTGACTGGG + Intergenic
943286090 2:186002747-186002769 AAAGCTAGATAGAGGTGACATGG + Intergenic
946103938 2:217352835-217352857 CAGGGAAAACAGAGGTGACTAGG + Intronic
946859148 2:223983596-223983618 AAGATTAGGCATAGGTGACACGG + Intronic
946935561 2:224716837-224716859 CACATTAGACAGAGAAGACATGG - Intergenic
948080808 2:235203698-235203720 CATGTGGGACACAGGTGACATGG + Intergenic
948623125 2:239249220-239249242 CGGGGCAGACAGAGGAGACACGG + Intronic
1169271849 20:4206171-4206193 CAGCTTAAACAGTGGTGAGAGGG - Intergenic
1171297195 20:24028342-24028364 CATGTTAGATAGAGGTTTCATGG - Intergenic
1171528940 20:25838684-25838706 CAGGTCAGACAAAAGTTACAAGG + Intronic
1171547886 20:26017201-26017223 CAGGTCAGACAAAAGTTACAAGG - Intergenic
1171774847 20:29355514-29355536 CAGGAGAGACTGAGGTGACTAGG + Intergenic
1171816856 20:29793144-29793166 CAGGAGAGACTGAGGTGACTAGG + Intergenic
1171901490 20:30862833-30862855 CAGGAGAGACTGAGGTGACTAGG - Intergenic
1172229630 20:33328080-33328102 CAGGTAAGGCAGAGGAGGCAGGG + Intergenic
1173603177 20:44310584-44310606 CAGGCAGGACAGAGGTGAGATGG + Intronic
1174449378 20:50610057-50610079 CAGGTGAGGCAGGGGTGGCAGGG - Intronic
1174449414 20:50610156-50610178 CAGGTGAGACAGGGTTGGCAGGG - Intronic
1174449426 20:50610201-50610223 CAGGTGAGACAGGGTTGGCAGGG - Intronic
1174843831 20:53924096-53924118 CAGGTCAGCCTGAGGAGACAGGG - Intergenic
1175215076 20:57388037-57388059 CAGGCTGGGCAGAGGTGACTTGG - Intergenic
1175893733 20:62326974-62326996 CAGGACAGACAGAGGTGACCTGG + Intronic
1175898724 20:62351621-62351643 CAGGTTAGGCAGGGGTGACAAGG + Intronic
1176089455 20:63312488-63312510 CAGGGTAGAGGCAGGTGACACGG - Exonic
1177428814 21:20962004-20962026 CAGTGTGGATAGAGGTGACAAGG - Intergenic
1177950872 21:27535357-27535379 CAGCTTTGACAGAGGTGGCTGGG - Intergenic
1178181062 21:30162138-30162160 CAGATTAGACAGAGGAGTGAAGG + Intergenic
1178339745 21:31776046-31776068 CCAGTTAGACAGAGGTGCTATGG - Intergenic
1178752611 21:35318843-35318865 CATGTTAGACAGAGCAGATATGG + Intronic
1180728977 22:17967054-17967076 TAGGTGAGACAGAGGTTCCATGG + Intronic
1182662268 22:31933430-31933452 GAGGTTGGAGAGAGGAGACACGG - Intergenic
1183172535 22:36198762-36198784 CAGGTCACACAGAGGGGACATGG + Intronic
950610505 3:14124033-14124055 AAAGTTAGACACAGGAGACATGG - Intronic
950869723 3:16218387-16218409 TAGGGAAGAGAGAGGTGACAAGG - Intronic
951718138 3:25671056-25671078 AAGGTAAGACAAAGGTAACAAGG - Intergenic
952036992 3:29214820-29214842 AAGGTTAGAGAGAAATGACAAGG + Intergenic
952064591 3:29553440-29553462 CAGTTTAGACAGAGGGGATCAGG + Intronic
952873802 3:37925102-37925124 AAGGATGGACAGAGGGGACAGGG - Intronic
952954481 3:38548734-38548756 CAGGTGAGACTGAGGTGGCCTGG + Exonic
954130334 3:48557299-48557321 CAGGTTGGTCAGAGCCGACAGGG + Intronic
954744139 3:52777575-52777597 CTGGTCTGACTGAGGTGACAGGG + Exonic
954901291 3:54022204-54022226 CAGGATAGACAGAGGGAACAGGG + Intergenic
955930721 3:64054195-64054217 TAGGTTGGAGAGAGGTGCCAGGG + Intergenic
955931109 3:64057839-64057861 TAGGTTGGAGAGAGGTGCCAGGG - Intergenic
959661097 3:108868931-108868953 CAGGCTAGAGTGAGGTGGCACGG - Intergenic
960732699 3:120743822-120743844 CAGGGTAGACAGAGGGCAGAGGG + Intronic
960884552 3:122381370-122381392 AAGGTTAAACAGAGGTCATAAGG + Intronic
963206548 3:142642123-142642145 CAGGTTAGACAGAGGTGACAAGG - Intronic
963350096 3:144140838-144140860 CAGCTTAGACAGTGGTGAGTAGG + Intergenic
963395593 3:144728879-144728901 CAGTTAAGAAAGAGGTGATAAGG + Intergenic
963986576 3:151602469-151602491 CAGCTTAGACAATAGTGACATGG + Intergenic
964564246 3:158032369-158032391 CAGCCTTGACAGAGGTGACTGGG - Intergenic
965245320 3:166259018-166259040 CATGATACTCAGAGGTGACAGGG - Intergenic
965523488 3:169692208-169692230 CAGGTTAGGGGGAGGTGTCATGG + Intergenic
967138890 3:186536435-186536457 CAAGTTACACAGGAGTGACATGG - Intergenic
967321819 3:188201944-188201966 CAGGTCAAGCAGAGGGGACAAGG + Intronic
968358933 3:198133196-198133218 CAGGAGAGACTGAGGTGACCAGG - Intergenic
968958647 4:3731566-3731588 CAGGCCAGGCAGAGGTCACAGGG - Intergenic
969477426 4:7429558-7429580 CAGAAAAGACAGAGGTGTCATGG + Intronic
970943130 4:21658820-21658842 CAAGGGAGACAGAGGTCACAGGG - Intronic
974239972 4:59234625-59234647 CAGCTAAGACAGTGGTGAAAGGG - Intergenic
981463162 4:145034722-145034744 CAGGTTCGACCCAGGGGACAGGG + Intronic
982070381 4:151689064-151689086 CAGGTTACACACAGCAGACACGG - Intronic
983739974 4:171118055-171118077 CTGGAAAGACAGATGTGACATGG + Intergenic
984577390 4:181466906-181466928 AAAGTTTGAGAGAGGTGACAAGG - Intergenic
985073930 4:186193985-186194007 CTGGTCTGACAGAGGGGACAGGG - Intronic
986326932 5:6682512-6682534 CAGGACAGACAGAAGTGACGGGG + Intergenic
993857328 5:93092783-93092805 CATGTTAGAAAGAAGTGACGTGG + Intergenic
1005224063 6:23620729-23620751 CAGGTTAGAATGAGGTCATATGG + Intergenic
1005633458 6:27731159-27731181 CAGGTTAGGCTGAGGTTAAATGG + Intergenic
1005810477 6:29511419-29511441 CACGAAAGACAGAGGTGAGAAGG + Intergenic
1005840283 6:29740715-29740737 CAGGTAAGGCAGTGGTGGCAGGG - Intergenic
1014027225 6:116662800-116662822 CAGGTTTGACAGTGGTGAAAGGG - Intronic
1014486767 6:122008661-122008683 CAGGTGACAAAGTGGTGACATGG + Intergenic
1016846313 6:148571570-148571592 CAGGTCAGACAGAAGCCACAAGG - Intergenic
1018111316 6:160539233-160539255 CAGGTTTGGGACAGGTGACAAGG - Intronic
1018131920 6:160740018-160740040 CAGGTTTGGGACAGGTGACAAGG + Intronic
1018301836 6:162410878-162410900 CAGGGAAGAAGGAGGTGACAGGG + Intronic
1022115994 7:27261109-27261131 CATTTTAGAAAGATGTGACAAGG + Intergenic
1022584982 7:31600300-31600322 GAGGTTATACACAGGTGAAAAGG - Intronic
1024883648 7:54116990-54117012 CAGGTGATACAGAAGTGAGAGGG - Intergenic
1024961086 7:54977503-54977525 CAGGGTAGACAGTGGAGACACGG + Intergenic
1026806404 7:73431993-73432015 CAGCCTAGAGAGAGGTGAGAGGG + Intergenic
1029736730 7:102469392-102469414 CAGGTTAGATGGAGGAAACAGGG + Intronic
1030399659 7:109032356-109032378 CAGGTTTTACAGAGATTACATGG - Intergenic
1031327353 7:120418334-120418356 CAGGTTAGAAAAATGTGAAAGGG - Intronic
1031957421 7:127956526-127956548 CATGTGAGAAAGAGGAGACAGGG + Intronic
1034281934 7:149860663-149860685 TCGGTTAGTCAGAGGTTACACGG + Exonic
1036207793 8:6818040-6818062 CAAGTTGTGCAGAGGTGACAGGG - Intronic
1037982234 8:23262444-23262466 CAGGTAAGGCAGAGGTGAACTGG + Intergenic
1040836537 8:51737532-51737554 CAGGGTAGAAAGAGGAGAAAGGG - Intronic
1043274549 8:78376958-78376980 CAGCTGAGACAGAGCAGACAGGG - Intergenic
1046514560 8:115241522-115241544 CAGGTCAGACAGAGGAAATAAGG + Intergenic
1048504448 8:135008148-135008170 CAGGTCACACAGTGGTGACTGGG + Intergenic
1048600972 8:135918362-135918384 CAAGTTTGTCAGAGGTGATAGGG + Intergenic
1048611495 8:136027873-136027895 CAGGAAAGACAGAGGTGGCTTGG + Intergenic
1049351959 8:142169438-142169460 CAGGTCAGATAGTGGTGGCATGG + Intergenic
1049503130 8:142978725-142978747 CTGGAGAGACAGAGGGGACATGG + Intergenic
1050596500 9:7209731-7209753 GAGGTTAGAGAGAGGAGAAAAGG - Intergenic
1051658357 9:19403972-19403994 CAGGTTAGAAAAAGGAGAGAGGG + Intergenic
1052316408 9:27120316-27120338 CAGGTGAAGAAGAGGTGACAAGG - Intronic
1052565426 9:30143846-30143868 CAGGTTAGACAGCAGGGATATGG + Intergenic
1053796922 9:41734916-41734938 CAGGTCAGACAAAAGTTACAAGG + Intergenic
1054148267 9:61579938-61579960 CAGGTCAGACAAAAGTTACAAGG - Intergenic
1054185336 9:61946999-61947021 CAGGTCAGACAAAAGTTACAAGG + Intergenic
1054468012 9:65511046-65511068 CAGGTCAGACAAAAGTTACAAGG - Intergenic
1055868948 9:80850956-80850978 CTGGAGAGACAGAGGTTACATGG + Intergenic
1060403766 9:123362817-123362839 CAGGGTGGGCAGAGGTTACAAGG - Intronic
1185806955 X:3066738-3066760 CATGGGAGAGAGAGGTGACACGG + Intronic
1186059533 X:5689335-5689357 CAGGTTAGACTGAGGTGTGGGGG - Intergenic
1187496991 X:19803831-19803853 CAGGTTAGAAAGAAGGGCCAGGG - Intronic
1187840741 X:23484855-23484877 CAGGTTTGTCAAAGGTGAGATGG - Intergenic
1190357290 X:49617412-49617434 CATCTGTGACAGAGGTGACAGGG + Intergenic
1191615729 X:63167670-63167692 CAGCTTTGACAGGGGTGGCAAGG - Intergenic
1191620569 X:63211253-63211275 CAGCTTTGACAGGGGTGGCAAGG + Intergenic
1193072130 X:77317362-77317384 CAGGTTTGTCAAAGGTGAGATGG - Intergenic
1198190937 X:134304964-134304986 CATTTTTGACAGAGGTGCCAAGG + Intergenic
1198951486 X:142077531-142077553 CATTTTACACACAGGTGACATGG + Intergenic
1199065845 X:143417477-143417499 CAGCTTTGACAGAGGTGGCTGGG + Intergenic
1200141995 X:153907035-153907057 CAGGTGAGACAGCGGTCCCAGGG + Exonic
1200389718 X:155931991-155932013 CAGGTTTGTCAAAGATGACATGG + Intronic
1201562819 Y:15335680-15335702 CAGGTTAGAAATAGGTGGTAAGG - Intergenic