ID: 963208367

View in Genome Browser
Species Human (GRCh38)
Location 3:142659902-142659924
Sequence AGGCTTTAATTGATGAAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 219}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963208367 Original CRISPR AGGCTTTAATTGATGAAAGA AGG (reversed) Intronic
901366459 1:8754915-8754937 AGGCTTGAATTCTAGAAAGAGGG - Intronic
902750917 1:18510348-18510370 AGCCTTTTAGTGATGAAAGGGGG - Intergenic
906195629 1:43929021-43929043 AGGCTTGATTTAATGAATGAAGG - Intronic
906797359 1:48708702-48708724 AGGCTTTTCTTCCTGAAAGAAGG - Intronic
908110702 1:60894607-60894629 AGGGGTTAATTGTTGAGAGAAGG + Intronic
908789225 1:67764928-67764950 AGGCTTTGTTTGGAGAAAGACGG - Intronic
910070728 1:83210207-83210229 AGGCTTGAATAGAAGAAAAAAGG - Intergenic
910386893 1:86693406-86693428 AGGCTGGAATTTATTAAAGAGGG + Intergenic
916261668 1:162848431-162848453 AGGTTTTCAATAATGAAAGAAGG + Intronic
916843046 1:168620013-168620035 AGGCTATAAGTGAACAAAGATGG + Intergenic
918368582 1:183836148-183836170 AGACTGTAAATGAAGAAAGAAGG - Intronic
918392145 1:184077045-184077067 AGGCTTTAAATGTAGACAGACGG + Intergenic
920126597 1:203698564-203698586 AGGATTTAATAGAAGACAGAGGG - Intronic
921548493 1:216502840-216502862 ATGATTTAATTGTTGATAGAGGG + Intergenic
922512248 1:226178699-226178721 AGCCTTCATTTAATGAAAGAAGG + Intronic
1063004862 10:1960371-1960393 AGTATTTAAGTGTTGAAAGAAGG - Intergenic
1068712693 10:60151509-60151531 ATGCTTTCATTCATGACAGAAGG - Intronic
1069217034 10:65833593-65833615 ATGTTTTAATTAATGAAATATGG + Intergenic
1070042299 10:72793445-72793467 AGGGTTTAATTTATTAAAGCAGG + Intronic
1070701749 10:78607322-78607344 AGTCTTTAATTAATTCAAGATGG + Intergenic
1071137741 10:82471148-82471170 AGGCTTTATTGGATGAAAAGGGG + Intronic
1071758843 10:88577163-88577185 AGGAATTAACTGATGAAAGAGGG + Intronic
1077294656 11:1820345-1820367 AGGCACTAATTGATCAAAGGGGG + Intergenic
1077707818 11:4504979-4505001 AGGCTTAAATATATCAAAGATGG + Intergenic
1078665990 11:13325709-13325731 AGGGTTGAATTTTTGAAAGAAGG - Intronic
1078873453 11:15370924-15370946 AGACGTTAATGGATGAAATATGG + Intergenic
1078964738 11:16325757-16325779 AGGCTTTGATTTATGAATTATGG - Intronic
1079530117 11:21442149-21442171 AGGCATTAACTGAGTAAAGAAGG - Intronic
1081409952 11:42745973-42745995 TGGCATTAAGTGATGGAAGATGG + Intergenic
1083813895 11:65121096-65121118 AGGCTTGAATTGAGAAAAGAGGG - Intronic
1085257606 11:75184798-75184820 AGGCTTTATTTTAGGGAAGATGG + Intronic
1086283032 11:85213060-85213082 AGGCATAAAATGAAGAAAGAGGG + Intronic
1088747270 11:112814594-112814616 GGGTTTTTATTGATGAAGGAGGG - Intergenic
1090374329 11:126278242-126278264 AGGATTTAACTAATGAAAGGTGG - Intergenic
1092791112 12:12071725-12071747 AGGCTCTGATTGTGGAAAGAAGG - Intronic
1095042338 12:37456109-37456131 AGGCTTTTATGGATGTCAGAGGG - Intergenic
1095277940 12:40311802-40311824 AAGGTTTTATTGATGATAGATGG + Intronic
1095308665 12:40668649-40668671 AAGCTTTAATAGATAAATGAGGG - Intergenic
1097059632 12:56272917-56272939 AGACTTTAAAAGATGAAAAATGG - Exonic
1097930704 12:65181930-65181952 AGGCTTTAAAATCTGAAAGACGG - Intronic
1098422603 12:70317347-70317369 AAGCTTTAGTTGATCACAGAAGG - Intronic
1098553324 12:71789681-71789703 AGGCTTTAATAGTTAAAAGCTGG + Exonic
1098917179 12:76269637-76269659 AGTATTTCCTTGATGAAAGAGGG + Intergenic
1099012561 12:77309336-77309358 GGGTTTTAGTTGATGAAAGGAGG + Intergenic
1100699442 12:97130721-97130743 AGGCTCTAATTGAAGAAGCAGGG + Intergenic
1101157728 12:101943716-101943738 AGGATTTTATTACTGAAAGAAGG + Intronic
1105782571 13:23716957-23716979 AGCCTTTTATTGATGAAGGCAGG + Intergenic
1105906741 13:24818951-24818973 GGGCTCTAATGGAGGAAAGAAGG - Intronic
1106696070 13:32174144-32174166 ATGCATAATTTGATGAAAGAGGG + Intronic
1106822490 13:33480955-33480977 AGGCTCTCATTGACCAAAGATGG + Intergenic
1107255344 13:38419479-38419501 AGAGTTTAATTGAGCAAAGAAGG + Intergenic
1107786539 13:43963357-43963379 AGGCCTTAATAGATCAAAGGTGG - Intergenic
1109067614 13:57719105-57719127 AAGCTTACATTGTTGAAAGAAGG + Intronic
1109089652 13:58024744-58024766 AGGCTTTGATTGATAAATGCTGG + Intergenic
1109474470 13:62861275-62861297 AGACTATAATTTATGAAAGAAGG + Intergenic
1112853118 13:103731738-103731760 TGTATTTAATTGATGAAATAGGG + Intergenic
1114400774 14:22408396-22408418 AGTATTTAATAGATGGAAGAAGG - Intergenic
1114903274 14:27093396-27093418 AGCCTTTAATTGAAGAACAAAGG + Intergenic
1115020602 14:28676045-28676067 AGGCTTTAAAAGTTGAAAGTGGG + Intergenic
1116229256 14:42194878-42194900 AGGATGTGATTGTTGAAAGAGGG - Intergenic
1117661498 14:58010185-58010207 AGACTTTAATAGATGATGGATGG + Intronic
1118042237 14:61929998-61930020 TGGCTTTAATTGAGCAAGGAAGG + Intergenic
1119338976 14:73859124-73859146 AGGCATTTGTTGATGAAATAAGG + Intronic
1119558312 14:75570065-75570087 AGACTTAACTTGGTGAAAGAGGG - Intergenic
1120403368 14:84062639-84062661 AACCTTAAAGTGATGAAAGAAGG + Intergenic
1122500343 14:102193905-102193927 GGGCTTTTATTGGTGAAATAAGG - Intronic
1122504583 14:102223937-102223959 AGGCTTTCAATGACGAAAGGAGG - Intronic
1123129787 14:105975649-105975671 AGGCATTAACGGATTAAAGATGG - Intergenic
1123579979 15:21706182-21706204 AGGCATTAACGGATTAAAGATGG - Intergenic
1123616627 15:22148804-22148826 AGGCATTAACGGATTAAAGATGG - Intergenic
1126525138 15:49645542-49645564 AGGCTTGAATTGATTTAAGCAGG + Exonic
1130899874 15:88199241-88199263 AGGCTTTAACTGATGTGAGCTGG + Intronic
1202988849 15_KI270727v1_random:440427-440449 AGGCATTAACGGATTAAAGATGG - Intergenic
1132809410 16:1790430-1790452 TGCCTTTAATTGATGACAGCTGG + Intronic
1133333151 16:4988617-4988639 AGGCATAATTTAATGAAAGAAGG - Intronic
1135005105 16:18813818-18813840 AGGCTTGAATTAATTCAAGATGG - Intronic
1135086553 16:19479209-19479231 AAGCTTTAATGGGGGAAAGAAGG + Intronic
1135174103 16:20212817-20212839 AAGCTTTAATTAATGCTAGAAGG + Intergenic
1135327112 16:21533484-21533506 GGGCTACAATTCATGAAAGATGG + Intergenic
1136337428 16:29619324-29619346 GGGCTACAATTCATGAAAGATGG + Intergenic
1138316786 16:56077078-56077100 GGGATTTAAGAGATGAAAGATGG + Intergenic
1139005662 16:62568886-62568908 AGGCGTTAATTGAGGATTGATGG - Intergenic
1142040226 16:87888668-87888690 GGGCTACAATTCATGAAAGATGG + Intronic
1143588056 17:7861455-7861477 AGGGTTTAATTGAGCAAACAAGG - Exonic
1146741318 17:35286178-35286200 AGAATTTAATTGAGAAAAGAAGG + Intergenic
1148018436 17:44538659-44538681 AGGATGGAATTGCTGAAAGAAGG + Intergenic
1148987396 17:51635133-51635155 AGGCTTTAATGGAATACAGAAGG + Intronic
1150117512 17:62566881-62566903 AGACTTTGATTCAGGAAAGATGG + Intronic
1155812634 18:30257296-30257318 AGGATTTAATTAAATAAAGAGGG - Intergenic
1158201570 18:54947421-54947443 AGGCTTTCTGTGAAGAAAGAAGG + Intronic
1158803529 18:60942666-60942688 AAGATTCAATGGATGAAAGAGGG - Intergenic
1159028106 18:63205200-63205222 AGGCTGTTGTTGATGAAGGATGG - Intronic
1159321513 18:66857000-66857022 AGGCTTTAAGAGACAAAAGATGG + Intergenic
1160357790 18:78243260-78243282 ATGCTTAAATTGATTTAAGAAGG + Intergenic
1163563042 19:18032174-18032196 AGACTTTAAAAGATGAAAAATGG + Intergenic
1164279958 19:23760362-23760384 AGGCTTTATTAGAAGGAAGAGGG + Intergenic
1164309210 19:24031451-24031473 AGGCTTTATTGGAAGGAAGAGGG + Intergenic
925561665 2:5202930-5202952 AGGCCTTAATTGATTGAAGGAGG - Intergenic
925684303 2:6455965-6455987 AGGCTTATATTGATGATTGATGG - Intergenic
925749150 2:7071882-7071904 AGGCCTTAAAAGAAGAAAGAGGG + Intergenic
926817320 2:16812488-16812510 AGTATTTAATTGATGAAAAAAGG + Intergenic
928445467 2:31330003-31330025 AGTCTTTAATTGATGATGGCTGG - Intergenic
930413453 2:51057308-51057330 AGCCTTTAATTGATGATATTTGG + Intergenic
930832659 2:55761867-55761889 CTGCTTTAACTCATGAAAGATGG + Intergenic
931193588 2:60028687-60028709 AGGCTTTTGTTGATAAAGGATGG + Intergenic
931260351 2:60612692-60612714 AGAGTTTAATTGATGGCAGATGG + Intergenic
936935309 2:117834233-117834255 AGGCTTTGTTTGGTGCAAGAAGG - Intergenic
937553390 2:123123678-123123700 AGGTTTTAATAGGTGAAAAAGGG + Intergenic
937863967 2:126733995-126734017 AGGACTTAATTGAACAAAGATGG + Intergenic
939591603 2:144071004-144071026 TGGCTTTAAATGAGAAAAGAGGG + Intronic
942642828 2:178077501-178077523 AGGCTTGAATTAAGGAAAGCAGG - Intronic
943294828 2:186124481-186124503 AGGCTTTAGTTTAAGAAAGTTGG - Intergenic
944010776 2:194972311-194972333 AGGCCTAAATAAATGAAAGATGG + Intergenic
945132432 2:206587638-206587660 AGGCTGAAATTACTGAAAGATGG - Intronic
945276133 2:207989494-207989516 AGGCTGTAATTGGGGATAGATGG - Intronic
945744992 2:213709513-213709535 GAGCTTTAATTGATTAAACAGGG + Intronic
946240310 2:218349975-218349997 AGACTGTAATTTATTAAAGAGGG + Intergenic
946608020 2:221427180-221427202 AGGCATGGATTGATTAAAGAGGG - Intronic
946691828 2:222314621-222314643 AGGAATTAAATGATTAAAGAGGG + Intergenic
947023409 2:225709589-225709611 AAGCTTATATAGATGAAAGAGGG - Intergenic
947267642 2:228300744-228300766 AGACTGTAATTCATTAAAGAAGG + Intergenic
1168805624 20:670745-670767 AGTCTTTGATTGCTGAAGGAGGG - Intronic
1169372178 20:5036287-5036309 AGTCTTTAATGGATGTAAGTGGG + Intergenic
1169619400 20:7488238-7488260 AGGTTTTTAGTGAAGAAAGAAGG - Intergenic
1171354534 20:24534001-24534023 AGGTTTTTATTCATGGAAGAAGG + Intronic
1171804340 20:29661976-29661998 GGGCTTTTATTGATGTCAGAGGG + Intergenic
1172075735 20:32295822-32295844 ATGTTTTAATTGATAAATGAGGG - Intronic
1172864085 20:38081887-38081909 AGGCTTTATTTGTTGAATCAAGG - Intronic
1173989234 20:47287575-47287597 AGGCTCAAATTAATGAAAAAAGG + Intronic
1177721270 21:24909860-24909882 GGGCTTTAATTCATGAAAATTGG + Intergenic
1178036117 21:28584789-28584811 AGGGTGAAATTGATGAAAAAGGG + Intergenic
1179094241 21:38297673-38297695 AGGATATAATTGATGAACTAGGG - Intronic
1179258137 21:39735639-39735661 AGGATTTAAGTCATGAATGAAGG + Intergenic
1179323058 21:40311808-40311830 AGGATTTAATTCATGAAATAAGG - Intronic
1180261351 21:46671243-46671265 AGGCTTTTATGGTTGAAAGAAGG + Intergenic
1182955231 22:34418151-34418173 AGGATGGACTTGATGAAAGATGG + Intergenic
949153749 3:803027-803049 AAGCTTTTATTCATGACAGAAGG + Intergenic
950778856 3:15373839-15373861 AGGCTTCAATTTATGAACAAGGG + Intergenic
952016146 3:28959225-28959247 AGGCTTTTATGGATGTCAGAGGG - Intergenic
952072437 3:29654391-29654413 AGCCTATAATTGATGAATGAGGG + Intronic
952131867 3:30373332-30373354 TGTCTTTAGTTGATGAAAGAGGG + Intergenic
952696961 3:36277022-36277044 AGGTTGGAATTGATCAAAGATGG - Intergenic
954918821 3:54171921-54171943 AGGCTCCAGTTGAGGAAAGAAGG - Intronic
957616612 3:82536719-82536741 AGGCTATAAATGAAGAAAGCAGG - Intergenic
957882803 3:86243127-86243149 AGCCTTTAATTTAGGAAGGAAGG - Intergenic
958718741 3:97820433-97820455 AGGATTTAATTAATGAATTATGG - Intergenic
963208367 3:142659902-142659924 AGGCTTTAATTGATGAAAGAAGG - Intronic
964861520 3:161207638-161207660 TGCCTTAAAGTGATGAAAGATGG - Intronic
967502591 3:190217197-190217219 TGGCTTTGATAGATTAAAGAAGG - Intergenic
967610508 3:191500277-191500299 AGACTTTAAATGATGTAAAAAGG + Intergenic
971259828 4:25046006-25046028 AGGGTTTAAGTGATGGAATAAGG - Intergenic
975254942 4:72223034-72223056 TGGCTTTAATTGAAGATAGGTGG + Intergenic
975730247 4:77330574-77330596 AGACTTTAATTTATTAAAGAGGG + Intronic
977669506 4:99679705-99679727 GGGTTTTAACTGATAAAAGAAGG - Intergenic
979981480 4:127261325-127261347 AGACTTGACTTGATGAAAAAAGG + Intergenic
981663999 4:147200633-147200655 AGCCTTTATGTGATGAAATAGGG + Intergenic
983013102 4:162574511-162574533 TGCCTTTAACTGATGAAATAAGG + Intergenic
983125133 4:163942128-163942150 AGGCTGTAACTTATGGAAGATGG - Intronic
983529226 4:168792546-168792568 AGGCTTGAGTTGAGGAACGAAGG - Intronic
983790518 4:171792041-171792063 GGCCTTTTATTGATGAAAAAGGG - Intergenic
984135629 4:175934296-175934318 AAGCGTTAATTGATGAAAGTTGG - Intronic
985026901 4:185747345-185747367 AGGCTTTAAACGATGAACAAGGG + Intronic
985067774 4:186139997-186140019 ATGCTTTAAATGCTGAAAAAAGG + Intronic
988180841 5:27789625-27789647 AGAATTTAATTGAGCAAAGAAGG - Intergenic
988218598 5:28311679-28311701 GGGGTTTAATTGATCACAGAGGG + Intergenic
989682927 5:44050792-44050814 GGGCTTTGAATGATGAGAGATGG + Intergenic
990616217 5:57511197-57511219 AGGCTTTGAGTGGTGAAAGGAGG + Intergenic
991448244 5:66723433-66723455 AGACTATAATTGCTGAAAGAAGG + Intronic
992339114 5:75804415-75804437 AGGACTTAATTCAAGAAAGATGG + Intergenic
992804781 5:80325872-80325894 AGGCTTTTATTCATGATATAAGG - Intergenic
992871807 5:81013521-81013543 AGGATTTGATTGTTGAAAGAAGG - Intronic
992888108 5:81179077-81179099 AGGCTTTAATTGATGTTTAAAGG + Intronic
993147510 5:84114072-84114094 AGGCTTTAATTGGTGAGGGAGGG + Intronic
993699510 5:91101341-91101363 AGGTGTTAATTGATGATAGTGGG + Intronic
994297565 5:98109477-98109499 AGGCTTGCATGGACGAAAGATGG - Intergenic
994807368 5:104466897-104466919 ATGCATTCATTGATTAAAGATGG - Intergenic
995618722 5:113998685-113998707 GGGCTTTAATTGATGGATAATGG + Intergenic
996972171 5:129384577-129384599 ATGTTTTAATTAATGAAAGGAGG - Intergenic
997366713 5:133330366-133330388 AAGCTTTTACTCATGAAAGAAGG + Intronic
998396058 5:141818825-141818847 AGGATTTAATTCTGGAAAGAGGG + Intergenic
998956844 5:147447390-147447412 AGGCATATGTTGATGAAAGAGGG + Intronic
999680901 5:154059082-154059104 AGCCTTTAACTAATGACAGATGG - Intronic
1004321353 6:14633976-14633998 TGGCTTTGGTTGATGAAAGCAGG - Intergenic
1007461659 6:42023701-42023723 AGTGTTTAATAGATGATAGATGG - Intronic
1007960716 6:45956590-45956612 AGGTTCTAATGTATGAAAGAAGG - Intronic
1010945413 6:81968794-81968816 AAGCTTTAATTAAGGCAAGAAGG - Intergenic
1011892352 6:92180927-92180949 AGTCATGATTTGATGAAAGACGG + Intergenic
1013179295 6:107704844-107704866 AGGGTTCAAAGGATGAAAGAAGG - Intronic
1013321987 6:109002045-109002067 TGGCTTTACTTGATTAAATATGG + Intronic
1017812727 6:157995828-157995850 AGACTCTAATTGATTAATGATGG - Intronic
1019227876 6:170530042-170530064 TGGCTTTCATTGAAGAATGAAGG + Intergenic
1020440147 7:8208848-8208870 AAGCATTAAGTGATGAAACATGG + Intronic
1021947183 7:25739602-25739624 GGGCTCTAATTTATGAAAGATGG - Intergenic
1022586407 7:31617157-31617179 AGGCTTTTCTTCCTGAAAGATGG - Intronic
1022743806 7:33149164-33149186 AGGCTTTCATTGATGGAGCAGGG + Intronic
1022855359 7:34309070-34309092 AGCCTTTATCTGATGAAAGAAGG - Intergenic
1023023423 7:36030820-36030842 AGTCTTTAAAAGATGCAAGACGG - Intergenic
1024674188 7:51623448-51623470 AGGTTTTAATTGAAGAAAGGAGG - Intergenic
1026550416 7:71363692-71363714 AGAGTTTAATTGAGCAAAGAAGG + Intronic
1027288450 7:76675078-76675100 AGGCTTGAATAGAAGAAAAAAGG - Intergenic
1027438754 7:78195865-78195887 AGGCATCAGTTGATGAATGAAGG - Intronic
1027965132 7:84994598-84994620 ATGCTTAAATTGAGGAAAGAGGG - Intergenic
1028510393 7:91619207-91619229 TGGCTTTAATTAATTCAAGAGGG + Intergenic
1032779756 7:135155624-135155646 GGGCATTAATTGATGGAAGGTGG + Intronic
1034464965 7:151222043-151222065 ATGCTTTACTTTTTGAAAGAAGG + Intronic
1035637943 8:1161427-1161449 AGGCTTTAAATGCTGGCAGAGGG + Intergenic
1036059360 8:5298296-5298318 AGGCATTAATGGATTAGAGAAGG - Intergenic
1038589282 8:28821538-28821560 AGGCTTTCAGTGTTCAAAGATGG + Intronic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1041646270 8:60255607-60255629 AGACATTAATTGATGAAAAAGGG + Intronic
1042079616 8:65037035-65037057 AGGATATAATTGATGGAACAAGG - Intergenic
1042884930 8:73538461-73538483 AGTCTTCAATCAATGAAAGAAGG + Intronic
1043254325 8:78114726-78114748 AAGCTGTGATTGATCAAAGATGG - Intergenic
1044012077 8:87006526-87006548 AAGCTTTTATTTATGAAGGAAGG + Intronic
1044034135 8:87276726-87276748 TGGCTATAATTCAAGAAAGAAGG + Intronic
1045203021 8:100006542-100006564 AGGTTTTATTTGATGATTGATGG - Intronic
1045555439 8:103210183-103210205 AGGCTGTAATTGGTGGAGGAAGG + Intronic
1045708235 8:104952850-104952872 AGGCTTTCAGTGATAAAACATGG + Intronic
1046031365 8:108787139-108787161 TGCTTTTAATTGATGACAGATGG - Intronic
1047029702 8:120862931-120862953 GGGCTGTAATTTATGAGAGAAGG + Intergenic
1047650012 8:126910503-126910525 AGGCTTTGTTTGCTAAAAGAAGG - Intergenic
1048425952 8:134323643-134323665 AGGTTATAATGGATGAAAGTAGG + Intergenic
1056856703 9:90136738-90136760 AGGCTTTAACTGGTGCAATATGG - Intergenic
1057495850 9:95560372-95560394 AGGCTTTAAGTGCTATAAGAGGG - Intergenic
1058982505 9:110183277-110183299 AGATTTTAATTCATTAAAGAGGG - Intergenic
1061811763 9:133166496-133166518 AGGGTTTAAATGAGGAAAGACGG + Intergenic
1203441939 Un_GL000219v1:16602-16624 AGACTTGAATTCATGAAAGAAGG + Intergenic
1203512747 Un_KI270741v1:135511-135533 AGACTTGAATTCATGAAAGAAGG + Intergenic
1185808779 X:3085615-3085637 AGGCTTTTTTTAAAGAAAGAAGG - Intronic
1186359498 X:8825030-8825052 AGGATTGAATTGCTGAAAGTGGG - Intergenic
1187622975 X:21079149-21079171 AGGCCTTAATTGCTAAAATATGG - Intergenic
1188890658 X:35607507-35607529 AGGCTGAAAGTGATAAAAGATGG - Intergenic
1189926264 X:45958812-45958834 AGTCATTTATTGATGAAAGAAGG - Intergenic
1189929279 X:45990704-45990726 AGCCTTCAACTGATGAAACAAGG - Intergenic
1190463060 X:50698111-50698133 AGTGTTTAATTAACGAAAGATGG - Intronic
1191163390 X:57360248-57360270 AGGAATTATTTGAAGAAAGAAGG - Intronic
1195468396 X:105206634-105206656 AGAATTTTATTGATTAAAGATGG + Intronic
1196055106 X:111347412-111347434 ATGCTTTGATGGGTGAAAGAGGG - Intronic
1197038991 X:121911735-121911757 AGGCTTTAATGGAGGAAATGAGG - Intergenic
1197213048 X:123843974-123843996 AGGGTTTAATAGGTGAAACAAGG + Intergenic
1197727959 X:129788679-129788701 AGGCCCTATTTGATGCAAGAAGG + Intronic
1198977815 X:142356910-142356932 AGGGTTTATTTCAAGAAAGAAGG - Intergenic