ID: 963210164

View in Genome Browser
Species Human (GRCh38)
Location 3:142680350-142680372
Sequence CCACCATGCCTGGCCAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3052
Summary {0: 6, 1: 28, 2: 174, 3: 703, 4: 2141}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963210160_963210164 5 Left 963210160 3:142680322-142680344 CCCAAAGTGCTGGAATTATAGGC 0: 1032
1: 30665
2: 261001
3: 272072
4: 169172
Right 963210164 3:142680350-142680372 CCACCATGCCTGGCCAAAACTGG 0: 6
1: 28
2: 174
3: 703
4: 2141
963210158_963210164 8 Left 963210158 3:142680319-142680341 CCTCCCAAAGTGCTGGAATTATA 0: 1372
1: 40332
2: 336525
3: 252831
4: 136324
Right 963210164 3:142680350-142680372 CCACCATGCCTGGCCAAAACTGG 0: 6
1: 28
2: 174
3: 703
4: 2141
963210156_963210164 18 Left 963210156 3:142680309-142680331 CCTGCTTCAGCCTCCCAAAGTGC 0: 2688
1: 67947
2: 186014
3: 237634
4: 276237
Right 963210164 3:142680350-142680372 CCACCATGCCTGGCCAAAACTGG 0: 6
1: 28
2: 174
3: 703
4: 2141
963210161_963210164 4 Left 963210161 3:142680323-142680345 CCAAAGTGCTGGAATTATAGGCA 0: 618
1: 16350
2: 124711
3: 250989
4: 241720
Right 963210164 3:142680350-142680372 CCACCATGCCTGGCCAAAACTGG 0: 6
1: 28
2: 174
3: 703
4: 2141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963210164 Original CRISPR CCACCATGCCTGGCCAAAAC TGG Intronic
Too many off-targets to display for this crispr