ID: 963211555

View in Genome Browser
Species Human (GRCh38)
Location 3:142698157-142698179
Sequence TTGGTCTGAATCAGAATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 139}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963211555 Original CRISPR TTGGTCTGAATCAGAATTGT GGG (reversed) Intronic
901554569 1:10021503-10021525 TTGTTCTGAAACTGGATTGTAGG - Intergenic
902844256 1:19097075-19097097 TACCTCTGCATCAGAATTGTGGG - Intronic
903758782 1:25683546-25683568 TGGGTCTGCATCAGGAATGTGGG + Intronic
912755320 1:112320246-112320268 TTGATCTGCATCAGAATTACTGG + Intergenic
913178768 1:116299028-116299050 TTGATCTGAAGCAGAGTTTTGGG - Intergenic
915060327 1:153176499-153176521 TTGAAGTGAATCAAAATTGTTGG - Intergenic
916035356 1:160917376-160917398 TTGGACTGAATAAGAATTCCTGG - Intergenic
916430077 1:164719546-164719568 ATGCTCTGAATCAGAATTTCTGG + Intronic
917429272 1:174948728-174948750 ATCTTCTGAATCAGAATTTTAGG + Intronic
919152170 1:193715341-193715363 TTGGTTTGAATCAGGTTAGTGGG + Intergenic
919679880 1:200424083-200424105 TTGGTCTGATACAGATTAGTAGG + Intergenic
920980628 1:210831058-210831080 TTGGTCAGACTTAGAATTGAGGG - Intronic
1069069475 10:63978524-63978546 TTGGTCTGAGTCAGAATACCTGG + Intergenic
1069317147 10:67120031-67120053 AAGGTCTGATTCAGATTTGTTGG - Intronic
1070384502 10:75912429-75912451 TGCATCTGAATTAGAATTGTAGG + Intronic
1070948806 10:80414345-80414367 TTTCTCTGAAACAGAATAGTAGG - Intronic
1073513784 10:104059654-104059676 TAGGCCTGAGTCAGCATTGTAGG + Exonic
1077757011 11:5042288-5042310 TATGTCTCAATCAGAATTCTTGG - Intergenic
1080155962 11:29111403-29111425 TTGGGTAGAAACAGAATTGTAGG - Intergenic
1080567225 11:33521829-33521851 TTGGTCTGAAGGAGAATGGAAGG + Intergenic
1085208224 11:74749626-74749648 TTGGAGGGAAACAGAATTGTTGG + Intronic
1086648006 11:89248785-89248807 TTGGTCTAAATGAGAAATGATGG + Intronic
1087768968 11:102186310-102186332 TAGATCTGAATCAGATTTTTAGG + Intronic
1087935047 11:104023844-104023866 TTGCTCTGAATTAGACTTTTAGG - Intronic
1091207187 11:133829914-133829936 TTGGTTTGAGCCAAAATTGTTGG - Intergenic
1091821079 12:3475638-3475660 TTGGTCTGTAACAGAAGTGGAGG + Intronic
1092455518 12:8639264-8639286 ATGGTTTGAATCATAATGGTGGG + Intronic
1098651914 12:72981918-72981940 TTATTCTGAATCACAATTTTCGG - Intergenic
1098823040 12:75257478-75257500 TTGGTCTGAATAATAATAGACGG + Intergenic
1099852801 12:88123888-88123910 TTGGTCTGAACCAAAAGTTTTGG - Intronic
1101462508 12:104911164-104911186 TTGGTTTGGTTCAGAAATGTGGG - Intronic
1104131288 12:125896761-125896783 TTGTTCTGTATCTTAATTGTGGG + Intergenic
1108143315 13:47449334-47449356 TTGGTCTGAATCAAGAGTATGGG - Intergenic
1110505959 13:76286291-76286313 TTGGTGTGAGTCAAAAGTGTGGG - Intergenic
1112167989 13:96940570-96940592 GTGGGCTGAATCACAATTGAGGG - Intergenic
1112690375 13:101886626-101886648 TTGGTCTGAGCAAGAATTTTGGG + Intronic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1114857906 14:26473779-26473801 TTGGTTTGACTCACTATTGTAGG - Intronic
1116533568 14:46003324-46003346 TTGGTCTGTATCAGAAATTGCGG - Intergenic
1117786756 14:59293742-59293764 TTGGTCTGAAACTGAATTTTTGG + Intronic
1117947666 14:61046496-61046518 TTAGTCTAATTCAGAAGTGTGGG + Intronic
1120707404 14:87759091-87759113 TTTCTCTGAATCAGCATTCTGGG - Intergenic
1121898179 14:97668336-97668358 TGGGTCTGACTAAGATTTGTAGG - Intergenic
1125187127 15:36943933-36943955 TTGGTCTGAATCTAAATTTCTGG + Intronic
1126124718 15:45284940-45284962 TTGGTTTGGTTCAGAATGGTGGG - Intergenic
1127662946 15:61117212-61117234 TTTGTTTTAATCAGATTTGTTGG - Intronic
1128289104 15:66463213-66463235 TTTGTCTGAATCAGACTGGAAGG + Intronic
1128444728 15:67748761-67748783 TTGGCCAGAATCAGAAGAGTGGG - Intronic
1129534438 15:76300580-76300602 TTGGTAGGAAGCAGAATTGTAGG - Intronic
1130555716 15:84921139-84921161 TTGGACTGAATCAGAGCTCTGGG - Intronic
1132211446 15:100026085-100026107 ATGGTAGGAGTCAGAATTGTTGG - Intronic
1140950188 16:79809550-79809572 TTGGTCTGAATTATAACTGCTGG - Intergenic
1146773745 17:35593137-35593159 TTGGGCTAAATCTGGATTGTTGG + Intronic
1150059727 17:62055937-62055959 TTAGTGTTAATGAGAATTGTGGG - Intronic
1153184235 18:2469256-2469278 CTGGGCTGAATCAGAATGCTGGG + Intergenic
1155868959 18:31002202-31002224 TTATTCTAAATCATAATTGTGGG + Intronic
1156716430 18:40017880-40017902 CTGTTCTGAATCAGAAGAGTGGG - Intergenic
1156733505 18:40224795-40224817 TTGGACTGAATATGTATTGTAGG + Intergenic
1157448948 18:47771422-47771444 CTGGTCAGAAATAGAATTGTTGG - Intergenic
1158788455 18:60744627-60744649 ATGGTATGACTCACAATTGTAGG - Intergenic
1159102123 18:63969347-63969369 TTGGCATGGATCAGAACTGTAGG + Intronic
1159793241 18:72810658-72810680 TGTGTCTTAAGCAGAATTGTAGG - Intronic
1160233593 18:77067864-77067886 TAGGTCTGAATCAGACTTCAGGG - Intronic
1162607747 19:11724059-11724081 TTGGTCAGAAAAAGAATTATTGG + Intronic
1163335368 19:16667906-16667928 TTCATTTAAATCAGAATTGTGGG + Intronic
926384351 2:12321478-12321500 TTGCTGTGAGTCAGAAGTGTGGG + Intergenic
927597137 2:24406745-24406767 ATGCACTGAATCAGAATTCTTGG + Intergenic
928723480 2:34146445-34146467 TATGTCTGAATTAGAATTGAAGG + Intergenic
930848491 2:55932166-55932188 TTGGTTTAAATAAAAATTGTAGG + Intergenic
935367136 2:102306648-102306670 TTTGTCTGAATATGAACTGTAGG - Intergenic
937331596 2:121033907-121033929 CTGGGCTGAATCTGAATTGAGGG + Intergenic
939192013 2:138927812-138927834 TTGGAGTGAATCATAATTTTAGG - Intergenic
939926241 2:148177334-148177356 TAGTTCTGAACCAGAACTGTGGG + Intronic
942501276 2:176593305-176593327 TTGATCTGAAAGAGAATTGTGGG + Intergenic
942854859 2:180532830-180532852 TTTTTCTGAAACAGAAGTGTGGG - Intergenic
945983585 2:216336833-216336855 TTTATTTGAAGCAGAATTGTTGG - Intronic
1172855795 20:38001361-38001383 TTGGACTGACTCAGATATGTAGG + Intronic
1178301216 21:31454777-31454799 TGGAGCTGAATCAGAATTGAAGG + Intronic
1182219362 22:28745697-28745719 TTGGACTGAAACAGAAATGCTGG - Intronic
950515608 3:13463112-13463134 TTGGTCTGAATCTCAAATGGAGG - Intergenic
951415687 3:22418907-22418929 TTTGTCTGAATCTAAATTGTGGG - Intergenic
952458972 3:33504525-33504547 TTGGGCTAAGACAGAATTGTAGG - Intronic
952482832 3:33779547-33779569 TTGGTCAGAATGAGAATCATGGG + Intergenic
955196774 3:56811701-56811723 TTTGGTTTAATCAGAATTGTGGG - Intronic
956651148 3:71505778-71505800 TTCTTCTGAATCACAACTGTGGG + Intronic
959933961 3:112011079-112011101 TTGGTCTGATTCTAAATTGCAGG + Intronic
960504211 3:118473193-118473215 GTGGTCAGAATTAGAATTGTTGG - Intergenic
961214914 3:125151856-125151878 TTGGTGTGAATTAAAATTGATGG + Intronic
963211555 3:142698157-142698179 TTGGTCTGAATCAGAATTGTGGG - Intronic
963385130 3:144582956-144582978 TTTGGCTGAATCATAATTGTAGG + Intergenic
964296850 3:155242574-155242596 TTAGAATGAATCAGAATAGTTGG + Intergenic
965151216 3:164977811-164977833 TTGGTCTGAGTGAGAAATTTTGG - Intergenic
966149756 3:176854338-176854360 TTGGTCTGACTCCGAAATATAGG - Intergenic
970383183 4:15529019-15529041 TGTATCTGAATCAGAATTGCTGG - Intronic
970757267 4:19441993-19442015 TTATTTTGAATCAAAATTGTTGG + Intergenic
972094921 4:35336305-35336327 ATGTTTTGAATCAGAATTGATGG + Intergenic
974052620 4:56955215-56955237 ATTTTCTTAATCAGAATTGTGGG + Intergenic
976781890 4:88769381-88769403 TGGCTCTGAATCAGAATACTTGG + Intronic
979042012 4:115810526-115810548 TTGATTTGTATCAGAATTGTGGG - Intergenic
981017979 4:139994166-139994188 TTGGAATGAAACAGAATTTTGGG - Intronic
982289355 4:153764293-153764315 TTGGTCTGATTCCCAACTGTCGG + Intergenic
984012717 4:174389892-174389914 TTAGTCTCAAGCAGAATTTTTGG + Intergenic
985118894 4:186619644-186619666 TGGTTCTGAATCAGAATCGGTGG + Exonic
985175300 4:187194037-187194059 TGGGTCTGTATCATAATTGGTGG - Intergenic
987111131 5:14688117-14688139 TTTTTCTGAAACAGAATTGTAGG + Intronic
987748719 5:22010861-22010883 ATGCTCTGATTCAGAATTTTGGG + Intronic
988048009 5:25984510-25984532 TTGGACTGGCTCAGAATTTTTGG + Intergenic
988492182 5:31714231-31714253 TAGGGCTGAAGCAGAACTGTGGG + Intronic
988819057 5:34862744-34862766 TGGCTGTGAATCAGAATTATTGG - Intronic
990765974 5:59183181-59183203 TTGGTTTGAATCAGTAATGGAGG + Intronic
991768907 5:70020642-70020664 ATGCTCTGATTCAGAATTTTGGG + Intergenic
991848203 5:70896065-70896087 ATGCTCTGATTCAGAATTTTGGG + Intergenic
993077758 5:83255591-83255613 TTGCCCTGAAACAAAATTGTAGG - Intronic
995740755 5:115353735-115353757 TTGGTTTGATCCAGAATGGTGGG + Intergenic
996268079 5:121567523-121567545 ATATTCAGAATCAGAATTGTTGG - Intergenic
997160546 5:131604756-131604778 TTGCTTAAAATCAGAATTGTGGG - Intronic
998538445 5:142956070-142956092 TTGGTATTAAGCATAATTGTGGG + Intronic
998910729 5:146957251-146957273 TTGATCTAAATCAGAATTGCTGG - Intronic
999944844 5:156583774-156583796 TGAGTCTGACTCAGACTTGTAGG - Intronic
1003343219 6:5241875-5241897 TTGGCCTGACTCAGAAATATTGG + Intronic
1008870193 6:56263689-56263711 TTTGCCTAAAACAGAATTGTGGG - Intronic
1014942899 6:127464375-127464397 ATGGTCTGAGTCAGAAGTCTGGG - Intronic
1015585819 6:134775193-134775215 TTGCTCTGAATCCAAATTTTAGG - Intergenic
1016660876 6:146578349-146578371 TTGGTGTGAATCAAAACTGAAGG + Intergenic
1017063768 6:150509693-150509715 TTTGTCTGCATTAAAATTGTCGG + Intergenic
1023505497 7:40896106-40896128 TTTGTTTGAATCAGATTTTTTGG - Intergenic
1024164924 7:46721469-46721491 TTGGGCTAACTCAGGATTGTAGG - Intronic
1027736464 7:81938622-81938644 TTTTTTTGAATCAGAATTCTGGG - Intergenic
1028453809 7:91016622-91016644 CAGGTCTTAAGCAGAATTGTAGG + Intronic
1033231671 7:139603174-139603196 TAGGTCAGAATAAGAACTGTGGG + Intronic
1037744833 8:21634598-21634620 GTGGTCCGAATCAGAATTTTGGG + Intergenic
1040379770 8:46861156-46861178 TTTGTCAGAATCTGATTTGTGGG - Intergenic
1045325547 8:101115052-101115074 TTGGTGAGATTCAGATTTGTGGG + Intergenic
1047659873 8:127021544-127021566 TTGGTGTGATTCAAAATTGTAGG - Intergenic
1048920969 8:139229808-139229830 TTATTCTGAATCAGGATTTTAGG + Intergenic
1053064925 9:35061372-35061394 TTAGAGTAAATCAGAATTGTTGG - Intronic
1055042566 9:71891106-71891128 TAGGTCTGCTTCAGAATTATAGG + Intronic
1055181312 9:73390190-73390212 TTTGTATTAATAAGAATTGTTGG + Intergenic
1057326137 9:94065940-94065962 TTTGTCTGACTCAGACTTGTTGG - Intronic
1057801516 9:98193901-98193923 AAGGTCTGAATCAGAGCTGTAGG - Intergenic
1058394796 9:104538944-104538966 TTGGTCAAAATCACAAATGTAGG + Intergenic
1059800243 9:117742840-117742862 ATGGGCAGAATTAGAATTGTGGG + Intergenic
1060064481 9:120491790-120491812 TTGTTTTGACTCATAATTGTGGG - Intronic
1062200932 9:135302240-135302262 TTAGCCTGAATCAAAATAGTCGG + Intergenic
1186944968 X:14555783-14555805 TTGTTCTGAATCAGATTTCCTGG + Intronic
1189150236 X:38699290-38699312 GTAGTCTGAATCAGCAGTGTGGG + Intergenic
1193646333 X:84073458-84073480 TTGGTTTGGATAAGAATTTTTGG + Intronic
1194227205 X:91275633-91275655 TTGGTCTGAAACAGCTATGTGGG - Intergenic
1196389628 X:115193704-115193726 TTGGTCTGGATAACCATTGTAGG + Intronic
1196895520 X:120331832-120331854 CGGGTCTGTAGCAGAATTGTGGG + Intergenic
1197274151 X:124458720-124458742 TTTCTCTCAATCAGAATTCTTGG - Intronic
1198265386 X:135004142-135004164 GGGGTCTGAATCAGAAAGGTGGG - Intergenic