ID: 963217656

View in Genome Browser
Species Human (GRCh38)
Location 3:142767791-142767813
Sequence GAATGACATCTTTTGCTTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 1, 2: 1, 3: 11, 4: 211}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963217652_963217656 11 Left 963217652 3:142767757-142767779 CCCTACGGATGTACCTGTTCTGG 0: 1
1: 0
2: 0
3: 11
4: 94
Right 963217656 3:142767791-142767813 GAATGACATCTTTTGCTTAATGG 0: 1
1: 1
2: 1
3: 11
4: 211
963217655_963217656 -2 Left 963217655 3:142767770-142767792 CCTGTTCTGGATATTTCATATGA 0: 3
1: 52
2: 415
3: 1509
4: 2689
Right 963217656 3:142767791-142767813 GAATGACATCTTTTGCTTAATGG 0: 1
1: 1
2: 1
3: 11
4: 211
963217654_963217656 10 Left 963217654 3:142767758-142767780 CCTACGGATGTACCTGTTCTGGA 0: 1
1: 0
2: 0
3: 15
4: 110
Right 963217656 3:142767791-142767813 GAATGACATCTTTTGCTTAATGG 0: 1
1: 1
2: 1
3: 11
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963217656 Original CRISPR GAATGACATCTTTTGCTTAA TGG Intronic
904407039 1:30298702-30298724 GAATGTCAACTTTTACTGAACGG - Intergenic
904655514 1:32042970-32042992 AAATGACATTGCTTGCTTAAAGG + Exonic
905475875 1:38227687-38227709 GAATTTCAACTTTTACTTAAGGG - Intergenic
906062029 1:42955110-42955132 GAATGCCAGCTTTTGGATAAAGG + Intronic
908474441 1:64473611-64473633 GAATGTCTTCCCTTGCTTAAGGG + Intronic
908776701 1:67647559-67647581 GATTGACAGCATTTGCTGAAAGG - Intergenic
910030274 1:82712334-82712356 GAATGCAATATTTTCCTTAAGGG - Intergenic
910975831 1:92904482-92904504 CATTGCCATCTTTTGCTTATAGG - Intronic
911399439 1:97356760-97356782 AAAGGACATCTTTTCATTAAAGG - Intronic
916022523 1:160806379-160806401 AAATGTCATCTTTTGCTTCTGGG + Intronic
916702229 1:167308963-167308985 GAATTATAACTATTGCTTAAAGG - Intronic
916792844 1:168138531-168138553 GAAGGACATCTTTCGCATCATGG - Intergenic
917415176 1:174801715-174801737 GAACCTCATCTTTTTCTTAAAGG + Intronic
918656870 1:187037738-187037760 GAAAGATATCTTTGGGTTAAAGG + Intergenic
919254745 1:195106320-195106342 GAATAACACCTTTTGCTTCTAGG + Intergenic
920515337 1:206581013-206581035 GGACGGCATCTTTTGCTGAAGGG - Intronic
920796758 1:209145237-209145259 GAATGACATGATTAGGTTAAAGG + Intergenic
1063124588 10:3127399-3127421 GAATGACATCAACCGCTTAATGG - Intronic
1063903857 10:10763238-10763260 AAATGACCTCTTTTGCGTAAAGG - Intergenic
1068310699 10:55270964-55270986 GAATGAAATCATGTGCTTCACGG + Intronic
1070203697 10:74233721-74233743 GAAAGAAATCATTTGTTTAATGG - Intronic
1070383112 10:75899603-75899625 GGAAGACATCTTTAGCTGAATGG - Intronic
1071109274 10:82136189-82136211 GAATGACCTCATTTGTTTGAGGG - Intronic
1078094966 11:8291174-8291196 AAAGTACTTCTTTTGCTTAATGG + Intergenic
1078588416 11:12615798-12615820 TAATGACTTCTTTTCCTTATGGG - Intergenic
1082880823 11:58035622-58035644 GAAAGACATATTTTCCTTAGGGG + Intronic
1082888415 11:58112590-58112612 GATTGACCTCTTTTGCCTAGAGG + Intronic
1083358757 11:62089818-62089840 AAATGACATATTTGGCTTATTGG + Intergenic
1083382980 11:62282262-62282284 AAATGACATATTTGGCTTATGGG + Intergenic
1083910149 11:65703005-65703027 GAATGGGAAGTTTTGCTTAATGG + Intergenic
1085377401 11:76077976-76077998 GAGTGACATCTTTTGCTGGGAGG + Intronic
1087040817 11:93798027-93798049 GATTTACATCTTTTTCTTGAGGG + Intronic
1087249744 11:95884507-95884529 GAATGAAATCATGTGCTTAGTGG - Intronic
1087260904 11:96011225-96011247 GAATGACTTATTTTCCTTTAAGG - Intronic
1092673998 12:10896229-10896251 CAATGCCATCTTTTGCTTAAAGG + Intronic
1092911543 12:13149445-13149467 GAATGACCTCTTTGATTTAAGGG - Intergenic
1092937526 12:13377946-13377968 GAATGACATCATAGGGTTAACGG + Intronic
1097417453 12:59329229-59329251 GAAAGACATCTTTTGATTTCAGG - Intergenic
1098230790 12:68370223-68370245 GAATGACATCTGGTGGTTTATGG - Intergenic
1098384558 12:69904938-69904960 GAATGTCCTCCTTTGCTTAGAGG + Intronic
1099395722 12:82136053-82136075 GAATAAGAGCTTATGCTTAAGGG + Intergenic
1101543960 12:105692471-105692493 GAATGACATCGATAACTTAATGG + Intergenic
1101998074 12:109539323-109539345 GAATGGCATCCTTTGCTTCACGG + Intergenic
1102531798 12:113552118-113552140 GGATGACTTCTTTTTTTTAAGGG + Intergenic
1102805085 12:115772747-115772769 GATTGGCATATTTTTCTTAAAGG - Intergenic
1102927810 12:116839834-116839856 GAGTGACATATTGAGCTTAAAGG - Intronic
1103977658 12:124713989-124714011 GAATGACAGTTATTGCTTAATGG + Intergenic
1106077300 13:26471908-26471930 GAGTGACCTCTCTTCCTTAAAGG - Intergenic
1106748599 13:32732146-32732168 GAATGGCATATTTGGCTTGACGG - Exonic
1108618093 13:52155629-52155651 CAATTACATCTTTTGCATGAAGG + Intronic
1108807829 13:54181581-54181603 GAATGACATCATGTCCTTAGTGG - Intergenic
1110761922 13:79240366-79240388 AAATGACATGCTCTGCTTAAGGG + Intergenic
1115676798 14:35685169-35685191 GAATAAAAGCTTTTTCTTAATGG - Intronic
1116229527 14:42198652-42198674 GAATATCATCTTTTGTTGAACGG - Intergenic
1118723662 14:68611348-68611370 CCATGACATCCTTTGCTGAAAGG - Intronic
1119837099 14:77760448-77760470 GAAAAGCATCTTTTTCTTAAAGG + Intronic
1120910595 14:89663297-89663319 TAATGCCATCTTTTTCTTTAAGG + Intergenic
1127053685 15:55110983-55111005 CAATGACATCTTAGGTTTAATGG + Intergenic
1127071590 15:55292034-55292056 GAATGCTATCTTTTGCTTCCAGG - Intronic
1127148416 15:56049276-56049298 GAATGGCATTCTTTGCTTCAGGG + Intergenic
1130275490 15:82474059-82474081 GAATGTCATAATTTGCTAAAAGG - Intergenic
1130401901 15:83564418-83564440 GAATGAGATCTTTTTCTTTTGGG + Intronic
1130467850 15:84201454-84201476 GAATGTCATAATTTGCTAAAAGG - Intergenic
1130496415 15:84472088-84472110 GAATGTCATAATTTGCTAAAAGG + Intergenic
1130590142 15:85206052-85206074 GAATGTCATAATTTGCTAAAAGG - Intergenic
1131374455 15:91912148-91912170 GAATGACTGCCTTTACTTAATGG - Intronic
1131420049 15:92297884-92297906 GGATGACATATTTTGCTTTGGGG - Intergenic
1134405049 16:13949645-13949667 GAATGAGATTTTTTTCTTTATGG - Exonic
1134629604 16:15747435-15747457 GAATGACAGCCTTTTCTTGAAGG - Intronic
1137470658 16:48754050-48754072 GAATGACATCTTGTCATTTATGG + Intergenic
1137704463 16:50524826-50524848 GAATGGCAAATTTTGCCTAAAGG - Intergenic
1138209079 16:55147784-55147806 GAATGATATGTTTTGCTGGAAGG - Intergenic
1144217571 17:13069802-13069824 GAATAACATCGTTTCCTTCAAGG + Intergenic
1145873610 17:28297906-28297928 AAATGTCAGCTTTTGTTTAAGGG + Intergenic
1147757489 17:42778657-42778679 GAATGACACCATCTGCTTCAGGG - Intronic
1148234607 17:45960215-45960237 GAATGTTCTCTTTTGCTTCAAGG + Intronic
1149020701 17:51961016-51961038 GAATGTCTTCTTCTGCTTCAGGG - Intronic
1149135084 17:53354498-53354520 GCATGACATTTTTAGCTTACTGG + Intergenic
1150175631 17:63052098-63052120 GAATGACATCTTTCAGTAAAAGG + Intronic
1152188314 17:78872612-78872634 AAATGACATCATTTGCCAAAAGG + Intronic
1155973072 18:32100022-32100044 CAATTATATCTTTTGGTTAAGGG + Intronic
1156190269 18:34711113-34711135 AAATGAACTCTTTTGCTTAGAGG + Intronic
1158118236 18:54020638-54020660 GAATGAAATATTTTGGTTACTGG - Intergenic
1158794401 18:60825514-60825536 GAATTTCATTTTTGGCTTAATGG + Intergenic
1159241457 18:65748916-65748938 GAAAAATATCTTTTTCTTAAAGG + Intergenic
1160089240 18:75810647-75810669 GAATGACATCATGTGTTCAATGG + Intergenic
927729214 2:25455686-25455708 GAAGGACTGCTTTTGTTTAAAGG - Intronic
928255358 2:29717446-29717468 GAAAGACTTCTTTTGCATATAGG + Intronic
929123640 2:38503508-38503530 GAAAGGCATCCTTTGCTTCAGGG - Intergenic
929352648 2:40977554-40977576 GAATGACATCTTTTTCAATATGG - Intergenic
929649038 2:43659385-43659407 GAATAACATCTATTTTTTAAAGG - Intronic
930758244 2:55001834-55001856 AAATGGCTTCTTTTGCTTTATGG - Intronic
930837042 2:55805378-55805400 AAATTCCATCTTTTTCTTAAAGG - Intergenic
930979039 2:57499184-57499206 GAATGACAATTTTTGTTTTATGG - Intergenic
931461482 2:62454023-62454045 GAAGGAACTCTTTTACTTAAAGG + Intergenic
932334439 2:70922013-70922035 GAATGACATCATCTGCTTCTTGG - Intronic
935165644 2:100566526-100566548 GAATGACATCTTACGCAAAAAGG + Exonic
935546831 2:104408631-104408653 GTGTGACATCATTTGTTTAAAGG + Intergenic
935851807 2:107229843-107229865 TAATGACTTCTTTTGCTTTGGGG + Intergenic
937894209 2:126965359-126965381 AAATTACATTTTTTTCTTAAAGG - Intergenic
938308632 2:130270342-130270364 GAATGCCATCTAATGCTTTAGGG - Intergenic
939038141 2:137157404-137157426 GAAGGACATCTTGTTCTTATGGG + Intronic
943221577 2:185114941-185114963 GAATTACTTCTGTTGCTTGAAGG + Intergenic
947887581 2:233586060-233586082 GAACCACATCTTCTTCTTAAAGG + Intergenic
1173619871 20:44428773-44428795 CAATGACCACTTTTACTTAATGG - Intronic
1173969654 20:47142455-47142477 GAATGACTTCGTTTGTATAATGG + Intronic
1174523108 20:51148313-51148335 GAATTACATATTTTAATTAAGGG + Intergenic
1177054322 21:16281191-16281213 GTATGACATCTTTAGGTTCAGGG + Intergenic
1178037185 21:28598325-28598347 GAATGACATGTTTTGCTTTGAGG + Intergenic
1179024768 21:37670811-37670833 GAATAACATCCTGTGCTTATAGG - Intronic
1180688442 22:17689306-17689328 GAATGACAGCTTTGCTTTAAAGG + Intronic
1181912853 22:26254227-26254249 GAATGAAATCCTTTGGTCAAAGG - Intronic
1183609831 22:38892355-38892377 GAATTACAAATTTTACTTAATGG + Intergenic
951296428 3:20941662-20941684 AAATGACATTTTTTTCTTATTGG - Intergenic
952404470 3:32993084-32993106 AAATGACTTCTTTTTCATAAAGG + Intergenic
952619158 3:35315209-35315231 GAATGACAGCTTTTGAAGAATGG - Intergenic
953567776 3:44047908-44047930 GAATGATATCTTCTGATTACTGG + Intergenic
953844561 3:46417082-46417104 CAATGCCATGTTTTGCTTATGGG - Intergenic
955123890 3:56090175-56090197 GAAGGACATTTTTTTCTGAAAGG - Intronic
956619690 3:71209125-71209147 GACTGACCTCTTTTTCTTAAAGG - Intronic
957119837 3:76075688-76075710 TGATGACATCTCTTCCTTAATGG + Intronic
960045877 3:113197695-113197717 GAATGGCAACTCTTCCTTAAAGG - Intergenic
962195660 3:133361088-133361110 GAAAGACAACTTATCCTTAAAGG - Intronic
962634101 3:137312495-137312517 GCATGACACATTTTGGTTAATGG + Intergenic
963217656 3:142767791-142767813 GAATGACATCTTTTGCTTAATGG + Intronic
964681761 3:159347862-159347884 AAATGACATCTTTTTTTGAAAGG - Intronic
965073756 3:163950705-163950727 GAATGAAAACTTTTGCATGAAGG + Intergenic
965545527 3:169911901-169911923 AAAGGACATCTTTATCTTAAAGG + Intronic
966955049 3:184867908-184867930 GTATGAAATGTTTTACTTAAAGG + Intronic
967425715 3:189324919-189324941 GAGTGACTTCTTATGCTTAGTGG + Exonic
967693905 3:192508975-192508997 GTATGACACCTTTTGCTTATAGG + Intronic
969274022 4:6123037-6123059 AAGTGACATCTTTCGTTTAAAGG - Intronic
971558750 4:28047342-28047364 GAATGGAATCTGTTGCTTGAAGG - Intergenic
971697119 4:29920377-29920399 TAATGTCCTCTTTTCCTTAATGG - Intergenic
973167794 4:47098932-47098954 GAATAACATCTTTTCAATAATGG - Intronic
973185399 4:47321846-47321868 GAATTGTATCATTTGCTTAAAGG + Intronic
973218937 4:47703754-47703776 GAAAAACGCCTTTTGCTTAAAGG + Intronic
973877771 4:55238284-55238306 CAATTACATCTTTAGCATAAAGG - Intergenic
976187199 4:82453809-82453831 AAAAGACATCTTTTGCTGACTGG + Intronic
977630461 4:99237173-99237195 GAATAGCATAATTTGCTTAATGG + Intergenic
979049959 4:115918056-115918078 GAATGATATTTTGTGCTCAAAGG + Intergenic
979560955 4:122101785-122101807 GAATGTCAACTTTCGCTTAGAGG + Intergenic
980275518 4:130645473-130645495 GAATGACTTCTTATTCTGAAAGG - Intergenic
984013954 4:174404228-174404250 GAAAGAATTCTTGTGCTTAAGGG - Intergenic
984772525 4:183449987-183450009 GAATGAGATTTTTTTTTTAATGG + Intergenic
986684442 5:10263844-10263866 GAATGACAGCTTTTGCTTAAAGG + Intronic
988718657 5:33854038-33854060 GCTTGACATATTTTGCATAAAGG - Intronic
989475918 5:41872473-41872495 GAATCAGACCTTTTGTTTAAAGG - Intergenic
989568236 5:42922828-42922850 GAAGGACATCTTGTGCTAGATGG - Intergenic
989777274 5:45225013-45225035 GAATGTCATCTTATCCTTGAAGG - Intergenic
991179766 5:63736328-63736350 CAATGGCATCATTTCCTTAAAGG + Intergenic
991444259 5:66682754-66682776 GCAAGACCTCTTTTTCTTAAGGG - Intronic
992387075 5:76294947-76294969 GAATGACCTCTTTTGCTAATGGG - Intronic
993788223 5:92171551-92171573 GAACCACATTTTTTGCTTTATGG - Intergenic
994338440 5:98597635-98597657 TTATGACATCTTTTGTTCAAGGG + Intergenic
996232187 5:121079472-121079494 AAATGACATCTTTTATTCAAAGG - Intergenic
998545633 5:143025019-143025041 GATGGACATCCTTTGCTCAATGG + Intronic
999878685 5:155836869-155836891 GTGTGACATCTTTATCTTAAGGG + Intergenic
1004067572 6:12263989-12264011 GAATGAAATTTTTTTCTCAATGG - Intergenic
1004299307 6:14442771-14442793 GGATGACAGCTTTGGCATAAAGG + Intergenic
1004543213 6:16571452-16571474 GAATGACATCTTTTGTAGAGCGG - Intronic
1004757012 6:18621319-18621341 GAATGACAACTTCTAATTAAGGG - Intergenic
1005343589 6:24867251-24867273 TGATGACATCTTTTGGTTGATGG + Intronic
1005629276 6:27692741-27692763 GAATGACAGGTTTTGCTTTAAGG + Intergenic
1006770026 6:36545600-36545622 TAATTACATCTTTTGATTAAAGG - Intronic
1008438043 6:51499045-51499067 CAATGACCTACTTTGCTTAAAGG - Intergenic
1008558610 6:52700793-52700815 CAATTTTATCTTTTGCTTAAAGG + Intergenic
1010475822 6:76286286-76286308 GAAAAACTCCTTTTGCTTAAAGG - Intergenic
1012341605 6:98131987-98132009 GTATGCAATCTTTTTCTTAATGG + Intergenic
1013889233 6:115006110-115006132 GTATGTCATTTTTTACTTAAAGG + Intergenic
1013953481 6:115813495-115813517 TAATGTTATCTTTTGCTAAATGG - Intergenic
1014033793 6:116741347-116741369 GAATTACATCTTTTTTTTTAAGG + Intronic
1014974176 6:127858085-127858107 GAATGTCATCTTTCTTTTAAAGG + Intronic
1015937216 6:138415938-138415960 GAGGGACACCTTTTGCTTCATGG - Exonic
1016236815 6:141878021-141878043 GAGAGACAGCTTTGGCTTAAGGG + Intergenic
1017098642 6:150827692-150827714 GAATGACATCTTACGCAAAAAGG + Intronic
1018328817 6:162705480-162705502 GACTGGTATCGTTTGCTTAATGG - Intronic
1021115353 7:16740751-16740773 GAATGATTTCTTTTGTTGAAGGG + Intergenic
1024002787 7:45202082-45202104 GAAGGACATTTTTTGATTACTGG + Intergenic
1024682115 7:51702514-51702536 GAAAGACCTCTTTTATTTAAAGG - Intergenic
1024736874 7:52314760-52314782 GAAAGACATCTTGTGCTTATTGG + Intergenic
1024885276 7:54135001-54135023 GAATGAAATCTTTATATTAAAGG + Intergenic
1028267632 7:88747039-88747061 GACTGTAGTCTTTTGCTTAAAGG - Intergenic
1028490301 7:91404022-91404044 GAATGACAACTTTGGTTTCAAGG - Intergenic
1028714816 7:93953198-93953220 GAATGACATCTTTCCCTCTAGGG + Intergenic
1028848556 7:95510962-95510984 GTCTGATATCTTTTGCTAAATGG - Intronic
1029543142 7:101196334-101196356 GAATGACATCTTTAGACTTAAGG - Exonic
1030176796 7:106661749-106661771 GTATGACATGTTTTGCTTTCTGG - Intergenic
1030426807 7:109388114-109388136 GAAAGACAACTTTTGCTTGGAGG - Intergenic
1030523374 7:110625641-110625663 GAATGATGTCTTTTGCTACATGG - Intergenic
1030759035 7:113328087-113328109 GACTGGAATCTTTTGGTTAATGG + Intergenic
1031083036 7:117276794-117276816 GAATGTCATCTTTTGGCTGATGG + Exonic
1033815409 7:145065709-145065731 GGATGACATATTTGGCATAAGGG + Intergenic
1036294358 8:7523495-7523517 GAATGACATCCTGAGCTCAAGGG + Intergenic
1036328204 8:7797496-7797518 GAATGACATCCTGAGCTCAAGGG - Intergenic
1037062611 8:14533747-14533769 GAAAGATATATTTTGGTTAATGG - Intronic
1037284328 8:17281943-17281965 GAATGAAATCTTTTTAATAATGG - Intronic
1038176865 8:25188141-25188163 GAATGAGATGTTATGCCTAATGG - Intronic
1038248353 8:25880268-25880290 TAATCACATCTTTTGCTTGATGG + Intronic
1038853114 8:31299608-31299630 GAATGACAAATTTTGTTAAATGG + Intergenic
1039970299 8:42316318-42316340 GGATGACATCTTAAACTTAAAGG + Exonic
1040875243 8:52143964-52143986 AAATTACTTCTTTTGCTAAATGG + Intronic
1043822539 8:84885970-84885992 GAATGACTTAATGTGCTTAAAGG + Intronic
1043848053 8:85183753-85183775 GAATGGAATTTGTTGCTTAATGG + Intronic
1044064235 8:87680255-87680277 TAATGATATCTTTTTCTTGATGG - Intergenic
1044777766 8:95711066-95711088 TAATGACAGCTTTAGATTAAAGG - Intergenic
1046831699 8:118753225-118753247 CAATGAAATCTTTGGCCTAAGGG - Intergenic
1048594775 8:135854702-135854724 TAATGACATTTGTTCCTTAAAGG - Intergenic
1048774199 8:137927161-137927183 AAATGACATAATTTGCTTGAGGG - Intergenic
1051069072 9:13140678-13140700 GAATGACATTTTTTTCTAGAAGG - Intronic
1056871132 9:90280388-90280410 GAATTGCATCTTTTACCTAAGGG - Intergenic
1059297461 9:113284405-113284427 CAATGACATTTTTTCCTAAATGG + Intronic
1060306558 9:122418148-122418170 GAATGGCATGTTTTCCTTTAAGG - Intergenic
1061657011 9:132099947-132099969 GAGGGACATCTTTAGCTTAGTGG + Intergenic
1062719448 9:138029261-138029283 GAATGTCTTCTTGTGCTCAAGGG + Intronic
1186875620 X:13814424-13814446 GAATAAAATCCTTTGCTGAAAGG + Intronic
1187718649 X:22129455-22129477 GATTGAGACCTTCTGCTTAAAGG - Intronic
1193571036 X:83143751-83143773 GAATGAGAGTTCTTGCTTAATGG + Intergenic
1194752296 X:97698456-97698478 GAATGACAACTTTAGTTTAGGGG - Intergenic
1195609071 X:106843830-106843852 GAAAGACATCTTGTGTTTATGGG - Intronic
1195641606 X:107181705-107181727 AAATGACATCTTTATCTTATAGG + Intronic
1196633492 X:117972380-117972402 GGATGACTTCTTTTGTGTAATGG - Intronic
1198940485 X:141950592-141950614 CATTTACATCTTTTGCTTGAAGG - Intergenic
1201181360 Y:11350427-11350449 TAATGACATGTTTTCCTTTAAGG + Intergenic
1201503255 Y:14669054-14669076 GAATGACATTTTGTCCTCAAAGG - Intronic