ID: 963221595

View in Genome Browser
Species Human (GRCh38)
Location 3:142818971-142818993
Sequence ACTGAGAAGCCATCTGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 264}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963221595_963221601 10 Left 963221595 3:142818971-142818993 CCATCCTCAGATGGCTTCTCAGT 0: 1
1: 0
2: 2
3: 25
4: 264
Right 963221601 3:142819004-142819026 GTCTGGATTTTCCTGGCATTTGG 0: 1
1: 0
2: 0
3: 15
4: 174
963221595_963221597 -7 Left 963221595 3:142818971-142818993 CCATCCTCAGATGGCTTCTCAGT 0: 1
1: 0
2: 2
3: 25
4: 264
Right 963221597 3:142818987-142819009 TCTCAGTCCCATCATGTGTCTGG 0: 1
1: 0
2: 0
3: 13
4: 154
963221595_963221600 3 Left 963221595 3:142818971-142818993 CCATCCTCAGATGGCTTCTCAGT 0: 1
1: 0
2: 2
3: 25
4: 264
Right 963221600 3:142818997-142819019 ATCATGTGTCTGGATTTTCCTGG 0: 1
1: 0
2: 1
3: 17
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963221595 Original CRISPR ACTGAGAAGCCATCTGAGGA TGG (reversed) Intronic
901227578 1:7623043-7623065 CTTGAGAAGGCCTCTGAGGATGG - Intronic
901558273 1:10048822-10048844 ACTGGGAAGCCATCTGTAGTTGG + Intronic
901669446 1:10847074-10847096 ACGGTGCAGCGATCTGAGGAGGG - Intergenic
901671000 1:10856448-10856470 ATTAACAAGCCATCTGAGGCGGG + Intergenic
902298433 1:15484233-15484255 ACTGAGAACCCGGCTGAGGGTGG + Intronic
902556742 1:17251190-17251212 TCTGAGAAGCCAGCAGAGGCTGG + Intronic
902719207 1:18292836-18292858 AGTGAGATTCCCTCTGAGGAGGG - Intronic
903896268 1:26607489-26607511 AGTGAGAAGCCATTAGAGAATGG - Intergenic
904814939 1:33188730-33188752 ACTGAGAAGCCATGGTAAGAGGG - Intergenic
905930459 1:41783258-41783280 AGTGAGAAGCCACAGGAGGAAGG + Intronic
906223980 1:44105982-44106004 AGTGAGATCCCATCTCAGGAAGG + Intergenic
906557188 1:46723147-46723169 GCTGAGAACCCATCTCAGGGAGG + Intergenic
906672763 1:47668669-47668691 ACTGATAAAAAATCTGAGGATGG + Intergenic
907588245 1:55640926-55640948 TCTGAGAAGGCAGCTGAGGTTGG + Intergenic
913674526 1:121128663-121128685 AGTAAGAAGCCATGTGAAGATGG + Intergenic
914026309 1:143915972-143915994 AGTAAGAAGCCATGTGAAGATGG + Intergenic
914664746 1:149823725-149823747 AGTAAGAAGCCATGTGAAGATGG + Intergenic
914671019 1:149870093-149870115 AGTAAGAAGCCATGTGAAGATGG - Intronic
915450407 1:156001282-156001304 ACTGAGAAGCTTTCTGAGTCTGG + Intronic
915993076 1:160536940-160536962 AATCAGAAGCCATCTGACAATGG - Intergenic
916431399 1:164732338-164732360 ACTGAGAATCCATGTGAAGTTGG - Intronic
916445865 1:164871291-164871313 ACTGAGGAGACCTCTGAGGGAGG + Intronic
916631158 1:166613933-166613955 GCTGAGAAGAGATCTGGGGAAGG + Intergenic
918450210 1:184650371-184650393 ACACAGCACCCATCTGAGGACGG - Intergenic
921063578 1:211607119-211607141 ACTCAGAAGCCATCTCTGCATGG + Intergenic
921360861 1:214329989-214330011 ACTGAGCAGCCACCTGACGTTGG - Intronic
922065441 1:222134652-222134674 AATGTGAAGCTATCAGAGGATGG - Intergenic
922787799 1:228291796-228291818 ACAGGGAAGCCATCTGAACATGG - Intronic
923114601 1:230923351-230923373 ACTAAGCTGCCATCTGGGGAGGG - Intronic
1062760423 10:12933-12955 ACTGAGAAGCCAGTTAGGGAGGG - Intergenic
1063547788 10:6999099-6999121 ACTGAGAAGCCATGTGCAGATGG - Intergenic
1066492457 10:35906835-35906857 AATGGGAAGCCATGTGAGGTGGG + Intergenic
1068816276 10:61318210-61318232 AGTGAGAAGCAAGCTGATGATGG + Intergenic
1070509424 10:77146986-77147008 ACTGTGAAGCCACCTGGGCATGG + Intronic
1070638682 10:78149913-78149935 AGTTAGAAGGCATCTGAGAATGG - Intergenic
1071361176 10:84847397-84847419 ACTGACTTGCCATCTGAGGCCGG + Intergenic
1072357410 10:94624893-94624915 ACACTTAAGCCATCTGAGGAAGG + Intergenic
1072752261 10:97990141-97990163 TCTGAGAATCCATCTGTGCATGG - Intronic
1076067561 10:127460814-127460836 ACTGTGAAGTCATCCTAGGAAGG + Intergenic
1076211265 10:128646866-128646888 AATGACAACCCAGCTGAGGAGGG + Intergenic
1076276063 10:129199794-129199816 ACTGAGCAGCCAGCCGAGGAGGG + Intergenic
1077980305 11:7293195-7293217 TCTGGGCAGCCTTCTGAGGAAGG + Intronic
1078562034 11:12380535-12380557 AGTGGGAAGCCATCAGAGCAAGG + Intronic
1079113068 11:17617416-17617438 ACAGTGAAGCCATCTGAGCCTGG + Intronic
1080576080 11:33600437-33600459 ACAGTGAAGCCATATGGGGAAGG + Intronic
1083451922 11:62752036-62752058 TCTGAGCTGCCATCTAAGGATGG + Exonic
1084935689 11:72585422-72585444 ACAGAGACGTCATCTGGGGAAGG + Exonic
1085221008 11:74873658-74873680 ACTGAGGAAGCATCTCAGGAAGG + Intronic
1086398814 11:86443985-86444007 GCTGAGGAGCCATATAAGGAAGG + Intronic
1087774134 11:102242440-102242462 ACTGAAAAGTCAGCTGAGGCTGG + Intergenic
1088142527 11:106634437-106634459 ACTGGGGAGCCATCTTTGGATGG - Intergenic
1089053778 11:115567635-115567657 ACTGAGAAGTCATCTCTGAAGGG - Intergenic
1089431397 11:118427633-118427655 ACTGAGAAAGCAGCTCAGGAAGG - Intronic
1091667666 12:2430932-2430954 ACAGAGAAGCCATGTGTGGCTGG - Intronic
1093111020 12:15152141-15152163 TTTGGAAAGCCATCTGAGGAAGG + Intronic
1093595067 12:20949804-20949826 ACTGAGAAACCTTCTCAGGAAGG - Intergenic
1093993776 12:25619570-25619592 CCTGAGGAACCATCTGAAGATGG - Intronic
1096368095 12:51045715-51045737 ACTCAGAAGCTACCTGAAGATGG + Intergenic
1096455456 12:51781203-51781225 ACTGAGAAAGCAGCTGAGAATGG + Intronic
1099260983 12:80382487-80382509 ACTGAGCAGTGATCAGAGGAAGG - Intergenic
1102724953 12:115054408-115054430 AGTGAGAATCCATCTCAGGGAGG - Intergenic
1102997182 12:117360154-117360176 ACGGAGAAGGCAGCCGAGGAGGG - Intronic
1103746907 12:123131032-123131054 CCTGAGCAGACATGTGAGGATGG + Intronic
1103791667 12:123476566-123476588 ACAGAGATGGCATGTGAGGAAGG + Intronic
1103834624 12:123808976-123808998 CCTGAGATGCCGTCTGAGCAAGG - Intronic
1104779092 12:131408305-131408327 GCTGAGATGCCACCTGAGAATGG + Intergenic
1106720518 13:32430330-32430352 AGAGAGAAGACAGCTGAGGAAGG + Intergenic
1109717828 13:66239756-66239778 ACAGATCAGACATCTGAGGATGG - Intergenic
1109804228 13:67416735-67416757 ACTGAGAAGCCCTCTGAGTGTGG + Intergenic
1110266951 13:73549327-73549349 ATGGCGATGCCATCTGAGGAAGG + Intergenic
1110442987 13:75545765-75545787 TTTAAGAAGCCATCTGAGGCTGG - Intronic
1110665658 13:78115257-78115279 CCTGAAAAGCCTTCTGGGGAAGG - Intergenic
1110977392 13:81856578-81856600 ACAGAGTAGAAATCTGAGGATGG + Intergenic
1111012255 13:82327744-82327766 ACTGAGAAAGCTTCTCAGGAAGG + Intergenic
1112313061 13:98336735-98336757 AATGAAAAGCCAATTGAGGATGG + Intronic
1112759078 13:102672696-102672718 GCTGAGAAGACATTTAAGGATGG + Intronic
1113958170 13:114110538-114110560 CCTGAGAAGCCGTGTAAGGAAGG - Intronic
1115571418 14:34670321-34670343 AATGAGAACTCATCTGATGATGG - Intergenic
1117234112 14:53753204-53753226 TCTGAAAAGCCTTCTGAAGAAGG + Intergenic
1117365757 14:55025904-55025926 CTTGAGACGCCATCTGAAGACGG - Intronic
1117993308 14:61455873-61455895 ACTGGAAAGCCAACTGAGGCAGG + Intronic
1118835304 14:69473719-69473741 ATTCAGGAGCCATCAGAGGAGGG + Intergenic
1119492129 14:75044203-75044225 ACTGAGGAGCCATCTGTTCATGG + Intronic
1119879982 14:78092311-78092333 CCAGAGAAGCCCTCTGAGCAGGG - Intergenic
1119937103 14:78602066-78602088 ACTGTGAAGTCATCTGAGATGGG + Intronic
1120913611 14:89690165-89690187 ACTCAGCAGCCATTTGTGGAGGG - Intergenic
1124631564 15:31340456-31340478 ACTGAGCACCCAGGTGAGGAGGG - Intronic
1126029863 15:44486025-44486047 ACTGAGACGCCATCTCAGAGTGG - Intronic
1127675800 15:61237587-61237609 AATGAGTAACCATGTGAGGATGG - Intergenic
1127676899 15:61248117-61248139 TCTCAGAAGCCCTCTGAAGAAGG - Intergenic
1128150382 15:65359817-65359839 ACTCAGAAGCCTGCTGAGAAAGG + Intronic
1129288588 15:74545702-74545724 ACTGAGAAGTCATATAAGAAAGG + Intronic
1130164018 15:81434293-81434315 ACTGAGACGGTATCTGAGCATGG + Intergenic
1132252683 15:100346023-100346045 ACTGAGAGACCTTCTGAGGTAGG - Intergenic
1132525434 16:411851-411873 ACTTAGTAGCCGGCTGAGGACGG - Intronic
1134015668 16:10886435-10886457 CAGGAGAACCCATCTGAGGATGG - Intronic
1134905802 16:17978511-17978533 ACTGAGGAGCTATTTGATGAGGG - Intergenic
1135944364 16:26852908-26852930 ACTGAGGTGGGATCTGAGGAGGG - Intergenic
1137617522 16:49856321-49856343 ACAATGAACCCATCTGAGGAGGG + Intronic
1138143353 16:54587085-54587107 ACTGATAAGGCATCTGGGGAAGG - Intergenic
1138244913 16:55460301-55460323 TCTCAGATGCCATCTGAGGTGGG + Intronic
1140451674 16:75075758-75075780 ACTCAGCAGCCATGTGAGAAAGG - Intronic
1140833314 16:78770841-78770863 ACTGAGACGTCATCTGTGGACGG + Intronic
1140985908 16:80157772-80157794 AGAGAGAAGCCACGTGAGGAGGG - Intergenic
1141203424 16:81914409-81914431 TCTGACAGGCCATCTGGGGATGG + Intronic
1142630429 17:1222363-1222385 ATTAAGAAGCCATTTGAGGCCGG - Intronic
1143890926 17:10101826-10101848 ACTGAGAAGCCAACTTAGATGGG - Intronic
1144126637 17:12208859-12208881 ACAGAAGAGCCATCTGAGGGAGG + Intergenic
1145002668 17:19316277-19316299 AATTAAAAGCTATCTGAGGATGG + Intronic
1146599491 17:34202353-34202375 AGAGAGAAGCCATCAGAGAAGGG + Intergenic
1146664824 17:34692375-34692397 CCAGAGAAGCCTTCTGATGATGG - Intergenic
1146822878 17:35998687-35998709 ACAGAGAAGGCATCTATGGAGGG + Intronic
1146824997 17:36014155-36014177 ACAGAGAAGGCATCTATGGAGGG + Intronic
1147140951 17:38460463-38460485 ACTCAAAAGACATCTGAGGGTGG - Intronic
1149957761 17:61072028-61072050 ACTTGGAAGCCATCAGAAGATGG - Intronic
1150309413 17:64115566-64115588 AGTGAGAAGACAGCTGAGCAGGG - Intronic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1152953331 18:13287-13309 ACTGAGAAGCCAGTTAGGGAGGG - Intergenic
1156305575 18:35875383-35875405 ACTGAGAAAGCTTCTCAGGAGGG + Intergenic
1157336251 18:46739674-46739696 ACTGAGAAGCCCTCTGGGGCAGG + Intronic
1157716463 18:49891253-49891275 TCTGAGAAGACATCTGAGTAAGG - Intronic
1158148351 18:54342259-54342281 CCGGTGAAGCCATCTGAGCATGG - Intronic
1158448206 18:57539700-57539722 AGTGACAAGCCCGCTGAGGAGGG - Intergenic
1158463156 18:57664911-57664933 GCTGAGAAGCCTTCTTTGGAAGG - Intronic
1158960086 18:62581463-62581485 ACTGTGACACCATCTCAGGAGGG - Intronic
1159008708 18:63038370-63038392 AATTAGAACCCATCTGAAGATGG - Intergenic
1159064032 18:63549717-63549739 ACTGAGAGTCCATCTCAGGACGG - Intergenic
1159201583 18:65192576-65192598 ACAGTGAGGCAATCTGAGGAGGG - Intergenic
1160572491 18:79827584-79827606 TCTGAGAGGCCAGCAGAGGAGGG + Intergenic
1165220306 19:34310856-34310878 ACTGAGAGCGCATCTGAGCAGGG + Intronic
1165636927 19:37348084-37348106 ACGGAGAAGACAAATGAGGAAGG - Intronic
1166253080 19:41584776-41584798 AGTGAGAGGGCATCTGAGGGGGG + Intronic
1167497366 19:49827500-49827522 AGGGAGAGGCCATGTGAGGACGG - Intronic
1168661467 19:58170792-58170814 AGTGAGAGTCCATCTAAGGAAGG + Intergenic
925694867 2:6566139-6566161 CCTCAGAGGCCATCTGAGGAAGG - Intergenic
926462484 2:13149003-13149025 ACTGAGAAGCCATGCTAAGATGG + Intergenic
926837468 2:17039895-17039917 ACTGAATAGCCATCTGAAGATGG + Intergenic
927210365 2:20635316-20635338 GCTGAGAAACCAGCAGAGGAAGG + Intronic
927948596 2:27152469-27152491 CAGGAGGAGCCATCTGAGGAGGG - Intronic
929580288 2:43077997-43078019 ACTGAGCACCCACCTAAGGAGGG + Intergenic
929961502 2:46499926-46499948 ACTTAGGAGCCAGCTGGGGAGGG - Intronic
931539530 2:63314603-63314625 ACTAAGAACACATCTAAGGAAGG - Intronic
933415126 2:81977925-81977947 ACTGAGAAGTCATATTAGAAGGG + Intergenic
938581556 2:132651233-132651255 AGAAAGAAGCCATTTGAGGATGG - Intronic
938589425 2:132722414-132722436 TCTTAGAAGCCAAGTGAGGAAGG - Intronic
938747863 2:134297284-134297306 CCAGTGAAGCCATCTGAGCATGG - Intronic
943163959 2:184293102-184293124 ACTGGGAAGCTATATGAGGCTGG + Intergenic
943665101 2:190600953-190600975 TCTGAGCAGCCTTCTCAGGAAGG - Intergenic
945902297 2:215552508-215552530 ACTGGTTAGGCATCTGAGGAGGG + Intergenic
946786049 2:223245910-223245932 ACTGAGAAGCCTGCTGAGAGTGG + Intergenic
947007510 2:225529263-225529285 TCTGAGGTGCCTTCTGAGGACGG - Intronic
947052377 2:226059910-226059932 AATGAGTAACCATCTGAGGCAGG - Intergenic
947268161 2:228305073-228305095 GCTGAGAAAGCATCTCAGGAAGG - Intergenic
1169263079 20:4151684-4151706 ACTGGGAAGGCATTTGAGGAAGG - Intronic
1172835333 20:37869675-37869697 ACAGAGAAGACATCTCAGGAGGG + Intronic
1173011473 20:39187036-39187058 ACCAAACAGCCATCTGAGGATGG - Intergenic
1175275064 20:57762776-57762798 ACTGAAAGGCCACCTGAGGATGG + Intergenic
1175785991 20:61712131-61712153 ACTGAGAAGCCAGGAGAGGCTGG + Intronic
1177151552 21:17460106-17460128 AAAGAGATGCCATCTGAGAATGG + Intergenic
1177703866 21:24674702-24674724 ACACTGAAGCCATCTGTGGATGG + Intergenic
1178220711 21:30655846-30655868 ACAGTGAAGCCATCTGAGTCTGG - Intergenic
1178396852 21:32250476-32250498 ACTGAGAAACAACCTGGGGATGG - Intergenic
1180717438 22:17881427-17881449 ACTGGGCTGCCCTCTGAGGATGG - Intronic
1182943497 22:34300531-34300553 AGTGAGACTCCATCTGAAGAAGG - Intergenic
1184488554 22:44796017-44796039 CCTGGGAAGCCAGGTGAGGAGGG - Intronic
1185218897 22:49619039-49619061 AGTGACCAGCCATCAGAGGAAGG + Intronic
949099684 3:128972-128994 ATTGAGAAGGCCTCAGAGGAAGG - Intergenic
950131475 3:10549871-10549893 ACTGAGGGGCCCACTGAGGAGGG + Intronic
950687276 3:14627592-14627614 ACTGGGAAGCCTTCTGAGGAAGG - Intergenic
952927804 3:38334572-38334594 GCTGACACCCCATCTGAGGAAGG + Intergenic
954446909 3:50551771-50551793 GCAGAGAAGAGATCTGAGGATGG + Intergenic
954526703 3:51278300-51278322 ACTGGGAAGGCTTCTCAGGAGGG + Intronic
955459573 3:59166324-59166346 ACTGATTAGCCATCTGGAGAAGG + Intergenic
955977259 3:64490556-64490578 ACTGAGAACCCACCTGGTGAGGG + Intergenic
956162505 3:66370225-66370247 ACTATGAAGCAATGTGAGGAGGG - Intronic
956347623 3:68298369-68298391 GCTGAGAAGCCATTTGGGGAGGG + Intronic
957013872 3:75040340-75040362 ACTGTGAATCCATCTGAGCTGGG + Intergenic
957781453 3:84822659-84822681 ACTGAGCAGGCAGCTGGGGAAGG + Intergenic
959864202 3:111247250-111247272 GCTGAGAATACATCTTAGGAAGG + Intronic
960755679 3:121009398-121009420 ACAGAGAAGTAATGTGAGGAAGG - Intronic
961083208 3:124043933-124043955 TCTGGGCAGCCTTCTGAGGAGGG + Intergenic
962888189 3:139647598-139647620 ACAGAGAGGCCATTTGAAGATGG + Intronic
963129108 3:141841640-141841662 GCTGAGAAGGCAATTGAGGAAGG + Intergenic
963221595 3:142818971-142818993 ACTGAGAAGCCATCTGAGGATGG - Intronic
964948837 3:162261925-162261947 ACAGAGAAACCGTCTGTGGAAGG + Intergenic
965204481 3:165704004-165704026 TCTGGGAAGGCCTCTGAGGAGGG - Intergenic
968324188 3:197797955-197797977 AATGAGAAGCAATCTGAAGCTGG + Intronic
969303432 4:6310787-6310809 ACAGAGGAGCCAACTGAGGCTGG - Intergenic
970574226 4:17411868-17411890 ACTAACAAGCCACCTGTGGACGG - Intergenic
972649867 4:41006347-41006369 ACTGAGAAGACATAACAGGAAGG + Intronic
972705348 4:41537504-41537526 ATTGAGATGACATCTGAGAATGG - Intronic
974283865 4:59838338-59838360 ACTGAGAAACTCTCTGAGGAGGG - Intergenic
974885680 4:67814191-67814213 CCTGAGAATCAATATGAGGATGG - Intergenic
975100673 4:70509397-70509419 AAGGAGAAGAGATCTGAGGAGGG + Intergenic
976358095 4:84144454-84144476 ACTGAGAAACCATCATAGAATGG + Intergenic
976668484 4:87626040-87626062 ACTGAGAAGCAGTGAGAGGATGG - Intergenic
982731847 4:158964350-158964372 GCTGTGAAGTCATCTGAGGCTGG - Intronic
983392124 4:167145594-167145616 TCTCAGAAGCCAACTGAAGAGGG + Intronic
983804585 4:171978584-171978606 ACTGTGAACCCATCTGTGGCAGG - Intronic
984850289 4:184146753-184146775 TCTGCGTAGCCATCTGATGAGGG - Intronic
985175014 4:187191465-187191487 TCTGAGAAACCAGCTGAGCATGG - Intergenic
985354451 4:189102779-189102801 ACTGAGATGTCATCTGTGGGAGG - Intergenic
985706159 5:1402468-1402490 ACACAGAAGCCATCTGAGGGCGG - Intronic
986961967 5:13224854-13224876 ACTGAATAGCCATATGAAGAAGG + Intergenic
990549939 5:56864770-56864792 GGTGAGAAGCCATCTGGTGAAGG - Exonic
992873358 5:81027827-81027849 ACTGAGAAGCATTCTAAGAATGG + Intronic
993257203 5:85606115-85606137 TCTGAAAAGCCTTCTCAGGAAGG + Intergenic
994232783 5:97328012-97328034 ACTGAGCTGCCAGGTGAGGACGG - Intergenic
995715811 5:115081096-115081118 ACTGAGGAAGCATCTCAGGAAGG - Intergenic
996399088 5:123040555-123040577 TCTTAGAAGCCATCTGAGCCTGG + Intergenic
996615380 5:125435310-125435332 CCTTAGAAGCCTTATGAGGAAGG - Intergenic
996767341 5:127047831-127047853 ACTGAGAAGCCATGTGGGGGTGG + Exonic
997847683 5:137302970-137302992 CATGAGAATCCTTCTGAGGAAGG + Intronic
998567143 5:143225812-143225834 ACAGAGAAGCCATCTGTCAAGGG - Exonic
998966332 5:147544748-147544770 CCTTAGAAGCCATCTGATGAAGG - Intergenic
1000272937 5:159703948-159703970 AAACAGAAGCCATCTCAGGATGG - Intergenic
1000654397 5:163858934-163858956 ACTACGAAGCCCTTTGAGGAAGG + Intergenic
1001708047 5:173756290-173756312 ACTGAAAAGTCATGTGATGAAGG - Intergenic
1002418685 5:179134512-179134534 ACTGAGAGGGCTCCTGAGGAAGG - Intronic
1002861878 6:1086615-1086637 GCTGAGAAGGCATCTGAGGAAGG + Intergenic
1003040027 6:2679142-2679164 ACCTAGAAGGCAACTGAGGATGG + Intronic
1003167571 6:3694521-3694543 ACTGAAGAGCCATCTAAGGCTGG + Intergenic
1004212759 6:13668266-13668288 CCAGTGAAGCCATCTGAGCACGG - Intronic
1005955209 6:30658868-30658890 GCTGAGAAGTCATCAGAGGAAGG - Intronic
1007230705 6:40345852-40345874 ACGGAGGAGCCATCTGAGGCTGG - Intergenic
1007436508 6:41816517-41816539 ATTGAGAAGAGAGCTGAGGATGG - Intronic
1010344697 6:74798439-74798461 ACTGAGAAGTCGTCTCAGGTGGG + Intergenic
1011492494 6:87906789-87906811 AATGAGATGACATCTGTGGAAGG - Intergenic
1013251871 6:108342279-108342301 ACGGAGAAGGCATCAGGGGAGGG + Intronic
1016215308 6:141593060-141593082 ACAAAGAAGCCATCAGTGGAAGG - Intergenic
1018281961 6:162196174-162196196 AGTGAGAAGCCTTCAGGGGAAGG + Intronic
1018772223 6:166981007-166981029 ACTCTGAAGACATATGAGGAGGG - Intergenic
1018828460 6:167424225-167424247 GCTGAGAAGCCGTGTGAGAATGG - Intergenic
1021723879 7:23531633-23531655 ACCCAGAAGCCATCTTGGGATGG + Intronic
1022336996 7:29431499-29431521 AGTGTGAAGCCTTCTTAGGATGG - Intronic
1023032572 7:36103546-36103568 ACAGATAAGCCAACTGAGGTTGG - Intergenic
1026518210 7:71091229-71091251 CCTGAACAGACATCTGAGGATGG + Intergenic
1026590986 7:71695397-71695419 AGGGAGAAGCCAGCAGAGGAAGG + Intronic
1026715338 7:72784343-72784365 ACTTACCAGCCATCTGATGATGG + Intronic
1028531419 7:91842524-91842546 ACACTTAAGCCATCTGAGGATGG + Intronic
1029111891 7:98216994-98217016 TCTGAGATGCCAGCTCAGGAGGG + Exonic
1029289424 7:99490840-99490862 AGTTTGAAGCCATCTCAGGATGG - Intronic
1031183565 7:118447056-118447078 ACAGAGAAGCCTTCTGTGAAAGG - Intergenic
1031991439 7:128201578-128201600 ACAGAGAAGCCGGCGGAGGAAGG - Intergenic
1033423587 7:141223699-141223721 TCTGAGGAGCCTTCTGGGGAAGG + Intronic
1034143533 7:148847267-148847289 ACTGGGAAGAAATCTGAGAAGGG - Exonic
1034609497 7:152352868-152352890 ACTCAGAAGCCAGCTGACAAGGG + Intronic
1035058860 7:156054344-156054366 AGTGAGACTCCATCTCAGGAAGG - Intergenic
1035538967 8:416960-416982 TCTAAGAAGCAATCTGTGGAAGG + Intronic
1037695968 8:21224218-21224240 ACTGAGAAGTCATAGTAGGAGGG - Intergenic
1039358554 8:36848762-36848784 ACTGAGAATCCATATGAAAAGGG + Intronic
1039734823 8:40320543-40320565 CCTGAGAAGCAAGCTGAGGCTGG + Intergenic
1039914790 8:41851967-41851989 ACAGAGAAAGCCTCTGAGGAGGG - Intronic
1040722545 8:50343981-50344003 AGAGAAAAGCCAGCTGAGGATGG - Intronic
1042674789 8:71307850-71307872 AGTGAGTAGCCTTCTTAGGAGGG - Intronic
1044016115 8:87050400-87050422 TCTGAGAAGGCTTCTCAGGAAGG - Intronic
1044760188 8:95509840-95509862 ACTGAGAGGGCATGTGAGAATGG + Intergenic
1046258734 8:111737466-111737488 ACTGAGAAGTGAGATGAGGAGGG + Intergenic
1046787251 8:118281341-118281363 ACGGAAAAGCCATCGAAGGAAGG - Intronic
1047408810 8:124607420-124607442 ATTCAGAAACCATCTGGGGAAGG - Intronic
1048471690 8:134709819-134709841 AATGAGAAGCCCACTGAGAAGGG + Intronic
1048803971 8:138222178-138222200 ACAGAGAAGCCATGTAAGTAAGG + Intronic
1049034369 8:140062772-140062794 ACTCAGAAAGCTTCTGAGGAAGG + Intronic
1049140927 8:140953444-140953466 ACTTAGTAGCCATCTGAGTTAGG - Intronic
1050445653 9:5719431-5719453 CCTGAGAAGTCCTCTGAAGACGG + Intronic
1050747903 9:8898796-8898818 ACAGAGAAGTCATCTGTGAAAGG + Intronic
1051992207 9:23164427-23164449 GCTGAAAAGCCATCTGAAGAAGG + Intergenic
1052381542 9:27776193-27776215 ACTGGGAAGTCATCAGAGAAGGG + Intergenic
1053528791 9:38857078-38857100 ATGAAGAAGCCAACTGAGGAAGG + Intergenic
1054201018 9:62081511-62081533 ATGAAGAAGCCAACTGAGGAAGG + Intergenic
1054637341 9:67506852-67506874 ATGAAGAAGCCAACTGAGGAAGG - Intergenic
1055535942 9:77244497-77244519 GCTGTGAAACCACCTGAGGAGGG + Intronic
1057228470 9:93304729-93304751 ACTAAGGAGCCACCTAAGGACGG + Intronic
1057484552 9:95472390-95472412 ACTGAGAGGACGTCTGTGGACGG + Intronic
1058113558 9:101058198-101058220 ACAGCAAAGCCATTTGAGGAGGG - Intronic
1060256634 9:122036289-122036311 CCTGAGAGCCCACCTGAGGAGGG - Intronic
1060632552 9:125172984-125173006 ACTGAGGAGCCAGCTGGGCACGG + Intronic
1061497698 9:130985006-130985028 ACTGAGAGGCAAGCTGATGAGGG + Intergenic
1187259369 X:17671044-17671066 GCTGGGAAGGCATCTGAGCATGG + Intronic
1188727448 X:33603535-33603557 ACTAAGAAGTAAACTGAGGAGGG - Intergenic
1190171812 X:48117018-48117040 CCCGAGAAGCCAGCAGAGGAAGG + Intergenic
1190180757 X:48190240-48190262 CCCGAGAAGCCAGCAGAGGAAGG - Exonic
1190183470 X:48214511-48214533 CCTGAGAAGCCAGCAGAGGAAGG + Intronic
1190230189 X:48575879-48575901 GCCGAGAAGCCACCTGTGGATGG + Intronic
1192150978 X:68712232-68712254 ACTGGGAAGCTCCCTGAGGAGGG + Intronic
1192209787 X:69120511-69120533 TCTGAGGAGCCCTCTGAGGCAGG - Intergenic
1192544087 X:71998405-71998427 TCAGAGAAGGCATCTGAGGTAGG + Intergenic
1192949475 X:76001700-76001722 GCTGAGAAGCCATCTGATCATGG + Intergenic
1193654436 X:84182726-84182748 ACTGAGAAGGCACCTGTGGCAGG + Intronic
1197488068 X:127078998-127079020 ACAGTGAAGCCATCTGAGCTTGG - Intergenic
1197562058 X:128035403-128035425 ACTGAAAAGCCTTCTGAAGAAGG + Intergenic
1198378522 X:136062626-136062648 AGAGAGAAGCCATCTCATGATGG - Intergenic