ID: 963223011

View in Genome Browser
Species Human (GRCh38)
Location 3:142831718-142831740
Sequence ACTTATAAGCAGCAAAGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 377
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 339}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963223011 Original CRISPR ACTTATAAGCAGCAAAGGAA AGG Intronic
900034690 1:397242-397264 GCTAATAAGCAGCCAAGGAGTGG + Intergenic
900055521 1:627124-627146 GCTAATAAGCAGCCAAGGAGTGG + Intergenic
902956160 1:19925311-19925333 AGTTATTAGCAGGAAATGAATGG - Intergenic
907342822 1:53749036-53749058 ACTTCCAGGCAGCAAAAGAAGGG + Intergenic
909610623 1:77548175-77548197 ACTTATAATCAGCACATTAATGG - Intronic
909872443 1:80759661-80759683 ACTAATAAGCAGCAGAGCGAAGG - Intergenic
910812701 1:91254115-91254137 ACTTGGAAGCAGCAGAGGAAGGG - Intergenic
911389351 1:97219581-97219603 ATTTATAAGCAGCTAACCAAGGG + Intronic
911611555 1:99963887-99963909 ATTTGTAAGCAGGAATGGAAAGG - Intergenic
912012981 1:104994663-104994685 ACCTCTAAGCAGCAAGGGCATGG - Intergenic
912090049 1:106061172-106061194 TCTTGAAAGCAGCAAAGGAAAGG - Intergenic
912202237 1:107471361-107471383 AATTAAAAGCAGGAAAGCAAGGG + Intronic
913405386 1:118485238-118485260 AATTAAGAGCAGAAAAGGAAGGG + Intergenic
913410247 1:118542902-118542924 ACTTGGAGGCAGCAGAGGAAGGG - Intergenic
917091279 1:171355893-171355915 ACTTATAAGCGGGAAAAGCAAGG - Intergenic
917611602 1:176694174-176694196 ACTTAGCAGCAGCCACGGAAGGG + Intronic
919161078 1:193832217-193832239 ACTTAAAAGTAGCTAAGAAAAGG - Intergenic
919260808 1:195191092-195191114 AGTTGGATGCAGCAAAGGAAGGG - Intergenic
919266251 1:195270537-195270559 TCTTATAAGCAACAAACGTAAGG - Intergenic
919376884 1:196806234-196806256 ACTTATATACATGAAAGGAATGG + Intergenic
919386587 1:196931116-196931138 ACTTATATACATGAAAGGAATGG + Intronic
919647444 1:200109129-200109151 ACTTATAACCACCAAAGAATTGG + Intronic
920661057 1:207914677-207914699 ACTTACAGGCAGAAAAGGATAGG - Intergenic
920934756 1:210421386-210421408 ACTTATTAGTAGCCAAGGAAAGG - Intronic
920987471 1:210904071-210904093 ACTTATAAGCCTCTAAGGAACGG + Intronic
921649678 1:217662031-217662053 TCTTAAAAGAAGCAAATGAAAGG - Intronic
922539170 1:226406201-226406223 AAATGTAAGCAGCAAAGCAAAGG - Intronic
924338413 1:243005608-243005630 GCTAATAAGCAGCCAAGGAGTGG + Intergenic
1063150124 10:3328964-3328986 AAATATATGCAGCTAAGGAAGGG + Intergenic
1064020740 10:11806483-11806505 ACTTACTAGCAACAAAGGAATGG + Intergenic
1064678513 10:17785768-17785790 TCTTCTAAGTAGCAAAGGGAGGG - Intronic
1065243715 10:23735686-23735708 ACATATAACCATCAAAGAAATGG - Intronic
1065317292 10:24475671-24475693 AATTCTAAGCATCAAAGAAAGGG + Intronic
1065979644 10:30879221-30879243 ACTCATAATCCACAAAGGAATGG + Intronic
1066598416 10:37077611-37077633 CCTTTTTAGCAGAAAAGGAACGG - Intergenic
1067186633 10:44034546-44034568 ACTTCAAAGCATCAAAGGACAGG - Intergenic
1067437438 10:46287982-46288004 ACTTAGAAGCAGCCAACCAAAGG - Intronic
1068059934 10:52054540-52054562 CTTTATCATCAGCAAAGGAACGG + Exonic
1069580720 10:69564497-69564519 ATTTATAGGCAGCAAAGGACAGG + Intergenic
1070225714 10:74503268-74503290 AAATATCACCAGCAAAGGAAAGG + Intronic
1071546546 10:86534381-86534403 ATTTGTGAGCAGCAAAGGTAGGG + Intergenic
1073027566 10:100499061-100499083 ACTTACAGACAGCAAAGAAAAGG + Intronic
1073645093 10:105293643-105293665 ATTTAAAAGCACCTAAGGAAGGG + Intergenic
1073714476 10:106087257-106087279 TTTTTTAAGCAGGAAAGGAAAGG - Intergenic
1073921426 10:108464339-108464361 ACTTATAAGCAACCATGGATAGG + Intergenic
1074325059 10:112442534-112442556 AATTCTAAACAGCACAGGAAAGG + Intronic
1076136896 10:128051374-128051396 AATTATCAGCACCACAGGAAAGG + Intronic
1080549720 11:33362179-33362201 ACTTAAAAGCAGCAAGGGCTGGG + Intergenic
1080923904 11:36736244-36736266 TCCTAAAAGCAGCAAAAGAAAGG - Intergenic
1082872442 11:57955791-57955813 ACATTTAAGCAGAAAATGAAAGG - Intergenic
1082954520 11:58855617-58855639 ACTTCAAAGCTGCAAAGGACAGG - Intronic
1084637717 11:70403839-70403861 ACTCATGAGCAGCTAAGGATAGG - Intronic
1085163054 11:74366799-74366821 ACTTATAAGCTCCAAGGCAAGGG + Intronic
1085851741 11:80128591-80128613 AGTCATAAGCCGTAAAGGAAGGG - Intergenic
1086113894 11:83227085-83227107 TCTTATAAGCAGAAAAGGAGAGG + Intronic
1087153127 11:94876604-94876626 AAGTTTAAGCAGCAAAGGAGAGG - Exonic
1087558847 11:99758225-99758247 ACTTACAAGGAGCAAAAAAAGGG - Intronic
1088446646 11:109937586-109937608 AGGTATAAGCACCAAAGTAAAGG + Intergenic
1088709062 11:112490357-112490379 ACATATAAGCAGGAAAGTAAAGG - Intergenic
1088739996 11:112759444-112759466 ACTTTTAAGCAGAAGAGTAAGGG + Intergenic
1089355622 11:117850457-117850479 TCTTATAAACAGCAAAGAGATGG + Intronic
1090745968 11:129705024-129705046 ACTTATCAGAAGCTCAGGAAAGG + Intergenic
1091139550 11:133223294-133223316 ACTAATGAGGAGCAAAGGAGAGG + Intronic
1092091693 12:5809038-5809060 ACTTAAAATCAGGAAAGGACTGG - Intronic
1092862608 12:12732035-12732057 ACTTAAAAGCAGGAATGGATGGG - Intronic
1093240047 12:16659110-16659132 ACTTTGAGGCAGCAGAGGAAGGG + Intergenic
1093297094 12:17404535-17404557 ATTTCTAAGCAGCAAAGCATTGG + Intergenic
1093415591 12:18916843-18916865 ACCTACAAGCTGCAAAGGAGTGG - Intergenic
1093612436 12:21178390-21178412 ATTTATTAGCAGCATAAGAATGG + Intronic
1094287271 12:28809851-28809873 ACTAATAAGTAGAAGAGGAAAGG - Intergenic
1094815520 12:34179740-34179762 ACTTATTAGGACCAAAGCAAAGG - Intergenic
1095477377 12:42599499-42599521 ATTTATGAGCATCAAAGGATGGG + Intergenic
1095764932 12:45884668-45884690 AATTATTAGGAGGAAAGGAAAGG + Intronic
1096095647 12:48933922-48933944 ACTAAGCAGCAGCAATGGAAGGG + Intronic
1096908251 12:54956423-54956445 ACTTATAAGCGGCAGAGCCAAGG - Intronic
1098227307 12:68338015-68338037 AATTATAAGCCACAAAGGAGAGG - Intergenic
1098509387 12:71293543-71293565 ACATAGAAGAAGCAATGGAAGGG - Intronic
1098806838 12:75031666-75031688 ACTTATAAGAAGCAAAGAGCTGG + Intergenic
1099995418 12:89772657-89772679 ACTTATAAGAAGCAAAGAATAGG - Intergenic
1100711326 12:97260017-97260039 AATTATAAACAGCTAAGGAGAGG - Intergenic
1100908304 12:99328133-99328155 ACTGAAAAGCAGGAAATGAAGGG + Intronic
1101006137 12:100402678-100402700 ACTTATGAGGAGCAAATAAAAGG - Exonic
1102440606 12:112961333-112961355 ACCAATAAGAAGCAAAGGAGGGG - Intronic
1102902258 12:116647470-116647492 ATTTAAAAGAAGGAAAGGAAGGG - Intergenic
1103790276 12:123465416-123465438 TCTTAAAAACAGGAAAGGAAGGG - Intronic
1104500602 12:129282013-129282035 ACCTATAAGGAGACAAGGAAGGG - Intronic
1107209537 13:37836631-37836653 ATTTCTAAGCAGCAAAGCACTGG + Intronic
1108084569 13:46772653-46772675 ACTTATAAGCAGGAGCTGAATGG - Intronic
1108831342 13:54483067-54483089 ACTTATATCAAGCATAGGAAAGG + Intergenic
1109711669 13:66168639-66168661 CTTTAGAAGCAGAAAAGGAAAGG - Intergenic
1112606499 13:100911878-100911900 TCTTAAAAGAAGTAAAGGAAGGG - Intergenic
1112874763 13:104023629-104023651 AACTATAAACAGCAAATGAACGG - Intergenic
1113226987 13:108169571-108169593 ACTTGGAGGCAGCAGAGGAAGGG - Intergenic
1114430260 14:22654722-22654744 AATTGTAAGCACTAAAGGAAAGG + Intergenic
1115127686 14:30016158-30016180 ATTTATAGGCAGCAAAGAGAAGG + Intronic
1116238623 14:42312728-42312750 TGTTTTAAGCACCAAAGGAAGGG + Intergenic
1117378383 14:55136370-55136392 ACTTCTAAGAAGGAAAGGAAAGG - Intronic
1118117806 14:62800984-62801006 ATTTATATGCAGTTAAGGAAAGG + Intronic
1118179496 14:63478079-63478101 ACATATAAGAAACCAAGGAAGGG + Intronic
1118266195 14:64296815-64296837 AATAATAAGCAGAAAATGAATGG + Intronic
1118554885 14:67007222-67007244 AAATATAAGAAGCAAATGAATGG + Intronic
1121854980 14:97259824-97259846 TCTTAAAAGCAGCATAGCAAAGG + Intergenic
1123787996 15:23691420-23691442 AGATATAAACAGCAATGGAAGGG + Intergenic
1124788322 15:32702402-32702424 ACTTATAAGTTGCAAAAGAAAGG + Intergenic
1125606683 15:40943433-40943455 AGGCATAAGCAGCAAAGGAGAGG - Intergenic
1126398261 15:48242370-48242392 TCTTATAAGCAGAAGAGGACTGG - Intronic
1127094225 15:55496837-55496859 ACTTGAAAGCAGCAAATGCAGGG + Intronic
1128908315 15:71489307-71489329 ACTTAAAATGAGCAAAGAAATGG - Intronic
1129172286 15:73815560-73815582 ACTTATTAGCAGCAAAAGCCAGG + Intergenic
1130674647 15:85940954-85940976 ACTAATAAGCAGAAGAGCAAGGG - Intergenic
1130916337 15:88307989-88308011 ACTTATAAGAAGCACTGGAATGG - Intergenic
1130926354 15:88388492-88388514 ACTTTTAAGCAGTAGAGGGATGG + Intergenic
1131238637 15:90718869-90718891 ACCTATGAGCAGGAAGGGAAGGG + Intronic
1136155517 16:28379652-28379674 AAATATAATCAGCAAATGAATGG + Exonic
1136207567 16:28735637-28735659 AAATATAATCAGCAAATGAATGG - Exonic
1137867280 16:51913427-51913449 GCTCATAAGCAGCAAAGGGTGGG - Intergenic
1143737294 17:8921283-8921305 ACTTATAAGTAGGAATGGTAGGG - Intronic
1144434580 17:15228972-15228994 GCTGGTAAGCAGCAAAGGACAGG + Intergenic
1144595476 17:16566750-16566772 ACTTCAAAGCATCAGAGGAAAGG + Intronic
1144801209 17:17929079-17929101 ATTTTTAAGTAGCCAAGGAAAGG - Intronic
1144924495 17:18792762-18792784 ACTTATAGATAGCAAAGCAATGG + Intronic
1146195110 17:30805390-30805412 ACTGAAAAGCAGCAAAGAAGTGG + Intronic
1146571758 17:33958890-33958912 ATTTCTAAGCAGCAAAGCACTGG - Intronic
1146733252 17:35213969-35213991 ACTTAGAAGATGCAAAGAAAAGG + Intergenic
1147373183 17:40007987-40008009 ACTTATAATCATAAGAGGAAGGG + Intergenic
1147396898 17:40150629-40150651 AGTTAGAAGCATCAAGGGAATGG + Intronic
1149159994 17:53680966-53680988 TCTTGAAAGCAGCAAAAGAAAGG - Intergenic
1149465812 17:56878315-56878337 ACAAATAATCAGTAAAGGAAAGG + Intergenic
1149742600 17:59061198-59061220 ACTTCTAAGCCTCAAAGCAATGG + Intronic
1149977938 17:61285264-61285286 GCTAAAATGCAGCAAAGGAAGGG + Intronic
1150193283 17:63266533-63266555 ACTAAGAAGCAAAAAAGGAAGGG - Intronic
1151536772 17:74743367-74743389 ACCCATAAGCAGCCAAGGCAAGG + Intronic
1155191162 18:23432116-23432138 TCTTATATGGAGAAAAGGAAAGG + Intronic
1156055778 18:33000570-33000592 TCTTAAAAGCAGCAAGAGAAAGG + Intronic
1156532661 18:37833021-37833043 ACCTTTAGTCAGCAAAGGAATGG + Intergenic
1156617420 18:38803901-38803923 ACTTATGAGCTGAAAAGTAAAGG + Intergenic
1156678246 18:39557439-39557461 ACTCATCATCACCAAAGGAATGG - Intergenic
1157013877 18:43685414-43685436 AATAATAATCAGCAATGGAATGG + Intergenic
1157034791 18:43958511-43958533 ACTTGTAATCATCAAAGGCAAGG - Intergenic
1157113350 18:44841712-44841734 GCTTATCAGCATCCAAGGAAGGG + Intronic
1157378820 18:47192212-47192234 ACTAATAAGCAGCAACTGAGAGG - Intergenic
1158253532 18:55517782-55517804 AGGTATAAGCAGTAAAGCAATGG + Intronic
1159506544 18:69344768-69344790 AGTGATAAACAGAAAAGGAAAGG + Intergenic
1159607046 18:70485557-70485579 ACTTGGAGGCAGCAGAGGAAGGG + Intergenic
1159730870 18:72025897-72025919 ACTTCTAAGCAGCATATGATTGG + Intergenic
1159766809 18:72501726-72501748 ACGGATAAGTAGCAAATGAACGG + Intergenic
1160420995 18:78744058-78744080 AGTTATTAGCAACATAGGAATGG + Intergenic
1163360419 19:16842624-16842646 AGTTGTAATCAGCAAAGTAAAGG - Intronic
1163744436 19:19036737-19036759 CCTCTTAAGCAACAAAGGAAAGG + Intronic
1164798198 19:31053518-31053540 CCTTGGAGGCAGCAAAGGAAGGG + Intergenic
1165205792 19:34184351-34184373 ACATATTAAAAGCAAAGGAAAGG - Intronic
1166911637 19:46163301-46163323 AGTTGGAAGCAGCAGAGGAAGGG + Intergenic
1168422821 19:56216482-56216504 ACTTCTAAACAGATAAGGAATGG + Intergenic
1168425077 19:56233514-56233536 ACTTCTAAACAGATAAGGAATGG + Intronic
925104233 2:1276306-1276328 ACTTCAAAGCACCAAAGGACAGG + Intronic
925607618 2:5674384-5674406 ACAGAGAAGCAGAAAAGGAATGG - Intergenic
925872232 2:8281511-8281533 ATTTAAAAGCAGTAAATGAATGG + Intergenic
926711284 2:15883475-15883497 AATTAAAAGAAGAAAAGGAAGGG + Intergenic
926774902 2:16412430-16412452 ACTCATAGGTAGCAAAGCAATGG - Intergenic
927409386 2:22807050-22807072 ACTTATCAGCAGCATGGAAATGG - Intergenic
928554818 2:32412705-32412727 ACTGATAATCAGCAGAGGATGGG + Intronic
930919508 2:56734910-56734932 ACTTCAAAGCATCAAAGGACAGG + Intergenic
930939460 2:56997232-56997254 ACTTGGAGGCAGCAGAGGAAGGG + Intergenic
931543445 2:63354344-63354366 ACTTGGAGGCAGCAGAGGAAGGG - Intronic
931826896 2:66009843-66009865 ATTTATAAGCAGGAAAGGCCTGG - Intergenic
932116530 2:69055128-69055150 TTTTATAAACAGCTAAGGAATGG + Intronic
933080395 2:77977658-77977680 ACTTAGAGGCAGCAGGGGAAGGG - Intergenic
933783084 2:85815150-85815172 AAATAAAAGCAGGAAAGGAAAGG + Intergenic
934918487 2:98321118-98321140 ACTTGTAAGCTGCAAAGGTTTGG - Intergenic
936893939 2:117405657-117405679 ACAGATAAGCAGCCAAGAAATGG + Intergenic
938098543 2:128479524-128479546 TCTGATAAGCAGCCAAGGAAGGG + Intergenic
939041352 2:137192556-137192578 ACTTGAAAGCAGGAAAGCAATGG + Intronic
940446977 2:153787067-153787089 ACTTGGAGGCAGCAGAGGAAGGG - Intergenic
941177763 2:162220546-162220568 ACTTGAAATCAGAAAAGGAAAGG + Intronic
942203605 2:173596680-173596702 ACTTATAATCAGCTGAAGAAAGG + Intergenic
944184762 2:196935555-196935577 GCTTTGAAGCATCAAAGGAAAGG - Intergenic
944641929 2:201736164-201736186 TCTTATAAGCAGCACATGGATGG - Intronic
944891135 2:204118154-204118176 AATTCTAGGCAGAAAAGGAAGGG - Intergenic
945016242 2:205520102-205520124 ACTTAGAGGCAAAAAAGGAAGGG + Intronic
945480141 2:210336029-210336051 TCTTAAAAGCAGTAAAAGAAAGG - Intergenic
946434986 2:219645422-219645444 AATTCTGAGCAGCAAAGGAAAGG + Intergenic
946968845 2:225069317-225069339 ACTTGGAAGAAGCAAAGGAGAGG + Intergenic
946988545 2:225302307-225302329 ATTTCTAAGCAGCAAAGCATTGG + Intergenic
1170662207 20:18353087-18353109 ACTTATAAACAAAGAAGGAAAGG + Intergenic
1172612725 20:36263747-36263769 ACTTTTAAGCATTAAAGCAATGG - Intronic
1174965229 20:55206068-55206090 GCATATAATCAGCAAAGGGAAGG + Intergenic
1175616170 20:60400615-60400637 AATAATAATCAGGAAAGGAAAGG - Intergenic
1178761820 21:35410461-35410483 CCTTATAACCAGCACAGGACAGG + Intronic
1178767050 21:35464193-35464215 CCTTAGATGCAGCAAAGTAAAGG + Intronic
1179556197 21:42178502-42178524 ACCTGAAAGCAGCAATGGAAGGG - Intergenic
1180153074 21:45962250-45962272 CTTTATTAGCAGCATAGGAATGG - Intergenic
1180862886 22:19097167-19097189 ACTTAGAAGCAGCCAAGGCAAGG - Intronic
1181876392 22:25944020-25944042 ACCTAAAAGATGCAAAGGAAGGG - Intronic
1181993221 22:26854115-26854137 ACTTATGAGCAGGAAAGGGCAGG + Intergenic
1183041773 22:35185213-35185235 ACTTGGAGGCAGCAGAGGAAGGG - Intergenic
950379441 3:12598813-12598835 AGTTAAAAGCATCAAATGAATGG - Intronic
951307720 3:21086209-21086231 TCTTATTAGCAGCATAAGAATGG - Intergenic
951546098 3:23827032-23827054 ACTAATAAACAGCTAAGAAAAGG + Intronic
951945876 3:28135183-28135205 ACTTCAAAGCAGCTAAGGCAGGG - Intergenic
952713165 3:36452780-36452802 ACTGGGAAGTAGCAAAGGAAAGG + Intronic
954667476 3:52264646-52264668 ATTTGTAGGCAACAAAGGAAAGG + Intronic
956983280 3:74665975-74665997 ATTTATAAGAAGCCAAGGACAGG + Intergenic
957253699 3:77809628-77809650 ACTTAAAAGCAGCAGCTGAAAGG + Intergenic
959196009 3:103183047-103183069 GCTTATAAGGGACAAAGGAATGG - Intergenic
959452221 3:106517785-106517807 ACTTGGAGGCAGCAGAGGAAGGG - Intergenic
959505793 3:107155356-107155378 ACTGAGGAGCAGAAAAGGAAAGG + Intergenic
961503131 3:127351379-127351401 ACTTGAAAGCATAAAAGGAACGG + Intergenic
962036395 3:131656149-131656171 AGTTAGAAGAAGGAAAGGAAGGG - Intronic
962914791 3:139891112-139891134 TCTTATAAGCAGTGAAGAAATGG - Intergenic
963223011 3:142831718-142831740 ACTTATAAGCAGCAAAGGAAAGG + Intronic
965097625 3:164254264-164254286 ACCTCTAAGCTGCAAAAGAATGG - Intergenic
966041446 3:175494508-175494530 ACTCATAAGCTGGAAATGAATGG + Intronic
967153732 3:186673697-186673719 ACTGAAAATCAGCAAAGGAAAGG + Intronic
967307265 3:188071027-188071049 ATTTAGAAGCATCAAAGGAATGG + Intergenic
970240033 4:13999549-13999571 ACTCATTAGCAAAAAAGGAAAGG - Intergenic
970568517 4:17356170-17356192 ACTTTTAAGCAGTAATGGGAAGG - Intergenic
970755106 4:19416363-19416385 ACTTATAAAATGCAAATGAAAGG + Intergenic
971743546 4:30551017-30551039 ATTTCTAAGCAGCAAAGCATTGG + Intergenic
972267180 4:37472729-37472751 GCATAAAAGCATCAAAGGAAAGG - Intronic
973107927 4:46362771-46362793 ATTTACATGCAGCAAAGCAATGG + Intronic
975106122 4:70571221-70571243 ACTTGGAGGCAGCAGAGGAAGGG + Intergenic
975951986 4:79785029-79785051 ATTTTTAAGCACCAAAGGATAGG + Intergenic
976104219 4:81599825-81599847 ATTTAGCAGCTGCAAAGGAAAGG + Intronic
978072909 4:104493237-104493259 CCTTTTAAGAAGCAAAGCAAAGG + Intronic
978350534 4:107816425-107816447 ATTCAGCAGCAGCAAAGGAAAGG - Intergenic
978683679 4:111414491-111414513 ACTTGGAGGCAGCAGAGGAAGGG + Intergenic
978832750 4:113109031-113109053 AAATATAAGCATCAAATGAATGG - Intronic
978952887 4:114582368-114582390 ACTTGGAGGCAGCAGAGGAAAGG + Intergenic
979049375 4:115910439-115910461 ACATGTAAGCTGCCAAGGAATGG + Intergenic
979238707 4:118429660-118429682 GCTAATAAGCAGCCAAGGAGTGG - Intergenic
981206232 4:142043817-142043839 ACTTATGAGCAGCAAAGTGTTGG + Intronic
981606357 4:146545509-146545531 ACTTGGAGGCAGCAGAGGAAGGG + Intergenic
982165910 4:152613608-152613630 GGTTTTAAGCAGCAAAGGGAGGG + Intergenic
983380752 4:166989950-166989972 TCTTATAAGTAGAAAGGGAAGGG + Intronic
984519580 4:180785783-180785805 ACTTAAAAGCAGAAAATGAGGGG - Intergenic
985345929 4:189004166-189004188 ACTTTAAAGCATCAAAGGACAGG + Intergenic
987185916 5:15419025-15419047 ACTTGTAAGAAGAAAATGAAAGG - Intergenic
987237799 5:15960544-15960566 ACTTCTGAGCAACAAAGGGAGGG + Intergenic
987299510 5:16585026-16585048 AATTATAAGCATCAGAGGAGAGG + Intronic
987431877 5:17844880-17844902 TCTTAGAGGCAGCAGAGGAAGGG + Intergenic
987595109 5:19988123-19988145 ATTTATAAGAAGCAAAGAGAGGG + Intronic
988147600 5:27330575-27330597 ATTTCTAAGCAGCAAAGCATTGG + Intergenic
988936062 5:36083802-36083824 ACTTGAAAGGAGCAAAAGAAGGG - Intergenic
991157883 5:63459598-63459620 ACTTGGAGGCAGCAAAGGAAGGG - Intergenic
991528513 5:67590904-67590926 AATTATAATCAGCTACGGAAAGG + Intergenic
992012328 5:72541303-72541325 ACACATCAGCAGCAGAGGAAAGG + Intergenic
992188224 5:74264525-74264547 ATTTATAAGCACCAAAAGATAGG - Intergenic
993283033 5:85952223-85952245 ACTTGGAGGCAGCAGAGGAAGGG + Intergenic
994153190 5:96473579-96473601 ACAGATAAGAAGGAAAGGAATGG + Intergenic
994229485 5:97297511-97297533 ACTTATAACCAGCCCAGGACTGG + Intergenic
994329810 5:98491575-98491597 ACTTATCAGCCGCTAAGAAATGG + Intergenic
994775215 5:104031016-104031038 AATTCTAGGCAGAAAAGGAAAGG + Intergenic
995057786 5:107780105-107780127 AATTTTAAGGGGCAAAGGAAAGG - Intergenic
995210270 5:109530003-109530025 TCCTATAAACAGCAAAGGTAGGG - Intergenic
995270910 5:110219250-110219272 ACTTGGAGGCAGCAGAGGAAGGG + Intergenic
995668890 5:114577433-114577455 ACTTAGAAGCTTCAAAGGACAGG - Intergenic
995900476 5:117060142-117060164 ACTGCTAAGAAGCAAAGGTAGGG - Intergenic
996679077 5:126210712-126210734 ACAAAGAAGCAGCAGAGGAAAGG + Intergenic
998343453 5:141439718-141439740 AATTATAAGCAGGAACGGAACGG + Intronic
999052226 5:148534854-148534876 ACTTGGAGGCAGCAGAGGAAGGG - Intronic
1000031739 5:157407451-157407473 ACTTGGAGGCAGCAGAGGAAGGG - Intronic
1001115879 5:168939062-168939084 CCCTGTAGGCAGCAAAGGAATGG + Intronic
1002631342 5:180581718-180581740 ACATACAAGCAGCGAAGGGAGGG + Intergenic
1002739129 5:181421629-181421651 GCTAATAAGCAGCCAAGGAGTGG - Intergenic
1003175191 6:3749036-3749058 ACTTAAAAGGATCAAAGAAAGGG + Intronic
1004038146 6:11944829-11944851 AATTGTTAGCAGTAAAGGAAAGG - Intergenic
1005465793 6:26111309-26111331 ACTTCTAAGTAGCAAAGTCATGG + Intergenic
1005631138 6:27709204-27709226 ACTTATAAGTAGCAAGGGAAAGG - Intergenic
1006658924 6:35622591-35622613 ACTTATAAGGAGCAGATGGATGG - Intronic
1007215810 6:40236214-40236236 ACTTGGAGGCAGCAAAGGCAGGG - Intergenic
1007316507 6:40993556-40993578 ACTCATAAGCACCAAATAAAGGG + Intergenic
1007325820 6:41058859-41058881 GCTTTCAAGGAGCAAAGGAAAGG - Intronic
1007904624 6:45446923-45446945 GTTTGTAAGTAGCAAAGGAAGGG + Intronic
1008173294 6:48234990-48235012 ACTTGGAGGCAGCAGAGGAAGGG - Intergenic
1008211512 6:48729915-48729937 ACTTGGAGGCAGCAGAGGAAGGG - Intergenic
1008792391 6:55252566-55252588 ACTTATTTGCAGAGAAGGAATGG + Intronic
1009640003 6:66322649-66322671 ACATAAAAGCAGCAAAGTATGGG - Intergenic
1010729206 6:79370344-79370366 ACTTAAAAGCTTCAAAGGATAGG + Intergenic
1011331198 6:86208310-86208332 ACTTATAAGAAGCAAAGAGCTGG - Intergenic
1011392397 6:86868116-86868138 ACTTGGAGGCAGCAGAGGAAGGG - Intergenic
1011559942 6:88604010-88604032 AAATATAACCAGCAAAGAAAAGG - Intergenic
1012013239 6:93820269-93820291 ACTTAGAAGTATCCAAGGAAAGG + Intergenic
1012944910 6:105455043-105455065 TCTTTTAAGCAGAAAGGGAAAGG + Intergenic
1013705562 6:112829862-112829884 ACTGACAAGCAGCAGTGGAAAGG - Intergenic
1013719150 6:113001462-113001484 ACTTAAAAGCATTAAAGTAAGGG - Intergenic
1013855110 6:114563103-114563125 ATTTATAAAAAGCAAAGCAATGG + Intergenic
1014516471 6:122385015-122385037 TCTTATGAGCAACAGAGGAAAGG - Intergenic
1014799774 6:125765891-125765913 GCTTATAATCAGGAAAGGAGGGG - Intergenic
1015555674 6:134459168-134459190 GTTTTTAAGCAGCAAAGGAATGG - Intergenic
1016050869 6:139528741-139528763 ACTTAAAAACAGGAAATGAAGGG + Intergenic
1016120911 6:140340198-140340220 ACTTAAAAGCAGAGAAGGAAAGG + Intergenic
1016639442 6:146332394-146332416 GCTAATAGGCAGCAAAGAAATGG - Intronic
1016693685 6:146967505-146967527 AGGTATAAGGAGCAAAGCAAGGG - Intergenic
1018659163 6:166069199-166069221 AATTATAAGGAGCTTAGGAAAGG - Intergenic
1019244239 6:170697181-170697203 GCTAATAAGCAGCCAAGGAGTGG - Intergenic
1020697012 7:11424935-11424957 AATAATAAGCAGTAAAGGAGGGG - Intronic
1020823132 7:12995496-12995518 ATATATAAGCAGCACAGAAAAGG + Intergenic
1021541404 7:21762889-21762911 GCTTCTATACAGCAAAGGAAAGG + Intronic
1022754343 7:33269499-33269521 GCTTAGAGGCAGCAGAGGAATGG - Intronic
1023060371 7:36320899-36320921 ATTTCTAAGCAGCAAAGCATTGG + Intergenic
1027698554 7:81439687-81439709 AGTTATATGCAGTAAAGGATTGG - Intergenic
1027733649 7:81906111-81906133 ACTAATGATCATCAAAGGAAAGG - Intergenic
1029507650 7:100971924-100971946 AATTATAAGCACCTGAGGAACGG - Intronic
1030200842 7:106902082-106902104 ACTTGGAGGCAGCAGAGGAAGGG + Intronic
1030841860 7:114363789-114363811 AAATATCAGCAGCAAAGGAAGGG - Intronic
1031182722 7:118437271-118437293 ACTTGAAGGCAGCAAAGGAAGGG - Intergenic
1031514430 7:122684626-122684648 TTTTATCAGCAGCAAAGGACTGG - Intronic
1031627060 7:124004167-124004189 GCTTAGAGGCAGCAAAGCAAGGG + Intergenic
1032736344 7:134695949-134695971 ACTTATATGCTGGAAAGGGAGGG - Intergenic
1034150711 7:148913224-148913246 ATTCATAAGCATCAAAGTAAAGG - Intergenic
1035503885 8:110979-111001 GCTAATAAGCAGCCAAGGAGTGG + Intergenic
1035593793 8:838201-838223 ACTTAAAAGGAACAAAGGGAGGG - Intergenic
1036584020 8:10106427-10106449 ACTTTTAAACAGTAGAGGAATGG - Intronic
1040452323 8:47560486-47560508 ACTTATAAGCAGAAACTGGAAGG - Intronic
1040831799 8:51685146-51685168 ACCTATAATCAGAATAGGAAGGG - Intronic
1041037488 8:53809329-53809351 AAATATAAGAATCAAAGGAAGGG + Intronic
1041573149 8:59360720-59360742 ACTTATAAGCAGCAAATGGTAGG - Intergenic
1041611457 8:59854737-59854759 ACTTGGAGGCAGCAGAGGAAGGG - Intergenic
1043421611 8:80104103-80104125 ACTTAAAAGCAGCTTAGAAATGG + Intronic
1043696630 8:83227608-83227630 ACTACTAATCAGCAAAAGAAGGG - Intergenic
1045246309 8:100444472-100444494 AATAATAAGCAGCAAAGTTAAGG + Intergenic
1045745224 8:105410822-105410844 ACTTATGAGTAAGAAAGGAAAGG - Intronic
1045834507 8:106504372-106504394 ACGTAAAAACAGCACAGGAAAGG - Intronic
1046213776 8:111115395-111115417 ACTTATAAACAGGAAACCAAAGG - Intergenic
1046891755 8:119429979-119430001 AGTGGTAAGCAGAAAAGGAAAGG - Intergenic
1047425343 8:124740271-124740293 AGTTATAATCAATAAAGGAATGG - Intergenic
1047490492 8:125370295-125370317 ATTTCTAAGCAGCAAAGCAAAGG - Intergenic
1047708249 8:127524045-127524067 ACTTACAAGCAGATAGGGAAAGG + Intergenic
1047987824 8:130254103-130254125 GCTTATAAGCATTACAGGAAAGG + Intronic
1050298174 9:4228053-4228075 ACTTATAAGAACAAAAGGGAAGG + Intronic
1050458098 9:5853258-5853280 GCTTCTAGGCAGAAAAGGAAAGG + Intergenic
1052095938 9:24384170-24384192 ACTTATAACCAGGAAGGTAAGGG - Intergenic
1052522680 9:29569289-29569311 ACTTGTAAGATGCAAAGGAAAGG - Intergenic
1052626248 9:30980840-30980862 ACCTGGAAGCAGCAGAGGAAGGG - Intergenic
1052659323 9:31407895-31407917 AGTTATATGAAGAAAAGGAAGGG - Intergenic
1053728811 9:41031441-41031463 ACTAATAAGAAGAAAATGAATGG - Intergenic
1054699697 9:68400642-68400664 ACTAATAAGAAGAAAATGAATGG + Intronic
1055376445 9:75653823-75653845 AATTTTAAGCAGCAAAGCAGGGG + Intergenic
1056519282 9:87385154-87385176 ACTAATTAGGACCAAAGGAAAGG + Intergenic
1057711544 9:97450083-97450105 TCTGATGATCAGCAAAGGAAAGG + Intronic
1058551445 9:106119843-106119865 ACATTTTACCAGCAAAGGAATGG - Intergenic
1059703639 9:116799800-116799822 ACTGATCAAGAGCAAAGGAAAGG + Intronic
1203604427 Un_KI270748v1:46405-46427 GCTAATAAGCAGCCAAGGAGTGG - Intergenic
1186136706 X:6529241-6529263 ACCTATAAGCAGTATAAGAAAGG + Intergenic
1186267637 X:7849189-7849211 ACCTATAAGCAGTATAAGAAAGG - Intergenic
1187346336 X:18468181-18468203 AATTATAATCAGCAAATGAATGG + Intronic
1188594576 X:31882997-31883019 ACATATATGCAGCAAAGGACAGG + Intronic
1188615428 X:32152593-32152615 ATTTATTATCAGCAAAAGAAAGG - Intronic
1188769912 X:34140492-34140514 ATGTAAAAGGAGCAAAGGAAAGG - Intergenic
1188957944 X:36455858-36455880 ACTTATAAGCAGGAAGAGATGGG + Intergenic
1191752073 X:64553607-64553629 ACTTAGAATAAGCAAATGAAAGG + Intergenic
1192956535 X:76076386-76076408 ACTCAGAAGCAGCAGAGGAAAGG - Intergenic
1192992697 X:76477885-76477907 TCTTATAAGCAGCAGATCAATGG + Intergenic
1193006010 X:76618593-76618615 ACTTGGAGGCAGCAGAGGAAGGG - Intergenic
1193299111 X:79867976-79867998 ACTTGGAGGCAGCAGAGGAAGGG - Intergenic
1193497861 X:82236652-82236674 ACTTGGAGGCAGCAGAGGAAGGG + Intergenic
1193607307 X:83584052-83584074 ACTTAAAGGCAGCAGAGGAAGGG - Intergenic
1193714864 X:84926533-84926555 ACTTGGAGGCAGCAGAGGAAGGG + Intergenic
1194160555 X:90444730-90444752 ATTTAAAAACAGGAAAGGAAGGG - Intergenic
1194464359 X:94213903-94213925 AATTAAAAGAAGAAAAGGAAAGG + Intergenic
1194593906 X:95835395-95835417 ACTTGGAGGCAGCAGAGGAAGGG + Intergenic
1194736806 X:97521810-97521832 TCTTCAAAGCAGCATAGGAATGG + Intronic
1194948116 X:100092241-100092263 ACTTGGAGGCAGCAGAGGAAGGG - Intergenic
1195148914 X:102045081-102045103 ACTTGTAAGCAGCAGAGAAAGGG - Intergenic
1195473443 X:105259449-105259471 ACTTGGAAGCAGCAGAGGAAGGG + Intronic
1195856441 X:109337892-109337914 ACTTGGAGGCAGCAGAGGAAGGG + Intergenic
1196562878 X:117172335-117172357 TATTATAAGCAGCAAATGAAAGG + Intergenic
1198405346 X:136306566-136306588 ACTTTTAAAAATCAAAGGAAAGG - Intronic
1198737309 X:139800953-139800975 ACTAATAAGCAAAAAAGAAATGG + Intronic
1198752454 X:139949308-139949330 AATTAGAAGCAACAAAGGAAGGG - Intergenic
1199235565 X:145488403-145488425 GCTTCTAAGAAGCAAAGAAATGG - Intergenic
1199249092 X:145638528-145638550 ACTTGGAGGCAGCAAAGGAAGGG - Intergenic
1199302196 X:146226131-146226153 ACTGATAAGGAGCTAAGGAATGG + Intergenic
1201438041 Y:13980508-13980530 ACCTATAAGCAGTATAAGAAAGG + Intergenic
1202076966 Y:21045792-21045814 ATTTAGAAGAAGCAAGGGAAAGG + Intergenic
1202386483 Y:24331451-24331473 GCTAATAAGCAGCCAAGGAGTGG - Intergenic
1202484303 Y:25338677-25338699 GCTAATAAGCAGCCAAGGAGTGG + Intergenic